- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Lamb, T. M.
- Articles by Mitchell, A. P.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Lamb, T. M.
- Articles by Mitchell, A. P.
Coupling of Saccharomyces cerevisiae Early Meiotic Gene Expression to DNA Replication Depends Upon RPD3 and SIN3
Teresa M. Lamba and Aaron P. Mitchellaa Department of Microbiology and Institute of Cancer Research, Columbia University, New York, New York 10032
Corresponding author: Aaron P. Mitchell, Department of Microbiology, Columbia University, 701 W. 168th St., New York, NY 10032., apm4{at}columbia.edu (E-mail)
| ABSTRACT |
|---|
It has been established that meiotic recombination and chromosome segregation are inhibited when meiotic DNA replication is blocked. Here we demonstrate that early meiotic gene (EMG) expression is also inhibited by a block in replication. Since early meiotic genes are required to promote meiotic recombination and DNA division, the low expression of these genes may contribute to the block in meiotic progression. We have identified three Hur- (HU reduced recombination) mutants that fail to couple meiotic recombination and gene expression with replication. One of these mutations is in RPD3, a gene required to maintain meiotic gene repression in mitotic cells. Complete deletions of RPD3 and the repression adapter SIN3 permitted recombination and early meiotic gene expression when replication was inhibited with hydroxyurea (HU). Biochemical analysis showed that the Rpd3p-Sin3p-Ume6p repression complex does exist in meiotic cells. These observations suggest that repression of early meiotic genes by SIN3 and RPD3 is critical for the normal response to inhibited replication. A second response to inhibited replication has also been discovered. HU-inhibited replication reduced the accumulation of phospho-Ume6p in meiotic cells. Phosphorylation of Ume6p normally promotes interaction with the meiotic activator Ime1p, thereby activating EMG expression. Thus, inhibited replication may also reduce the Ume6p-dependent activation of EMGs. Taken together, our data suggest that both active repression and reduced activation combine to inhibit EMG expression when replication is inhibited.
MEIOSIS and sporulation comprise a complex developmental pathway that the diploid yeast Saccharomyces cerevisiae undergoes when starved for nitrogen and a fermentable carbon source (reviewed in ![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Progression through the meiotic pathway is controlled by the activation of temporally distinct classes of meiosis-specific genes (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Several early meiotic genes are required to promote middle and late gene expression (![]()
![]()
![]()
![]()
![]()
![]()
There are two regulatory mechanisms that govern early meiotic gene expression. Both mechanisms rely on Ume6p that binds to early meiotic promoters at the URS1 site (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
| MATERIALS AND METHODS |
|---|
Strains and media:
S. cerevisiae strains (see Table 1) derived from the SK-1 genetic background were used for all Northern blots, protein analysis, and for some ß-gal assays. The 1241 strain background was used for recombination testing and for some ß-gal assays. rpd3
::URA3 strains were constructed by transforming the XbaI cut plasmid pMV130 (![]()
::LEU2 strains were obtained by cross or by integration of a BamHI-XhoI fragment of plasmid pCS117 (![]()
![]()
|
SIN3-MYC was constructed as follows: A SIN3 complete open reading frame fragment was obtained from the AMP109 genome in a PCR with the oligos Sin3-up1 (5' CAGTCTTGTAACTACTGTTG) and Sin3-dwn1 (5' TACAATGTTATATCGTTGAC) and ligated into the plasmid pGEM-T (Promega, Madison, WI) to generate pTL13 plasmid. ApaI and NotI sites flanking the fragment were used to clone SIN3 into pRS424 plasmid to generate pTL15 plasmid. The oligos Sin3-PET-up (5' AATATAGAAACGACTGGGAATACTGAATCTTCAGACAAGGGGGCTAAGATTCAAAGGGAACAAAAGCTGG) and Sin3 PET-dwn (5' GAAGAAAGACCCTGTCGTACTAAAGATTTTTGTTCTAAATCTAGTTAAAACTACCTATAGGGCGAATTGG) were used in a PCR on the plasmid pMPY-MYC (![]()
A similar strategy was used to generate RPD3-HA, which contains a triple HA tag at the C terminus of the protein.
