Genetics, Vol. 157, 79-89, January 2001, Copyright © 2001

A New Hyperrecombination Mutation Identifies a Novel Yeast Gene, THP1, Connecting Transcription Elongation With Mitotic Recombination

Mercedes Gallardoa and Andrés Aguileraa
a Departamento de Genética, Universidad de Sevilla, 41012 Seville, Spain

Corresponding author: Andrés Aguilera, Departamento de Genética, Facultad de Biología, Universidad de Sevilla, Avd. Reina Mercedes 6, 41012 Seville, Spain., aguilo{at}cica.es (E-mail)

Communicating editor: L. S. SYMINGTON


*  ABSTRACT
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Given the importance of the incidence of recombination in genomic instability, it is of great interest to know the elements or processes controlling recombination in mitosis. One such process is transcription, which has been shown to induce recombination in bacteria, yeast, and mammals. To further investigate the genetic control of the incidence of recombination and genetic instability and, in particular, its connection with transcription, we have undertaken a search for hyperrecombination mutants among a large number of strains deleted in genes of unknown function. We have identified a new gene, THP1 (YOL072w), whose deletion mutation strongly stimulates recombination between repeats. In addition, thp1{Delta} impairs transcription, a defect that is particularly strong at the level of elongation through particular DNA sequences such as lacZ. The hyperrecombination phenotype of thp1{Delta} cells is fully dependent on transcription elongation of the repeat construct. When transcription is impeded either by shutting off the promoter or by using a premature transcription terminator, hyperrecombination between repeats is abolished, providing new evidence that transcription-elongation impairment may be a source of recombinogenic substrates in mitosis. We show that Thp1p and two other proteins previously shown to control transcription-associated recombination, Hpr1p and Tho2p, act in the same "pathway" connecting transcription elongation with the incidence of mitotic recombination.


CONSIDERING the relevance of recombination for genomic stability in mitotically dividing eukaryotic cells and the association of genomic instability with cancer, it is important to understand the molecular basis of how DNA recombination is affected by other DNA transactions such as replication, repair, and transcription. Numerous studies in bacteria and eukaryotes have shown that failures during DNA replication or repair can generate DNA breaks or gaps that serve as substrates for recombinational repair, leading to an increase in mitotic recombination and genetic rearrangements (for reviews see KOGOMA 1997 Down; KUZMINOV 1999 Down; PAQUES and HABER 1999 Down; AGUILERA et al. 2000 Down).

Transcription has also been documented to induce recombination, but the molecular basis of this induction is far from clear. The first report on transcription-induced recombination was provided by IKEDA and MATSUMOTO 1979 Down who showed that recombination of phage {lambda} in Escherichia coli was stimulated by Rpo-mediated transcription. Afterwards, other cases have been reported in prokaryotes (DUL and DREXLER 1988 Down; VILETTE et al. 1992 Down). In yeast, the first example of transcription-induced recombination was provided by the demonstration that hyperrecombination caused by HOT1, a cis-acting recombination hotspot, was dependent on both the RNA polymerase I (RNAPI) enhancer contained in the HOT1 sequence (VOELKEL-MEIMAN et al. 1987 Down) and an active RNAPI (STEWART and ROEDER 1989 Down; HUANG and KEIL 1995 Down). Subsequently, recombination was also shown to be stimulated by RNA polymerase II (RNAPII)-driven transcription (THOMAS and ROTHSTEIN 1989 Down; GRIMM et al. 1991 Down; NEVO-CASPI and KUPIEC 1994 Down; BRATTY et al. 1996 Down). In mammalian cells, RNAPII-driven transcription has been shown to induce intrachromosomal recombination (NICKOLOFF 1992 Down) and gene targeting (THYAGARAJAN et al. 1995 Down). However, the most significant cases that reveal transcription as an inducer of recombination are those of V(D)J recombination (BLACKWELL et al. 1986 Down; LAUSTER et al. 1993 Down; OLTZ et al. 1993 Down) and class switching (DANIELS and LIEBER 1995 Down), two developmentally regulated recombination processes whose incidence depends on transcription. Transcription, therefore, has ended up acquiring an important role in the control of recombination in higher eukaryotes, as a consequence of its putative ability to generate recombinogenic substrates.

Some clues toward understanding the mechanisms of transcription-associated recombination have been provided by studies on the HPR1 and THO2 yeast genes. HPR1 was identified by a mutation conferring a strong increase in recombination between DNA repeats (AGUILERA and KLEIN 1988 Down) whereas THO2 was identified as a multicopy suppressor of hpr1{Delta} (PIRUAT and AGUILERA 1998 Down). Both null mutants are viable and stimulate recombination between direct repeats up to 3000-fold (AGUILERA and KLEIN 1989 Down; PIRUAT and AGUILERA 1998 Down). Such strong hyperrecombination phenotypes are absolutely dependent on RNAPII-driven transcription elongation. Only when RNAPII is engaged in transcription elongation through the DNA repeats or the regions between the repeats is the increase in recombination observed. If transcription through such DNA regions is impeded by means of a transcription terminator or by shutting off the promoter, hyperrecombination is abolished (CHAVEZ and AGUILERA 1997 Down; PRADO et al. 1997 Down; PIRUAT and AGUILERA 1998 Down). It is likely, therefore, that transcription-induced recombination is caused by some forms of transcription-elongation impairments associated with the generation of recombinogenic intermediates. Although the nature of these intermediates is yet to be determined, possibilities such as collisions between converging replication and transcription machineries (VILETTE et al. 1995 Down; PRADO et al. 1997 Down; MCGLYNN and LLOYD 2000 Down), the accumulation of negatively supercoiled DNA (CHRISTMAN et al. 1988 Down; THOMAS and ROTHSTEIN 1989 Down), or an RNA:DNA hybrid may be important.