Yeast and bacterial media, including Luria broth, yeast extract-peptone-dextrose (YPD), yeast extract-peptone-potassium acetate (YPAc), synthetic complete (SC), sporulation medium (SPO), and 5-FOA, were prepared as previously described (![]()
Plasmid/genome recombination assay:
Strains of the 1241 background were used to monitor recombination between a genomic copy of leu2-c and a plasmid-borne leu2-e allele (pSR1 or pTL5). leu2-c and leu2-e are frameshift mutations produced by filling in and religating the LEU2 ClaI and EcoRI sites, respectively, and were provided by G. S. Roeder. Recombination between these two alleles can generate a wild-type LEU2 gene. The production of Leu+ descendants is stimulated by sporulation medium in rme1, but not RME1 haploids, suggesting that this assay recapitulates key features of meiotic chromosome metabolism. Independent nonpetite pSR1 (leu2e allele in a URA3 marked CEN plasmid) transformants were patched on SC-Ura and grown for 2 days. These were then replicated to SC-Ura, SPO, or SPO + 40 mM HU plates. After 2 days on SC-Ura or 4 days on SPO ± HU they were replicated to SC-Ura-Leu to assess recombination or SC-Ura to assess viability. To quantitate recombination, independent pTL5 (leu2e allele in a TRP1 marked CEN plasmid) transformants were patched on SC-Trp and replicated to nylon filters on SC-Trp, SC-Trp + 40 mM HU, SPO, or SPO + 40 mM HU plates. At the times indicated above, three patches of each strain were resuspended in water, diluted to appropriate densities, and plated on SC-Trp and SC-Trp-Leu. Recombination frequencies were calculated as the number of Trp+Leu+ colonies divided by the number of Trp+ colonies.
Mutagenesis, screen, and cloning:
TLY 77 cells carrying pSR1 and pREY138, an IME2-lacZ TRP1 plasmid (![]()
20% survival and plated on SC-Ura-Trp. Approximately 50,000 colonies were screened for their ability to produce Leu+ papillae after incubation on SPO + 40 mM HU plates. Potential positives were retested and 43 isolates were found to be hyper-recombinogenic since they produced numerous Leu+ papillae after mitotic growth; these were discarded. For the remaining 137 isolates, production of Leu+ papillae depended on incubation in SPO medium and these were secondarily screened for their ability to promote IME2 expression. Forty-two isolates gave moderate induction of IME2-lacZ in the presence of HU and were purified, retested, and crossed to a wild-type strain to determine whether a single gene segregated with the Rec+ phenotype. Twenty-two isolates showed a clear 2:2 segregation pattern and were examined further. Cross-complementation suggested that these mutations fell into at least three groups, but it also revealed that a hur-B51/hur-B51 diploid failed to sporulate. Complementation cloning revealed that hur-B51 is an allele of RPD3 and recovery of hur-B51 from the genome showed that the mutation was a C to T transversion at nucleotide 1255 creating a TAA stop codon. We have also identified SOK1, a dosage suppressor of the tpk1 tpk2 tpk3 triple mutant lethality (![]()
![]()
Miscellaneous:
For Northern analysis, RNA was isolated and 10 to 20 µg were run on formaldehyde denaturing gels, transferred to nylon membranes, and probed for IME1, IME2, SPO13, HOP1, and PC4-2 as described (![]()
![]()
![]()
-32P]dCTP using High Prime (Roche) labeling mix, hybridized, and washed according to standard procedure. Quantitation was carried out as described (Fig 3). The plasmids pKB852 and pTL7 contain the IME2 5' region (from -852 to -18 from the AUG) fused to -CYC1-lacZ. For ß-galactosidase assays, o-nitrophenyl-ß-D-galactopyranoside color reactions were carried out on permeabilized cells as described (![]()
|
|
|
Immunoprecipitation and Western blotting:
Protein extracts were prepared in "extraction buffer" (EB: 100 mM NaCl, 100 mM KCl, 1 mM EDTA, 5% glycerol, 0.05% ß-mercaptoethanol, 50 mM Tris-Cl pH 7.4 supplemented with protease inhibitors, 0.15 mg/ml phenylmethylsulfonyl fluoride, 1 µg/ml each leupeptin, aprotinin, and pepstatin, and phosphatase inhibitors, 20 mM ß-glycero-phosphate, 10 mM p-nitrophenyl phosphate, 5 mM NaF, and 1 mM NaVO4), and protein concentration was determined with Bio-Rad (Hercules, CA) reagent as described (![]()
![]()
| RESULTS |
|---|
Impaired replication downregulates early meiotic gene expression:
We used Northern analysis to test whether the expression of early meiotic genes is responsive to impaired replication. An rme1
haploid strain that can undergo the early events of meiosis was initially examined (Fig 1) to provide a basis for genetic studies, but diploids showed a similar response (see below). Cells shifted to SPO induced the expression of IME1, which in turn activated expression of the early meiotic genes IME2, SPO13, and HOP1 (Fig 1, lanes 2, 4, and 6). When DNA synthesis was impaired by the ribonucleotide reductase inhibitor HU, IME1 was induced at a slightly lower level (Fig 1, lanes 3, 5, and 7). Transcript accumulation of the early genes IME2, SPO13, and HOP1, however, was severely reduced by HU. The reduction of early meiotic transcripts in response to HU was not due to cell death because cells that were washed free of HU after an 8-hr treatment remained competent to express early meiotic genes (Fig 1, lane 8). Thus, HU caused a reversible reduction in early meiotic gene expression.