Although the function of HPR1 and THO2 is not clear yet, their null mutations have consequences at different steps of mRNA metabolism, suggesting that they may be involved either in transcription or in a transcription-associated process. Yeast hpr1{Delta} and tho2{Delta} cells are defective in transcription elongation, a defect that is more pronounced at particular DNA sequences whose relevant features are yet to be identified (CHAVEZ and AGUILERA 1997 Down; PIRUAT and AGUILERA 1998 Down). The hpr1{Delta} mutations confer pleiotropic phenotypes such as thermosensitivity at 37°, synthetic lethality with the SIN1-2 mutation or with the imbalance of histones H3 and H4 (FAN and KLEIN 1994 Down; ZHU et al. 1995 Down), as well as very poor growth in either top1, top2, or top3 backgrounds (AGUILERA and KLEIN 1989 Down; A. AGUILERA, unpublished observations). The relationship of the phenotypes of hpr1{Delta} and tho2{Delta} with transcription is supported by the identification of mutations in genes related to the RNAPII holoenzyme such as HRS1/PGD1 and SRB2 (SANTOS-ROSA et al. 1996 Down; PIRUAT et al. 1997 Down) or SOH1, RPB2, SUA7 (FAN et al. 1996 Down) and the cap-binding protein gene GCR3 (UEMURA et al. 1996 Down) that suppress either hyperrecombination or thermosensitivity of hpr1{Delta} mutants, respectively. More important, Hpr1p has been found in association with RNAPII together with other proteins such as Paf1p, Cdc73p, and Ccr4p (CHANG et al. 1999 Down). A wider relationship of Hpr1p with RNA metabolism may be suggested by the observation that hpr1{Delta} cells are defective in poly(A)+-RNA export at 37°, although this phenotype might also be an indirect consequence of the effect of hpr1{Delta} on transcription (SCHNEITER et al. 1999 Down). Altogether, this evidence indicates that the incidence of mitotic recombination in the yeast Saccharomyces cerevisiae can be controlled by proteins such as Hpr1p with a clear effect on RNAPII-driven transcription.

To further investigate the genetic control of the incidence of recombination and genetic instability we have undertaken a search of hyperrecombination mutants among a collection of 609 yeast strains, each one carrying a deletion of an unessential gene of unknown function. We have identified a new gene, THP1 (YOL072w), that stimulates recombination between repeats, but in a transcription-dependent manner. Deletion of THP1 also impairs transcription, a defect that is particularly strong at the level of elongation. Genetic and molecular characterization of thp1{Delta} adds further evidence that transcription-elongation impairment triggers recombination in mitosis. We provide evidence that Hpr1p, Tho2p, and Thp1p act in the same "pathway" connecting transcription with recombination.


*  MATERIALS AND METHODS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Yeast strains and plasmids:
Yeast strains used in this study are listed in Table 1. All plasmids used to determine recombination frequencies (pRS314-L, pRS314-LY, pRS314-LNA, pRS314-LNAT, pSCh204, pSCh206, p414-GLlacZ, and pSG206) and enzymatic activities and mRNA expression levels (p416GAL1-lacZ and pSCh202) have been described previously (CHAVEZ and AGUILERA 1997 Down; PRADO et al. 1997 Down; PIRUAT and AGUILERA 1998 Down). Plasmid pUG34 carrying yEGFP (yeast enhanced green fluoresecent protein) under the MET25 promoter and a multiple cloning site at the N terminus of yEGFP (provided by J. HEGEMANN, Düsseldorf, Germany) was used to make GFP-Tho2p and GFP-Thp1p fusion constructs. To construct plasmid pUG34-T3 expressing GFP-Thp1p we amplified the 1.4-kb THP1 open reading frame (ORF) with the oligos ACTAGTATCGATGAATTCATGGACATGGCCAACCAG (3'-end) and GATATCATCGATCTCGAGTCACCAAAGAACGTGAG (5'-end), cut with EcoRI and XhoI, whose recognition sites were included in each oligo, respectively, and inserted into pUG34. Plasmid pUG34-T2 expressing GFP-Tho2p was constructed by inserting the 4.8-kb THO2 ORF flanked by artificially introduced XhoI sites into pUG34.


 
View this table:
In this window
In a new window

 
Table 1. Strains

Genetic analysis and determination of recombination frequencies:
Yeast genetic analysis was performed following standard procedures (KAISER et al. 1994 Down). Yeast transformation was done with lithium acetate as published (SCHIESTL and GIETZ 1989 Down). 5-fluoroorotic acid (5-FOA) was added at the concentration of 500 mg/liter to synthetic medium with 1 g/liter proline as the nitrogen source and G418 at the concentration of 200 mg/liter to YEPD.

Recombination frequencies were determined as the median value of six independent cultures obtained, in all cases, from colonies isolated in synthetic-complete medium containing 2% glucose as previously published (PRADO and AGUILERA 1995 Down). Recombinants were selected on either SC-leu or SC + FOA containing 2% glucose, except for direct-repeat constructs placed under the control of the GAL1 promoter, in which recombinants were selected on SC-leu containing 2% galactose. All values were obtained in duplicate for each strain analyzed.

Enzymatic assays:
ß-Galactosidase and acid phosphatase activities were assayed as described (GUARENTE et al. 1982 Down; HAGUENAUER-TSAPIS and HINNEN 1984 Down) in either permeabilized or whole cells, respectively. Midlog phase cells were inoculated in 3% glycerol-2% lactate synthetic medium at a concentration of 1.5–2.0 x 107 cells/ml. After 16 hr of incubation at 30° either 2% glucose or 2% galactose was added and reincubated for another 8 hr before assays were performed.

DNA manipulation:
Standard methods were used for [32P]dCTP-DNA labeling, DNA blotting, and hybridization (PIRUAT and AGUILERA 1998 Down). DNA amplification by PCR was performed with the expand-high-fidelity Taq polymerase (Roche Diagnostics, Barcelona).

RNA analysis:
Yeast RNA was prepared from midlog phase cultures, 2–3 days old, subjected to electrophoresis on formaldehyde agarose gels, and hybridized with radiolabeled DNA probes as previously published (CHAVEZ and AGUILERA 1997 Down). Filters were either hybridized with lacZ, PHO5, or LEU2 and rehybridized with ACT1, GAL1, and 28S rDNA after removal of previous signals or with HPR1, THO2, and THP1 and rehybridized with the 28S rDNA probes as specified. The 28S rDNA probe used was a 589-bp rRNA internal fragment obtained by PCR as previously described (CHAVEZ and AGUILERA 1997 Down). For quantification of results a ß-radiation Fuji FLA3000 was used. All data were normalized with respect to the 28S rRNA value.

Subcellular localization of GFP-Tho2p and GFP-Thp1p fusions:
Cells transformed with the corresponding derivative pUG34 plasmids were taken from midlog phase cultures grown on liquid SC-his containing methionine. Nuclei staining was done with a final concentration of 1 µg/ml 4',6-diamidino-2-phenylindole (DAPI) in 50 µl of glycerol-resuspended cells. GFP-fusion proteins and DAPI were localized by an Olympus AHBT3 microscope.


*  RESULTS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Deletion of THP1 (YOL072w) confers hyperrecombination:
We have determined the recombination frequencies of a number of yeast strains carrying deletions of novel nonessential genes uncovered by the sequencing of the yeast genome. Among 609 deletions (M. GALLARDO and A. AGUILERA, unpublished results) we have identified one conferring a strong hyperrecombination phenotype that has the features of transcription-dependent hyperrecombination mutants such as hpr1{Delta} and tho2{Delta}, two viable deletions that confer hyperrecombination in a transcription-dependent manner (PRADO et al. 1997 Down; PIRUAT and AGUILERA 1998 Down).

Deletion of the yeast ORF YOL072w confers a 137-fold increase above the wild-type levels in the frequency of recombination of the DNA recombination system LY based on two direct repeats of a 0.6-kb internal fragment of the LEU2 gene, flanking a 5.16-kb DNA fragment as the intervening sequence (Fig 1). Recombination in the inverted repeat system SU was increased 18-fold. However, no significant increase was observed in the L repeat system, which is identical to LY but without an intervening region between the repeats. This difference in the recombination frequency between both systems is similar to that previously found for hpr1{Delta} and tho2{Delta}. As a consequence we decided to determine whether the hyperrecombination phenotype caused by deletion of YOL072w was also dependent on transcription, using the DNA repeat systems LNA and LNAT.



View larger version (18K):
In this window
In a new window
Download PPT slide
 
Figure 1. (A) Scheme of the recombination event leading to a Leu+ deletion in the DNA repeat systems used in this study. Inversions (not shown) also reconstitute a wild-type LEU2 copy. (B) Frequencies of recombination (x105) of wild-type (W303-1A) and thp1{Delta} (WFBE046) strains transformed with centromeric plasmids pRS314-LY, pRS314-L, pRS314-LNA, pRS314-LNAT, and pRS314-SU containing the corresponding direct and inverted repeat systems. The data represent the median value of three/four fluctuation tests, each one performed with six independent colonies. DNA repeats are not drawn to scale. The mRNA synthesized by each direct system is drawn as an arrow. Thin lines represent pBR322 sequences and boxes represent yeast DNA sequences. The LEU2 promoter as well as the different transcription terminators are indicated by short vertical lines. The internal LEU2 600-bp repeat is shown as a shaded box.

System LNA is based on the same 0.6-kb leu2 repeat as L and LY, but with a 2.2-kb intervening region made of bacterial pBR322 and yeast URA3 sequences. As with all the L-derivative systems (PRADO et al. 1997 Down) transcription is driven from the LEU2 promoter, located outside of the repeat system, and proceeds into the intervening region flanked by the repeats. System LNAT is identical to LNA, but with the CYC1 trancription terminator located right after the first leu2 repeat sequence, thus impeding transcription from entering into the intervening region flanked by the repeats. As can be seen in Fig 1, whereas deletion of YOL072w increases recombination of the LNA system by 100-fold above wild-type levels, it has no significant effect on recombination of LNAT. This result clearly indicates that hyperrecombination is observed only when the region flanked by the repeats is transcribed. In addition, deletion of YOL072w confers a poor growth phenotype at 30° and thermosensitivity at 37°, two phenotypes also observed in hpr1{Delta} and tho2{Delta} cells. Given the strong similarity between the hyperrecombination phenotypes of the deletion of YOL072w and hpr1{Delta} and tho2{Delta}, we named this gene THP1 (Tho2/Hpr1 phenotype). A search in the different genome databases shows that there are structural homologs of Thp1p in other eukaryotes such as Schizosaccharomyces pombe (SPBC1105.07c), Caenorhabditis elegans (C27F2.7), Drosophila melanogaster (CG7351), or Homo sapiens (AK000888). This suggests that Thp1p may play a role in a central biological process of the eukaryotic cell.

thp1{Delta} cells are affected in RNAPII-driven transcription:
One of the most relevant features of the hpr1{Delta} and tho2{Delta} mutants is their inability to elongate transcription throughout different DNA sequences, including the bacterial lacZ DNA sequence. To determine whether thp1{Delta} cells were affected in transcription we analyzed their ability to express the bacterial lacZ and yeast PHO5 sequences fused to the regulatable GAL1 promoter. As can be seen in Fig 2, GAL1-lacZ-derived ß-galactosidase activity of thp1{Delta} cells under induced conditions (2% galactose) was 14% of the wild-type levels. This result does not reflect an incapacity of thp1{Delta} cells to activate initiation of transcription from the GAL1 promoter; instead, it reflects an incapacity to express lacZ, since GAL1-PHO5-derived acid phosphatase activity was induced to 67% of the wild-type levels. As expected, no effect of thp1{Delta} was found under repression conditions.



View larger version (24K):
In this window
In a new window
Download PPT slide
 
Figure 2. Expression analysis of lacZ and PHO5 open reading frames placed under the control of the GAL1 promoter in wild-type and thp1{Delta} strains. Both strains were transformed with plasmids p416-GAL1-lacZ and pSCh202 containing the GAL1-lacZ and GAL1-PHO5 fusions, respectively. ß-Galactosidase and acid phosphatase activities were determined in duplicate for two independent transformants grown on either 2% glucose (GLU) or 2% galactose (GAL). Average and standard deviation of two different assays are shown.

To show that the results derived from enzymatic assays were caused by transcriptional rather than post-transcriptional defects, we determined the kinetics of activation of both lacZ and PHO5 mRNAs by Northern analysis. Fig 3 shows that full-length lacZ mRNA was not accumulated at all in thp1{Delta} cells after galactose induction, whereas PHO5 mRNA was accumulated to 50% of the wild-type levels. These results indicate that the incapacity of thp1{Delta} cells to express GAL1-lacZ was due to their incapacity to fully transcribe through lacZ rather than to an effect on activation of the GAL1 promoter. To confirm that elongation of transcription through lacZ could not occur properly in a thp1{Delta} cell, regardless of any effect on transcription initiation and irrespective of the distance of lacZ to the promoter, we determined whether inserting lacZ at the 3' untranslated region (UTR) of PHO5 in the previously characterized GAL1-PHO5 construct had any effect on transcription by thp1{Delta} cells. As can be seen in Fig 3 no full-length PHO5-lacZ mRNA could be detected after 3 hr of induction. Therefore, the lack of accumulation of lacZ and PHO5-lacZ mRNAs in thp1{Delta} cells is caused by the incapacity of the RNAPII to transcribe through lacZ, regardless of the distance to the promoter from which it is transcribed.