To determine whether the 5' regulatory region of an early meiotic gene was the target of replication control, we tested the HU response of an IME2-CYC1-lacZ reporter (abbreviated IME2-lacZ; Table 2). If the IME2 5'-region is a target for regulation, then ß-galactosidase activity should respond to HU just like the meiotic transcripts. We verified that IME2-lacZ was under meiosis-specific control in these strains by showing that an RME1 haploid (TLY 78) failed to express IME2-lacZ and that a rme1
haploid (TLY 77) induced IME2-lacZ more than 100-fold in response to sporulation medium. In the presence of HU, the rme1
haploid failed to substantially induce IME2-lacZ. These results suggest that the reduction of early meiotic gene expression in response to HU is mediated by 5' regulatory sequences.
|
Early meiotic gene activation is dependent on IME1 (![]()
Screen for genes that couple replication with recombination and EMG expression:
To learn how HU-blocked replication caused inhibition of early meiotic gene expression and recombination, we designed a screen to identify genes required for the HU response. To monitor recombination in haploids, we constructed strains carrying leu2-c in the genome and leu2-e on a plasmid and assessed the production of Leu+ progeny on plates. This assay maintains three critical features of meiotic recombination: (i) dependence on sporulation medium (Fig 2 and Table 3), (ii) inhibition by RME1 (not shown), and (iii) inhibition by HU (Fig 2 and Table 3). It is also sufficiently robust to monitor the response of single colonies. Thus, this recombination assay and the IME2-lacZ assay described above can be used to monitor meiotic progression in rme1
haploids.
|
We used these assays to perform a screen for mutants that maintain the ability to recombine at meiotic levels and permit IME2 transcription when meiotic replication is impaired. Cells were EMS mutagenized and screened for their ability to give rise to Leu+ papillae after incubation on sporulation medium containing 40 mM HU. Potential positives were secondarily screened for the ability to express IME2-lacZ in the presence of HU. The phenotypes of three Hur- (HU reduced recombination) mutants are shown in Fig 2 and Table 4. Wild-type cells and the Hur- mutants all produced Leu+ papillae after incubation on sporulation medium (Fig 2). Addition of 40 mM HU severely inhibited recombination in the wild-type strain, moderately inhibited recombination in Hur B42 and Hur B51 strains, and had very little effect on recombination in the Hur E3 strain. The reduced Leu+ papillation of the wild-type strain was not due to reduced viability, and all strains failed to papillate after growth on SC-Trp, indicating that they still required a starvation signal to induce recombination. The IME2-lacZ response of these strains was very similar (Table 4). Wild-type cells and the Hur- mutants all promoted IME2 reporter activity in sporulation medium. Addition of 40 mM HU severely inhibited expression in the wild-type strain (1000-fold reduction), moderately inhibited expression in the Hur B42 strain (30-fold reduction), and only weakly inhibited expression in the Hur B51 and Hur E3 strains (8- and 4-fold reduction, respectively). Thus, the Hur- mutants are defective in reducing recombination and meiotic gene expression when replication is inhibited.
|
We found that a hur-B51 diploid failed to sporulate, suggesting that besides preventing meiotic gene expression and recombination in the presence of HU, it also functions in normal meiosis (data not shown). A YCp50 genomic clone (![]()
14.2 kb of chromosome XIV including RPD3, PEX6, YNL328c, and EGT2. A plasmid containing only RPD3 also rescued the sporulation defect. A cross of TLY 356 (hur-B51) and an RPD3-URA3 strain indicated tight hur-B51-RPD3 linkage because the Hur- phenotype always segregated away from Ura+ (16 tetrads). Also, a hur-B51/rpd3
strain was sporulation defective. Therefore, linkage and complementation indicated that the Hur B51 strain carried a mutation in RPD3. Recovery of RPD3 from the genome of a Hur B51 strain and subsequent sequencing showed that it encoded a protein truncated by 15 amino acids at the C terminus, Rpd3-418*p. These results indicate that RPD3 is required to couple early meiotic gene activation and recombination with replication.