View larger version (57K):
In this window
In a new window
Download PPT slide
 
Figure 3. Transcription analysis of GAL1-lacZ, GAL1-PHO5, and GAL1-PHO5-lacZ in wild-type and thp1{Delta} strains. (A) Northern analysis of lacZ, PHO5, and PHO5-lacZ mRNAs driven from the GAL1 promoter in the strains W303-1A (WT) and WFBE046 (thp1{Delta}) transformed with centromeric plasmids p416-GAL1-lacZ, pSCh202, and pSCh212, respectively. Samples were taken after different times of addition of 2% galactose to exponentially growing cells in 2% glycerol-3% lactate synthetic medium. The DNA probes used were the 0.5-kb BamHI-HpaI 5'-end fragment of lacZ (for lacZ), a 1.5-kb EcoRI-PstI internal PHO5 fragment (for PHO5 and PHO5-lacZ), and a 589-bp 28S rRNA internal fragment obtained by PCR (rRNA). (B) Kinetics of induction of the mRNAs analyzed as determined by quantification of the Northern blots. All mRNA levels are given in arbitrary units (AU) with respect to the rRNA levels.

Our previous Northern analyses indicated that the kinetics of transcript accumulation in the GAL1-PHO5 construct was reduced to half the efficiency of the wild type (Fig 3). To determine whether this effect was also observed at endogenous chromosomal genes we analyzed transcription of the endogenous GAL1 and ACT1 genes. Fig 4 shows that whereas GAL1 was activated up to 26% of the wild-type levels, ACT1 was transcribed with 80% of the wild-type efficiency. These results indicate that thp1{Delta} impairs transcription of both episomal and chromosomal genes. However, the major effect is found for transcription of the lacZ sequences. Therefore, although we cannot exclude that transcription initiation might be reduced in thp1{Delta} cells, the major effect of thp1{Delta} on transcription is at the level of transcription elongation.



View larger version (69K):
In this window
In a new window
Download PPT slide
 
Figure 4. Transcription analysis of the endogenous ACT1 and GAL1 genes. DNA probes used were the 0.75-kb PvuII-AvaI internal GAL1 fragment and a 0.55-kb ClaI-ClaI internal ACT1 fragment. Other details as in Fig 3.

Transcription-elongation impairment is linked to hyperrecombination in thp1{Delta} cells:
We decided to determine whether the transcription and recombination phenotypes of thp1{Delta} cells were linked. We determined the effect of thp1{Delta} on recombination between the 0.6-kb internal leu2 repeats of the L series of repeat constructs in which either the lacZ or PHO5 coding sequence was inserted between the direct repeats immediately downstream of the leu2{Delta}3' copy. We used two different sets of repeat systems according to the external promoter from which transcription was driven: the L-lacZ and L-PHO5 systems in which transcription is driven from the LEU2 promoter and GL-lacZ and GL-PHO5 in which the LEU2 promoter was replaced by the regulatable GAL1 promoter, so that transcription may be turned off in 2% glucose. If the strong hyperrecombination phenotype of thp1{Delta} cells was linked to the transcriptional elongation defect, we would predict a very strong hyperrecombination phenotype at L-lacZ and a weak phenotype at L-PHO5, which would be abolished if transcription were turned off (GL-lacZ and GL-PHO5 systems).

As can be seen in Fig 5, transcription of lacZ driven from the LEU2 promoter was abolished in thp1{Delta} cells (L-lacZ system). Quantification analysis showed that the full lacZ mRNA was lower than 1% of the wild-type levels, consistent with the previously shown incapacity of thp1{Delta} cells to transcribe the lacZ sequences. This result, indeed, demonstrates that such an incapacity is independent of the promoter from which transcription is driven. As predicted, recombination was increased 930-fold above wild-type levels in thp1{Delta} in the L-lacZ system. Transcription through the L-PHO5 system was poorly affected in thp1{Delta} cells (44% of wild-type levels), consistent with the results obtained with the GAL1-PHO5 construct. Accordingly, recombination was increased in thp1{Delta} cells 23-fold above wild-type levels. Therefore, there is a correlation between the effect of thp1{Delta} on transcription through lacZ and PHO5 and hyperrecombination. The stronger the effect on transcription, the higher the hyperrecombination phenotype.



View larger version (49K):
In this window
In a new window
Download PPT slide
 
Figure 5. Transcription and recombination analysis of direct- repeat systems in wild-type and thp1{Delta} strains. Recombination frequencies and mRNA levels were determined in strains W303-1A (WT) and WFBE046 (thp1{Delta}) transformed with centromeric plasmids pSCh204, pSCh206, p414GLlacZ, and pSG206 carrying the direct repeat systems L-lacZ, L-PHO5 in which transcription is under the LEU2 promoter (PLEU), and GL-lacZ and GL-PHO5 in which transcription is under the control of the GAL1 promoter (PGAL). The transcripts driven from the LEU2 promoter are indicated by arrows whose 3'-end has been made to coincide with the position of its corresponding band in each Northern blot. A minor internal lacZ transcript present in all repeat systems containing lacZ is indicated with an asterisk. Total RNA was isolated from overnight cultures in SC-trp containing 2% glucose in all cases. The LEU2 probe used was the 485-bp ClaI-EcoRI LEU2 repeat. The rDNA probe used was the same as in Fig 4. The position of the endogenous LEU2 mRNA is indicated. Recombination values represent the median value of two different fluctuation tests, each one performed with six independent colonies. Recombinants were selected on SC-leu containing 2% glucose for the L-lacZ and L-PHO5 systems and on SC-leu2 with 2% galactose for GL-lacZ and GL-PHO5.

Confirmation of the linkage between transcription impairment and hyperrecombination comes from the characterization of the GL-lacZ and GL-PHO5 systems in 2% glucose, in which transcription of the whole repeat system is turned off (Fig 5). A strong reduction in the hyperrecombination levels of GL-lacZ was observed with respect to the L-lacZ, and complete abolishment of hyperrecombination was observed in the GL-PHO5 construct. Although theoretically a complete abolishment of hyperrecombination was at first expected for the GL-lacZ construct, it is important to note that there is a minor internal lacZ transcript (asterisked in Fig 5) present in all repeat systems containing lacZ. This transcript is transcribed from an internal sequence of lacZ as it appears in all our Northerns made with different systems using lacZ as reporter (CHAVEZ and AGUILERA 1997 Down; PIRUAT and AGUILERA 1998 Down; Fig 5). As can be seen in Fig 5, the transcript is observed in 2% glucose in the wild type and disappears in thp1{Delta} cells. Consequently, we believe that the basal hyperrecombination phenotype (30-fold above wild-type levels) observed for the thp1{Delta} cells in GL-lacZ in 2% glucose is linked to the transcription of this lacZ fragment. In any case, our results unambiguously show that the hyperrecombination phenotype of thp1{Delta} cells is linked to transcription-elongation impairment.

In all direct-repeat constructs studied, recombination can only initiate either in the repeats themselves or in the intervening region. As the transcriptional promoters (LEU2 and GAL1) and terminators are external to the systems, recombination cannot initiate at any of such elements (PRADO and AGUILERA 1995 Down). The thp1{Delta}-stimulated recombination events have to initiate in the regions through which transcription elongation takes place. Consequently, our recombination analyses not only show that hyperrecombination is linked to transcription impairment, but also that transcription in thp1{Delta} cells is certainly impaired at the level of elongation, regardless of whether the mutants may also be affected at other levels of transcription.

Hyperrecombination of thp1{Delta} is suppressed by the hrs1{Delta} mutation of the RNAPII holoenzyme:
If thp1{Delta} causes the same transcriptional and hyperrecombination phenotypes as hpr1{Delta} and tho2{Delta}, we should expect that the suppressors of hpr1{Delta} and tho2{Delta} also suppress thp1{Delta}. Therefore, we determined whether hyperrecombination at the leu2-k::ADE2-URA3-leu2-k chromosomal repeat required a functional Hrs1p component of the mediator of transcriptional regulation of the RNAPII holoenzyme (MYERS et al. 1998 Down), as previously observed for hpr1{Delta} and tho2{Delta} (PIRUAT et al. 1997 Down; PIRUAT and AGUILERA 1998 Down). As can be seen in Fig 6, hrs1{Delta} abolished the high frequency of Ura- recombinants in the thp1{Delta} mutants. Although we do not yet understand the molecular nature of this suppression, the result suggests that hyperrecombination in thp1{Delta} has the same characteristics as in hpr1{Delta}. Consistent with the idea that hyperrecombination in thp1{Delta} and hpr1{Delta} occurs by the same pathway, thp1{Delta} hpr1{Delta} double mutants show the same hyperrecombination phenotype as each of the single mutants (Fig 6).



View larger version (42K):
In this window
In a new window
Download PPT slide
 
Figure 6. Recombination frequencies of different mutant combinations of thp1{Delta} with the hyperrecombination mutation hpr1{Delta} and its suppressor mutation hrs1{Delta}. Recombination was studied at the chromosomal leu2-k::ADE2-URA3::leu2-k direct-repeat construct. Recombinants were scored as Ura- on SC + FOA. Strains used were MGY6-1A (WT), AYW3-3C (hpr1{Delta}), MGY3-2D (thp1{Delta}), MGY3-3B (hpr1{Delta} thp1{Delta}), SSAB-2C (hrs1{Delta}), and MGY2-1C (hrs1{Delta} thp1{Delta}). Other details as in Fig 1.

Subcellular localization of GFP-Tho2p and GFP-Thp1p fusion proteins:
We constructed GFP-Tho2p and GFP-Thp1p fusion proteins under the control of the regulatable MET25 promoter. Both GFP-tagged proteins were functional, as they complemented the temperature-sensitive defect and the hyperrecombination phenotype caused by the respective deletions (data not shown). GFP-Tho2p was found unambiguously in the nucleus of living yeast cells. GFP-Thp1p was found concentrated in the nuclei, although fluorescence could also be seen through the cytosol (Fig 7). However, the levels of detection of GFP-Thp1p were much lower than those of GFP-Tho2p. This may imply that fluorescence emission of GFP is not efficient enough when fused to Thp1p.



View larger version (77K):
In this window
In a new window
Download PPT slide
 
Figure 7. Subcellular localization of Tho2p and Thp1p using GFP-Tho2p and GFP-Thp1p fusions. The tho2{Delta} strain WRK5-1C was transformed with plasmids pUG34-T2 encoding GFP-Tho2p and the thp1{Delta} strain MGY6-4D with plasmid pUG34-T3 encoding GFP-Thp1p. GFP and DAPI staining were visualized by fluorescence microscopy. The green fluorescence picture of GFP-Thp1p needed a longer exposure for better visualization.

Transcription of HPR1 and THO2 is not affected in thp1{Delta} mutants and vice versa:
We decided to investigate whether the identical phenotypes of transcription and recombination observed for thp1{Delta}, hpr1{Delta}, and tho2{Delta} could be due to an effect of either of the mutations on the expression of the other two genes. As can be seen in Fig 8, exponential cultures of wild-type, hpr1{Delta}, tho2{Delta}, and thp1{Delta} cells show no biologically significant differences in the levels of mRNA. The percentage of the HPR1 and THO2 mRNAs in thp1{Delta} are 62 and 59% of the wild-type values, respectively. No significant changes are found either in the levels of HPR1 and THP1 in tho2{Delta} mutants (43 and 110%, respectively) and THO2 and THP1 in hpr1{Delta} mutants (54 and 71%, respectively). Therefore, we conclude that the thermosensitivity and transcriptional and recombinational phenotypes of thp1{Delta} are not caused by a reduction in the RNA levels of HPR1 and THO2 and vice versa.