Role of mitotic repressor genes in the response to impaired replication:
The isolation of an RPD3 allele that reduced the response to HU suggested that the Rpd3p-Sin3p repression complex might be critical for a normal response to impaired replication. Therefore, we examined the effects of HU on recombination (Table 3) and gene expression (Table 4) in rpd3
and sin3
mutants. Wild-type, rpd3
, and sin3
strains have a low frequency of recombination (
4 x 10-6) in mitotic culture (SC). HU stimulated recombination to the same extent in these three strains during mitotic growth in SC medium (SC + HU). A shift to sporulation medium promoted recombination
100-fold over the mitotic (SC) values. HU inhibited the production of meiotic recombinants (SPO + HU) in a wild-type strain by 16-fold; however, rpd3
and sin3
strains were reduced only 5- to 2.5-fold, respectively. Similarly, HU inhibited IME2-lacZ expression in a wild-type strain by 100-fold, while rpd3
and sin3
strains were reduced only 2.5- to 3-fold, respectively. Furthermore, when rpd3-418* was introduced into this strain background, IME2-lacZ expression was reduced only 5-fold by HU. Thus, RPD3 and SIN3 are required for the full recombination and gene expression responses to impaired replication.
To determine the effect of HU on expression of early meiotic genes in diploids, we performed Northern analysis (Fig 3). As expected, IME1 transcript levels were only slightly reduced by HU (quantitated in Fig 3C and Fig D). IME2 and HOP1 were poorly expressed in the wild-type diploid treated with HU. At the 6-hr timepoint, IME2 levels were reduced 6-fold and HOP1 levels were reduced nearly 10-fold by HU in the wild-type strain. In rpd3
and sin3
diploids there was a low but detectable level of IME2 and HOP1 in mitotically growing cells because of the lack of mitotic repression (Fig 3A, lane 8 and 3B, lane 1). When the mutants were shifted to sporulation medium containing HU, there was greater expression of early genes than in similarly treated wild-type cells, and this expression increased with time. For example at 6 hr, the rpd3
mutant had less than a 2-fold reduction in IME2 and little reduction of HOP1 expression in response to HU (Fig 3C). Thus, mutation of RPD3 or SIN3 permits induction of early genes in the presence of HU, suggesting that the Rpd3p/Sin3p complex represses meiotic gene expression when replication is inhibited.
One possible explanation for the reduced meiotic checkpoint response of rpd3
and sin3
mutants is that they have general defects in HU uptake or response. Two lines of evidence argue against this explanation. First, FACS analysis of cells taken from this experiment showed that HU blocked DNA synthesis in both wild-type and rpd3
diploids (data not shown). Second, HU treatment induced RNR2 expression in rpd3
and sin3
mutants (Fig 3A, and data not shown). Therefore, deletion of these genes did not simply bypass the normal DNA damage transcriptional response, nor did it permit HU-resistant DNA synthesis. Taken together, our data suggest that Rpd3p and Sin3p cooperate to repress early meiotic gene expression when replication is inhibited.
Impaired replication inhibits modification of Ume6p:
In mitosis the Rpd3p-Sin3p complex promotes repression of early meiotic genes through their interaction with the DNA-binding protein Ume6p (![]()
![]()
140-kD band. Incubation in sporulation medium shifted the Ume6-HAp band up, but the presence of HU reduced that shift. Our observations support the idea that a blocked replication signal may reduce early meiotic gene expression by inhibiting Ume6p phosphorylation.
|
The repression complex exists in sporulating cells:
Prior studies of the repression complex were carried out in mitotic cells, so it was unknown whether it existed in meiotic cells. The existence of a meiotic repression complex seemed tenuous because SIN3 transcripts were not detected in stationary phase cultures (![]()
and sin3
mutants have a reduced response to impaired meiotic replication, we suspected that the repression complex did exist and that it played a role in meiosis. To detect these proteins, we generated an anti-Rpd3p antibody and a functional MYC-tagged version of Sin3p. Expression of SIN3-MYC was controlled by the endogenous SIN3 promoter. Total protein extracts were obtained from a mitotic culture (Fig 5, lane 2) or 4 hr after a shift to sporulation medium in the absence (lane 3) or presence (lane 4) of 40 mM HU. Immunodetection of Sin3-MYCp and Rpd3p showed that their levels were relatively insensitive to sporulation medium or HU. We confirmed that HU inhibited Ime2p expression in this experiment by Western analysis (data not shown). Thus, Rpd3p and Sin3p are present in early meiotic cells, and HU does not cause an increase in the concentration of these repression proteins.
|
Although protein levels were maintained in sporulation medium, it seemed possible that association of the repression components would be altered. This idea was especially attractive because of the sporulation-induced Ume6p modification. To determine whether the association of the repression complex subunits was affected by a shift to sporulation medium or sensitive to impaired replication, Rpd3p immune complexes were obtained and the components analyzed by Western blot (Fig 5, lanes 57). Sin3-MYCp and Ume6-HAp were detected in Rpd3p-immune complexes isolated from both mitotic and sporulating cultures. Furthermore, complex formation was not grossly affected by HU. These data suggest that modification of Ume6p does not affect association and that inhibited replication does not increase the amount of the repression complex.