View larger version (92K):
In this window
In a new window
Download PPT slide
 
Figure 8. Transcription analysis of HPR1, THO2, and THP1 mRNAs. Total RNA was extracted from overnight cultures in YEPD of wild-type strain W303-1A (WT) and the mutant strains SChY58a (hpr1{Delta}), RK2-6C (tho2{Delta}), and WFBE046 (thp1{Delta}). As DNA probes we used the complete ORFs of HPR1 (2.4 kb), THO2 (4.8 kb), and THP1 (1.4 kb) obtained by endonuclease restriction sites or PCR amplification.


*  DISCUSSION
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

We have identified a new gene, THP1, whose deletion confers a strong increase in recombination between direct repeats (>2000-fold above wild-type levels). In addition, thp1{Delta} confers impairment of transcription of yeast genes and, in particular, of DNA sequences such as the bacterial lacZ. These hyperrecombination and transcription impairment phenotypes of thp1{Delta} cells are identical to those of hpr1{Delta} and tho2{Delta}. Similarly, hyperrecombination in thp1{Delta} cells is fully dependent on transcription elongation. If transcription through the recombination system used is impeded, no hyperrecombination is detected. We propose that THP1 affects transcription elongation and the incidence of mitotic recombination via the same biological process controlled by HPR1 and THO2, providing further evidence for transcription-elongation-associated recombination.

THP1 affects transcription of yeast cells:
We report in this study one deletion mutation among 609 analyzed, thp1{Delta} (yol072w{Delta}), whose hyperrecombination phenotype is transcription dependent. Thp1p has apparent structural homologs in S. pombe, C. elegans, D. melanogaster, or H. sapiens. Consequently, Thp1p may be an important eukaryotic function working at some central step in the biology of the cell.

One of the most significant features of thp1{Delta} cells is their defects in transcription. Such defects are not observed at the level of promoter activation. Whereas the GAL1 promoter can be activated in the thp1{Delta} mutant background, as determined by analysis of the transcripts of a GAL1-PHO5 construct or the endogenous GAL1 gene, transcription of lacZ fused to GAL1 is strongly reduced (Fig 3 Fig 4 Fig 5). Consequently, the major transcriptional defect observed in thp1{Delta} cells is at the level of the capacity of RNAPII to traverse sequences like lacZ. Transcription of all yeast genes analyzed in this study (GAL1, PHO5, LEU2, ACT1) are reduced at different levels in thp1{Delta} cells. We cannot disregard the possibility that thp1{Delta} had an effect on transcription initiation. However, our results clearly indicate that the major effect of thp1{Delta} in transcription is at a post-initiation step. When the lacZ sequence was inserted at the 3'-end of the UTR of PHO5, no accumulation of full-length transcript could be observed, implying that the attempt of the RNAPII to elongate transcription through lacZ after having traversed 1.5 kb of PHO5 strongly reduces the kinetic of accumulation of PHO5 mRNA (Fig 3). Identical results were obtained when lacZ was inserted downstream of the leu2{Delta}3' truncated copy of the direct-repeat-recombination systems (Fig 5). Thus, the strong reduction in the accumulation of mRNA in thp1{Delta} cells is independent of the promoter used, whether constitutive or regulated, or of the distance to the promoter of the DNA region where elongation is impaired. Therefore, thp1{Delta} impairs transcription elongation of genes, the strongest impairment being found at the lacZ sequence, identical to previously reported results for the hpr1{Delta} and tho2{Delta} mutations (CHAVEZ and AGUILERA 1997 Down; PIRUAT and AGUILERA 1998 Down).

Hyperrecombination conferred by thp1{Delta} is linked to transcription-elongation impairment:
We have shown that thp1{Delta} stimulates recombination in repeat constructs in which the intervening DNA sequence flanked by the leu2 repeats is either lacZ or other DNA sequences, such as pBR322, through which transcription is shown to be impaired in the mutant (Fig 5). If in the repeat constructs containing such sequences transcription is impeded by turning off the promoter (systems GLlacZ and GLPHO5 in glucose, Fig 5) or by inserting a premature transcription terminator upstream of the intervening sequences (system LNAT, Fig 1), hyperrecombination is abolished. Similarly, if the recombination systems do not contain intervening sequences (system L, Fig 1), hyperrecombination is not observed either. These results indicate that hyperrecombination in thp1{Delta} cells occurs only in repeat systems in which RNAPII attempts to traverse DNA regions through which transcription elongation is impaired.

It is important to emphasize the meaning of these results of hyperrecombination in the context of its dependency on transcription elongation. We know that recombination between direct repeats has to initiate in the repeats or in the intervening region (PRADO and AGUILERA 1995 Down), whereas transcription is only initiated outside of the recombination systems used in this study. If, as we have shown here, hyperrecombination is completely dependent on transcription, such dependency cannot be explained at the level of transcription initiation or promoter clearance, because a defect in transcription initiation would lead to a recombinogenic substrate outside of the recombination system that would not yield a successful recombination event (PRADO and AGUILERA 1995 Down). Since recombination can only initiate in the repeat overlaps or in the intervening region, which are in the elongation part of the transcript, the transcriptional defect that triggers the recombination substrate must be associated with the elongation step. When the PHO5 sequence located between the leu2 repeats is transcribed from the external LEU2 promoter, 1.6% of thp1{Delta} cells lose the PHO5 sequence, compared with the low levels of recombination in wild-type cells (0.07%; Fig 5). This confirms that transcription elongation through PHO5 is indeed impaired, explaining both the low accumulation of PHO5 mRNA and the hyperrecombination phenotype of thp1{Delta}. This result is identical to that previously observed in tho2{Delta} cells (PIRUAT and AGUILERA 1998 Down). Therefore, regardless of any possible effect of THP1 in transcription initiation or promoter clearance, only the effect on transcription elongation is responsible for the hyperrecombination phenotype. This result excludes the possibility of hyperrecombination being caused by any putative effect that thp1{Delta} might have on expression of factors causing recombinogenic substrates.