| DISCUSSION |
|---|
Previous studies had shown that inhibition of meiotic replication blocked the progression of meiosis (![]()
![]()
![]()
The coupling of meiotic gene expression and recombination to replication comprises a bona fide checkpoint, as defined by ![]()
![]()
![]()
One of the Hur- mutations lies in RPD3, and deletions of SIN3 and RPD3 partially uncoupled meiotic gene expression and recombination from replication. The model that cell cycle arrest and accumulation of derepressed meiotic transcripts in sin3
and rpd3
strains accounts for their meiotic recombination rate in the presence of HU seems unlikely, because cells arrested mitotically with HU fail to achieve SPO + HU recombination levels. However, SIN3 and RPD3 are not classical checkpoint genes since deletants still partially respond to inhibited replication. Furthermore, because of their natural positive roles in promoting middle meiotic gene expression and nuclear divisions (![]()
![]()
![]()
and rpd3
strains would not divide meiotically in the presence of HU. Thus, other checkpoint targets must exist that can account for the full response. In this regard, we showed that the phosphorylation of Ume6p, which is required for early meiotic gene expression, is inhibited when replication is blocked. Thus, the response to inhibited replication relies upon both reduced activation and active repression to inhibit early meiotic gene expression. A model that summarizes our findings on the coupling of meiotic gene expression with replication and incorporates speculation about the natural roles of SIN3 and RPD3 in meiosis is outlined in Fig 6.
|
The coupling of EMG expression to replication depends on SIN3 and RPD3:
In mitosis, Rpd3p interacts with Sin3p, which interacts with the DNA-binding protein Ume6p to repress early meiotic genes (![]()
![]()
![]()
SIN3 and RPD3 are normally positive regulators of meiosis because sin3 and rpd3 mutants are defective in sporulation, fail to express middle meiotic genes and undergo nuclear divisions, and have reduced expression of early meiotic genes (![]()
![]()
![]()
It seems likely that the ability of sin3 and rpd3 mutants to permit some meiotic recombination in the presence of HU is a consequence of early meiotic gene expression. However, rpd3 was recently found to be an allele of rec3, a mutant with reduced mitotic recombination rates (![]()
Control of Ume6p phosphorylation by inhibited replication:
Upon a shift to sporulation medium, Ume6p becomes hyper-phosphorylated in vivo (![]()
![]()
![]()
![]()
![]()
![]()
![]()
Relationship between EMG regulators and replication checkpoint control:
Combined with the work of ![]()
| ACKNOWLEDGMENTS |
|---|
We thank Dana Davis and Vincent Bruno for critical reading of the manuscript; Malathi Krishnamurthy and Yang Xiao for stimulating discussions; Shirleen Roeder, Steve Elledge, Mark Vidal, and David Stillman for gifts of plasmids. This work was supported by a Jane Coffin Childs Fellowship to T.M.L., a National Institutes of Health (NIH) grant (GM39531) to A.P.M., and an NIH training grant (T32 AI07161).
Manuscript received May 25, 2000; Accepted for publication November 3, 2000.
| LITERATURE CITED |
|---|
ANDERSON, S. F., C. M. STEBER, R. E. ESPOSITO, and J. E. COLEMAN, 1995 UME6, a negative regulator of meiosis in Saccharomyces cerevisiae, contains a C-terminal Zn2Cys6 binuclear cluster that binds the URS1 DNA sequence in a zinc-dependent manner. Protein Sci. 4:1832-1843[Medline].
BOWDISH, K. S. and A. P. MITCHELL, 1993 Bipartite structure of an early meiotic upstream activation sequence from Saccharomyces cerevisiae. Mol. Cell. Biol. 13:2172-2181
BOWDISH, K. S., H. E. YUAN, and A. P. MITCHELL, 1994 Analysis of RIM11, a yeast protein kinase that phosphorylates the meiotic activator IME1. Mol. Cell. Biol. 14:7909-7919
BOWDISH, K. S., H. E. YUAN, and A. P. MITCHELL, 1995 Positive control of yeast meiotic genes by the negative regulator UME6. Mol. Cell. Biol. 15:2955-2961
CHU, S. and I. HERSKOWITZ, 1998 Gametogenesis in yeast is regulated by a transcriptional cascade dependent on Ndt80. Mol. Cell 1:685-696[Medline].
CHU, S., J. DERISI, M. EISEN, J. MULHOLLAND, and D. BOTSTEIN et al., 1998 The transcriptional program of sporulation in budding yeast. Science 282:699-705
DIRICK, L., L. GOETSCH, G. AMMERER, and B. BYERS, 1998 Regulation of meiotic S phase by Ime2 and a Clb5,6-associated kinase in Saccharomyces cerevisiae. Science 281:1854-1857
DORA, E. G., N. RUDIN, J. R. MARTELL, M. S. ESPOSITO, and R. M. RAMIREZ, 1999 RPD3 (REC3) mutations affect mitotic recombination in Saccharomyces cerevisiae. Curr. Genet. 35:68-76[Medline].
ELLEDGE, S. J. and R. W. DAVIS, 1987 Identification and isolation of the gene encoding the small subunit of ribonucleotide reductase from Saccharomyces cerevisiae: DNA damage-inducible gene required for mitotic viability. Mol. Cell. Biol. 7:2783-2793
ESPOSITO, M. S., M. BOLOTIN-FUKUHARA, and R. E. ESPOSITO, 1975 Antimutator activity during mitosis by a meiotic mutant of yeast. Mol. Gen. Genet. 139:9-18[Medline].
HARTWELL, L. H. and T. A. WEINERT, 1989 Checkpoints: controls that ensure the order of cell cycle events. Science 246:629-634
HEPWORTH, S. R., H. FRIESEN, and J. SEGALL, 1998 NDT80 and the meiotic recombination checkpoint regulate expression of middle sporulation-specific genes in Saccharomyces cerevisiae. Mol. Cell. Biol. 18:5750-5761
HOLAWAY, B. L., D. J. LEHMAN, D. A. PRIMERANO, P. T. MAGEE, and M. J. CLANCY, 1985 Sporulation-regulated genes of Saccharomyces cerevisiae. Curr. Genet. 10:163-169[Medline].
HOLLINGSWORTH, N. M. and B. BYERS, 1989 HOP1: a yeast meiotic pairing gene. Genetics 121:445-462
KADOSH, D. and K. STRUHL, 1997 Repression by Ume6 involves recruitment of a complex containing Sin3 corepressor and Rpd3 histone deacetylase to target promoters. Cell 89:365-371[Medline].
KAISER, C., S. MICHAELIS and A. MITCHELL, 1994 Methods in Yeast Genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
KAO, G., D. G. MANNIX, B. L. HOLAWAY, M. C. FINN, and A. E. BONNY et al., 1989 Dependence of inessential late gene expression on early meiotic events in Saccharomyces cerevisiae. Mol. Gen. Genet. 215:490-500[Medline].
KASSIR, Y., D. GRANOT, and G. SIMCHEN, 1988 IME1, a positive regulator gene of meiosis in S. cerevisiae. Cell 52:853-862[Medline].
KASTEN, M. M., S. DORLAND, and D. J. STILLMAN, 1997 A large protein complex containing the yeast Sin3p and Rpd3p transcriptional regulators. Mol. Cell. Biol. 17:4852-4858
KLAPHOLZ, S., C. S. WADDELL, and R. E. ESPOSITO, 1985 The role of the SPO11 gene in meiotic recombination in yeast. Genetics 110:187-216
KUPIEC, M., B. BYERS, R. E. ESPOSITO and A. P. MITCHELL, 1997 Meiosis and sporulation in Saccharomyces cerevisiae, pp. 8891036 in The Molecular and Cellular Biology of the Yeast Saccharomyces: Cell Cycle and Cell Biology, edited by J. R. PRINGLE, J. R. BROACH and E. W. JONES. Cold Spring Harbor Laboratory Press, Plainview, NY.
MALATHI, K., Y. XIAO, and A. P. MITCHELL, 1997 Interaction of yeast repressor-activator protein Ume6p with glycogen synthase kinase 3 homolog Rim11p. Mol. Cell. Biol. 17:7230-7236
MATSUURA, A., M. TREININ, H. MITSUZAWA, Y. KASSIR, and I. UNO et al., 1990 The adenylate cyclase/protein kinase cascade regulates entry into meiosis in Saccharomyces cerevisiae through the gene IME1. EMBO J. 9:3225-3232[Medline].
MENEES, T. M. and G. S. ROEDER, 1989 MEI4, a yeast gene required for meiotic recombination. Genetics 123:675-682
MITCHELL, A. P., 1994 Control of meiotic gene expression in Saccharomyces cerevisiae. Microbiol. Rev. 58:56-70
MITCHELL, A. P., S. E. DRISCOLL, and H. E. SMITH, 1990 Positive control of sporulation-specific genes by the IME1 and IME2 products in Saccharomyces cerevisiae. Mol. Cell. Biol. 10:2104-2110
NAVAS, T. A., Z. ZHOU, and S. J. ELLEDGE, 1995 DNA polymerase epsilon links the DNA replication machinery to the S phase checkpoint. Cell 80:29-39[Medline].