Thp1p acts in the same biological pathway as Hpr1p and Tho2p:
Our results indicate that the three proteins, Hpr1p, Tho2p, and Thp1p, act in the same pathway connecting transcription and the incidence of transcription-associated mitotic recombination. Consistently, hyperrecombination of the leu2-k::ADE2-URA3::leu2-k repeat is suppressed by the hrs1{Delta} mutation in the three mutants hpr1{Delta}, tho2{Delta}, and thp1{Delta} (Fig 6; PIRUAT et al. 1997 Down). We have excluded the possibility that the similarity of phenotypes among the three mutants was caused by an incapacity of thp1{Delta} cells to transcribe either HPR1 or THO2 and vice versa (Fig 7). A further possibility could be that the three proteins form part of one protein complex. However, we have recently isolated a protein complex containing Hpr1p and Tho2p in which Thp1p is absent (S. CHAVEZ et al. 2000 Down). Our GFP fusion constructs reveal that Tho2p is located in the nucleus (Fig 7), as is the case with Hpr1p (CHANG et al. 1999 Down; S. CHAVEZ et al. 2000 Down). GFP-Thp1p fusion seems to be located in the nucleus also; however, fluorescence emission of this fusion is too low to exclude a cytosolic localization.

Affinity purification of a transcriptionally active form of RNAPII has led to the identification of a new RNAPII holoenzyme containing a discrete set of proteins that include Paf1p, Cdc73p, Hpr1p, Ccr4p, and at least 10 other subunits (SHI et al. 1997 Down; CHANG et al. 1999 Down). It has been proposed that the Paf1p-Cdc73p-containing RNAPII holoenzyme is required for the active transcription of a subset of yeast genes acting downstream from the protein kinase C signal transduction pathway (CHANG et al. 1999 Down). It would be important to know whether Thp1p is one of the unidentified components of such a holoenzyme. However, there are clear differences between the phenotypes of hpr1{Delta}, thp1{Delta}, or tho2{Delta} and those of paf1{Delta}, cdc73{Delta}, or ccr4{Delta}. Thus, ccr4{Delta} cells are not hyperrecombinant; paf1{Delta} and cdc73{Delta} are hyperrecombinant but to a lower extent than hpr1{Delta}, tho2{Delta}, and thp1{Delta}, and there is no evidence yet that such a hyperrecombination phenotype is transcription dependent. Also, whereas double mutant combinations of tho2{Delta}, hpr1{Delta}, and thp1{Delta} are viable and show identical phenotypes as the single mutants, as expected for proteins acting in the same biological pathway, the double mutants paf1{Delta} hpr1{Delta} and ccr4{Delta} hpr1{Delta} are synthetically lethal (CHANG et al. 1999 Down). Finally, the effect of hpr1{Delta} on transcription of different genes involved in cell wall biosynthesis, if any, has been reported to be different from the effect of paf1{Delta} or cdc73{Delta} (CHANG et al. 1999 Down).

The observation that hpr1{Delta} cells do not export poly(A)+ RNA at 37° (SCHNEITER et al. 1999 Down) could imply a wider relationship of Hpr1p, and possibly Tho2p and Thp1p, with mRNA metabolism. However, it is not yet clear whether such a relationship would be direct, since hpr1{Delta} cells do not grow at 37°. Even if Hpr1p becomes essential for RNA metabolism at elevated temperature, this has not been shown to be linked to the hyperrecombination and transcription phenotypes of hpr1{Delta} cells that are observed at 30°, a temperature at which mRNA export is not affected (SCHNEITER et al. 1999 Down). Given that mRNA metabolism, including 5'-capping, transcription termination, poly(A) addition, and splicing, is closely related and linked to transcription elongation (see BENTLEY 1999 Down; MINVIELLE-SEBASTIA and KELLER 1999 Down; HIROSE and MANLEY 2000 Down; PROUDFOOT 2000 Down), it is likely that a defect in transcription elongation also has consequences for subsequent steps of RNA metabolism, such as mRNA export.

Our recombination analyses have permitted us to identify functions involved in transcription-associated recombination and genetic instability, a phenomenon extending from bacteria to mammals (BLACKWELL et al. 1986 Down; DUL and DREXLER 1988 Down; STEWART and ROEDER 1989 Down; NICKOLOFF 1992 Down; LAUSTER et al. 1993 Down; DANIELS and LIEBER 1995 Down). The observation that Thp1p, as well as Hpr1p and Tho2p, influences transcription elongation in vivo suggests that there must be a functional connection between these proteins and transcription elongation. Even though some of these proteins, such as Tho2p and Thp1p, have structural homologs in higher eukaryotes, none of them have been detected in eukaryotic factors or complexes putatively involved in transcription elongation such as TFIIS (REINES et al. 1996 Down), P-TEFb (MARSHALL and PRICE, 1995 Down), TFIIF (PRICE et al. 1989 Down), Elongin (ASO et al. 1995 Down), ELL (SHILATIFARD et al. 1996 Down), Elongator (OTERO et al. 1999 Down), FACT (ORPHANIDES et al. 1998 Down), DSIF (HARTZOG et al. 1998 Down; WADA et al. 1998 Down), or Spt6p (HARTZOG et al. 1998 Down). Our genetic analysis of thp1{Delta} mutants provides evidence that their transcription-elongation impairment triggers the formation of recombinogenic substrates in a manner identical to the hpr1{Delta} and tho2{Delta} mutations. Whether such substrates are caused by the collision of the replication fork with a putatively stalled RNAPII (VILETTE et al. 1995 Down; PRADO et al. 1997 Down; MCGLYNN and LLOYD 2000 Down), by the accumulation of negatively supercoiled DNA downstream of the elongating RNAPII (CHRISTMAN et al. 1988 Down; THOMAS and ROTHSTEIN 1989 Down), by an R-loop, or by an opening of the chromatin around the stalled polymerase that would make the DNA more sensitive to an attack by nucleases or chemicals (CHAVEZ and AGUILERA 1997 Down; PRADO et al. 1997 Down) are all different possibilities that now can be tested to decipher the cellular pathway that connects transcription elongation with mitotic recombination and genetic instability.


*  ACKNOWLEDGMENTS

We thank J. Hegemann and F. Fabre for plasmids and strains, F. Prado for critical reading of the manuscript, and W. Reven for style correction. This work was supported by grants PB96-1350 and BIO98-1363-CE from the Ministry of Science and Culture of Spain, BIO4-CT97-2294 from the European Union, and RG0075/1999-M from Human Frontier Science Program.

Manuscript received September 6, 2000; Accepted for publication September 28, 2000.