ROSE, M. D., P. NOVICK, J. H. THOMAS, D. BOTSTEIN, and G. R. FINK, 1987 A Saccharomyces cerevisae genomic plasmid bank based on a centromere-containing shuttle vector. Gene 60:237-243[Medline].
RUBIN-BEJERANO, I., S. MANDEL, K. ROBZYK, and Y. KASSIR, 1996 Induction of meiosis in Saccharomyces cerevisiae depends on conversion of the transcriptional represssor Ume6 to a positive regulator by its regulated association with the transcriptional activator Ime1. Mol. Cell. Biol. 16:2518-2526
RUNDLETT, S. E., A. A. CARMEN, N. SUKA, B. M. TURNER, and M. GRUNSTEIN, 1998 Transcriptional repression by UME6 involves deacetylation of lysine 5 of histone H4 by RPD3. Nature 392:831-835[Medline].
SANCHEZ, Y., B. A. DESANY, W. J. JONES, Q. LIU, and B. WANG et al., 1996 Regulation of RAD53 by the ATM-like kinases MEC1 and TEL1 in yeast cell cycle checkpoint pathways. Science 271:357-360[Abstract].
SANCHEZ, Y., J. BACHANT, H. WANG, F. HU, and D. LIU et al., 1999 Control of the DNA damage checkpoint by chk1 and rad53 protein kinases through distinct mechanisms. Science 286:1166-1171
SCHNEIDER, B. L., W. SEUFERT, B. STEINER, Q. H. YANG, and A. B. FUTCHER, 1995 Use of polymerase chain reaction epitope tagging for protein tagging in Saccharomyces cerevisiae. Yeast 11:1265-1274[Medline].
SIA, R. A. and A. P. MITCHELL, 1995 Stimulation of later functions of the yeast meiotic protein kinase Ime2p by the IDS2 gene product. Mol. Cell. Biol. 15:5279-5287
SILVIA-LOPEZ, E., T. J. ZAMB, and R. ROTH, 1975 Role of premeiotic replication in gene conversion. Nature 253:212-214[Medline].
SIMCHEN, G., D. IDAR, and Y. KASSIR, 1976 Recombination and hydroxyurea inhibition of DNA synthesis in yeast meiosis. Mol. Gen. Genet. 144:21-27[Medline].
SIMCHEN, G., Y. KASSIR, O. HORESH-CABILLY, and A. FRIEDMANN, 1981 Elevated recombination and pairing structures during meiotic arrest in yeast of the nuclear division mutant cdc5. Mol. Gen. Genet. 184:46-51[Medline].
SMITH, H. E. and A. P. MITCHELL, 1989 A transcriptional cascade governs entry into meiosis in Saccharomyces cerevisiae. Mol. Cell. Biol. 9:2142-2152
SOUSHKO, M. and A. P. MITCHELL, 2000 An RNA-binding protein homologue that promotes sporulation-specific gene expression in Saccharomyces cerevisiae. Yeast 16:631-639[Medline].
STEBER, C. M. and R. E. ESPOSITO, 1995 UME6 is a central component of a developmental regulatory switch controlling meiosis-specific gene expression. Proc. Natl. Acad. Sci. USA 92:12490-12494
STRICH, R., R. T. SUROSKY, C. STEBER, E. DUBOIS, and F. MESSENGUY et al., 1994 UME6 is a key regulator of nitrogen repression and meiotic development. Genes Dev. 8:796-810
STUART, D. and C. WITTENBERG, 1998 CLB5 and CLB6 are required for premeiotic DNA replication and activation of the meiotic S/M checkpoint. Genes Dev. 12:2698-2710
VIDAL, M. and R. F. GABER, 1991 RPD3 encodes a second factor required to achieve maximum positive and negative transcriptional states in Saccharomyces cerevisiae. Mol. Cell. Biol. 11:6317-6327
VIDAL, M., R. STRICH, R. E. ESPOSITO, and R. F. GABER, 1991 RPD1 (SIN3/UME4) is required for maximal activation and repression of diverse yeast genes. Mol. Cell. Biol. 11:6306-6316
VIDAN, S. and A. P. MITCHELL, 1997 Stimulation of yeast meiotic gene expression by the glucose-repressible protein kinase Rim15p. Mol. Cell. Biol. 17:2688-2697
WANG, H., I. CLARK, P. R. NICHOLSON, I. HERSKOWITZ, and D. J. STILLMAN, 1990 The Saccharomyces cerevisiae SIN3 gene, a negative regulator of HO, contains four paired amphipathic helix motifs. Mol. Cell. Biol. 10:5927-5936
WARD, M. P. and S. GARRETT, 1994 Suppression of a yeast cyclic AMP-dependent protein kinase defect by overexpression of SOK1, a yeast gene exhibiting sequence similarity to a developmentally regulated mouse gene. Mol. Cell. Biol. 14:5619-5627
WEINERT, T. A. and L. H. HARTWELL, 1990 Characterization of RAD9 of Saccharomyces cerevisiae and evidence that its function acts posttranslationally in cell cycle arrest after DNA damage. Mol. Cell. Biol. 10:6554-6564
WEINERT, T. A., G. L. KISER, and L. H. HARTWELL, 1994 Mitotic checkpoint genes in budding yeast and the dependence of mitosis on DNA replication and repair. Genes Dev. 8:652-665
XIAO, Y. and A. P. MITCHELL, 2000 Shared roles of yeast glycogen synthase kinase-3 family members in nitrogen-responsive phosphorylation of the meiotic regulator Ume6p. Mol. Cell. Biol. 20:5447-5453
This article has been cited by other articles:
![]() |
K. Kugou, T. Fukuda, S. Yamada, M. Ito, H. Sasanuma, S. Mori, Y. Katou, T. Itoh, K. Matsumoto, T. Shibata, et al. Rec8 Guides Canonical Spo11 Distribution along Yeast Meiotic Chromosomes Mol. Biol. Cell, July 1, 2009; 20(13): 3064 - 3076. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Murakami and S. Keeney Regulating the formation of DNA double-strand breaks in meiosis Genes & Dev., February 1, 2008; 22(3): 286 - 292. [Full Text] [PDF] |
||||
![]() |
T. Inai, M. Yukawa, and E. Tsuchiya Interplay between Chromatin and trans-Acting Factors on the IME2 Promoter upon Induction of the Gene at the Onset of Meiosis Mol. Cell. Biol., February 15, 2007; 27(4): 1254 - 1263. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Pnueli, I. Edry, M. Cohen, and Y. Kassir Glucose and Nitrogen Regulate the Switch from Histone Deacetylation to Acetylation for Expression of Early Meiosis-Specific Genes in Budding Yeast Mol. Cell. Biol., June 15, 2004; 24(12): 5197 - 5208. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Stebbins and S. J. Triezenberg Identification, Mutational Analysis, and Coactivator Requirements of Two Distinct Transcriptional Activation Domains of the Saccharomyces cerevisiae Hap4 Protein Eukaryot. Cell, April 1, 2004; 3(2): 339 - 347. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. A. Pile, P. T. Spellman, R. J. Katzenberger, and D. A. Wassarman The SIN3 Deacetylase Complex Represses Genes Encoding Mitochondrial Proteins: IMPLICATIONS FOR THE REGULATION OF ENERGY METABOLISM J. Biol. Chem., September 26, 2003; 278(39): 37840 - 37848. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Murakami, V. Borde, T. Shibata, M. Lichten, and K. Ohta Correlation between premeiotic DNA replication and chromatin transition at yeast recombination initiation sites Nucleic Acids Res., July 15, 2003; 31(14): 4085 - 4090. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Honigberg and K. Purnapatre Signal pathway integration in the switch from the mitotic cell cycle to meiosis in yeast J. Cell Sci., June 1, 2003; 116(11): 2137 - 2147. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Sopko, S. Raithatha, and D. Stuart Phosphorylation and Maximal Activity of Saccharomyces cerevisiae Meiosis-Specific Transcription Factor Ndt80 Is Dependent on Ime2 Mol. Cell. Biol., October 15, 2002; 22(20): 7024 - 7040. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Schaber, A. Lindgren, K. Schindler, D. Bungard, P. Kaldis, and E. Winter CAK1 Promotes Meiosis and Spore Formation in Saccharomyces cerevisiae in a CDC28-Independent Fashion Mol. Cell. Biol., January 1, 2002; 22(1): 57 - 68. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Xu and A. P. Mitchell Yeast PalA/AIP1/Alix Homolog Rim20p Associates with a PEST-Like Region and Is Required for Its Proteolytic Cleavage J. Bacteriol., December 1, 2001; 183(23): 6917 - 6923. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. S. Brush, D. M. Clifford, S. M. Marinco, and A. J. Bartrand Replication protein A is sequentially phosphorylated during meiosis Nucleic Acids Res., December 1, 2001; 29(23): 4808 - 4817. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Davis, M. Barbera, A. McDonnell, K. McIntyre, R. Sternglanz, Q.-w. Jin, J. Loidl, and J. Engebrecht The Saccharomyces cerevisiae MUM2 Gene Interacts With the DNA Replication Machinery and Is Required for Meiotic Levels of Double Strand Breaks Genetics, March 1, 2001; 157(3): 1179 - 1189. [Abstract] [Full Text] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Lamb, T. M.
- Articles by Mitchell, A. P.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Lamb, T. M.
- Articles by Mitchell, A. P.
