*  LITERATURE CITED
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

AGUILERA, A. and H. L. KLEIN, 1988  Genetic control of intrachromosomal recombination in Saccharomyces cerevisiae. I. Isolation and genetic characterization of hyperrecombination mutations. Genetics 119:779-790[Abstract/Free Full Text].

AGUILERA, A. and H. L. KLEIN, 1989  HPR1, a novel yeast gene that prevents intrachromosomal excision recombination, shows carboxy-terminal homology to the Saccharomyces cerevisiae TOP1 gene. Mol. Cell. Biol. 10:1439-1451.

AGUILERA, A., S. CHÁVEZ, and F. MALAGON, 2000  Mitotic recombination in yeast: elements controlling its incidence. Yeast 16:731-754[Medline].

ASO, T., W. S. LANE, J. W. CONAWAY, and R. C. CONAWAY, 1995  Elongin (SIII): a multisubunit regulator of elongation by RNA polymerase II. Science 269:1439-1443[Abstract/Free Full Text].

BENTLEY, D., 1999  Coupling RNA polymerase II transcription with pre-mRNA processing. Curr. Opin. Cell Biol. 11:347-351[Medline].

BLACKWELL, T. K., M. W. MOORE, G. D. YANCOPOULOS, H. SUH, and S. LUTZKER et al., 1986  Recombination between immunoglobulin variable region gene segments is enhanced by transcription. Nature 324:585-589[Medline].

BRATTY, J., G. FERBEYRE, C. MOLINARO, and R. CEDERGREN, 1996  Stimulation of mitotic recombination upon transcription from the yeast GAL1 promoter but not from other RNA polymerase I, II and III promoters. Curr. Genet. 30:381-388[Medline].

CHANG, M., D. FRENCH-CORNAY, H. Y. FAN, H. KLEIN, and C. L. DENIS et al., 1999  A complex containing RNA polymerase II, Paf1p, Cdc73p, Hpr1p, and Ccr4p plays a role in protein kinase C signaling. Mol. Cell. Biol. 19:1056-1067[Abstract/Free Full Text].

CHÁVEZ, S. and A. AGUILERA, 1997  The yeast HPR1 gene has a functional role in transcriptional elongation that uncovers a novel source of genome instability. Genes Dev. 11:3459-3470[Abstract/Free Full Text].

CHÁVEZ, S., T. BEILHARZ, A. G. RONDÓN, H. ERDJUMENT-BROMAGE, and P. TEMPST et al., 2000  A protein complex containing Tho2, Hpr1, Mft1 and a novel protein, Thp2, connects transcription elongation with mitotic recombination in Saccharomyces cerevisiae.. EMBO J. 19:5824-5834[Medline].

CHRISTMAN, M. F., F. S. DIETRICH, and G. R. FINK, 1988  Mitotic recombination in the rDNA of S. cerevisiae is suppressed by the combined action of DNA topoisomerases I and II. Cell 55:413-425[Medline].

DANIELS, G. A. and M. R. LIEBER, 1995  RNA:DNA complex formation upon transcription of immunoglobulin switch regions: implications for the mechanism and regulation of class switch recombination. Nucleic Acids Res. 23:5006-5011[Abstract/Free Full Text].

DUL, J. L. and H. DREXLER, 1988  Transcription stimulates recombination. I. Specialized transduction of Escherichia coli by {lambda}-trp phages. Virology 162:466-470[Medline].

FAN, H. Y. and H. L. KLEIN, 1994  Characterization of mutations that suppress the temperature-sensitive growth of the hpr1{Delta} mutant of Saccharomyces cerevisiae.. Genetics 137:945-956[Abstract].

FAN, H. Y., K. K. CHENG, and H. L. KLEIN, 1996  Mutations in the RNA polymerase II transcription machinery suppress the hyperrecombination mutant hpr1{Delta} of Saccharomyces cerevisiae.. Genetics 142:749-759[Abstract].

GRIMM, C., P. SCHAER, P. MUNZ, and J. KOHLI, 1991  The strong ADH1 promoter stimulates mitotic and meiotic recombination at the ADE6 gene of Schizosaccharomyces pombe.. Mol. Cell. Biol. 11:289-298[Abstract/Free Full Text].

GUARENTE, L., R. R. YOCUM, and P. GIFFORD, 1982  A GAL10-CYC1 hybrid yeast promoter identifies the GAL4 regulatory region as an upstream site. Proc. Natl. Acad. Sci. USA 79:7410-7414[Abstract/Free Full Text].

HAGUENAUER-TSAPIS, R. and A. HINNEN, 1984  A deletion that includes the signal peptidase cleavage site impairs processing, glycosylation, and secretion of cell surface yeast acid phosphatase. Mol. Cell. Biol. 4:2668-2675[Abstract/Free Full Text].

HARTZOG, G. A., T. WADA, H. HANDA, and F. WINSTON, 1998  Evidence that Spt4, Spt5, and Spt6 control transcription elongation by RNA polymerase II in Saccharomyces cerevisiae.. Genes Dev. 12:357-369[Abstract/Free Full Text].

HIROSE, Y. and J. L. MANLEY, 2000  RNA polymerase II and the integration of nuclear events. Genes Dev. 14:1415-1429[Free Full Text].

HUANG, G. S. and R. L. KEIL, 1995  Requirements for activity of the yeast mitotic recombination hotspot HOT1: RNA polymerase I and multiple cis-acting sequences. Genetics 141:845-855[Abstract].

IKEDA, H. and T. MATSUMOTO, 1979  Transcription promotes recA-independent recombination mediated by DNA-dependent RNA polymerase in Escherichia coli.. Proc. Natl. Acad. Sci. USA 76:4571-4575[Abstract/Free Full Text].

KAISER, C., M. MICHAELIS and A. MITCHELL, 1994 Methods in Yeast Genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

KOGOMA, T., 1997  Stable DNA replication: interplay between DNA replication, homologous recombination, and transcription. Microbiol. Mol. Biol. Rev. 61:212-238[Abstract].

KUZMINOV, A., 1999  Recombinational repair of DNA damage in Escherichia coli and bacteriophage lambda. Microbiol. Mol. Biol. Rev. 63:751-813[Abstract/Free Full Text].

LAUSTER, R., C. A. REYNAUD, I. L. MARTENSSON, A. PETER, and D. BUCCHINI et al., 1993  Promoter, enhancer and silencer elements regulate rearrangement of an immunoglobulin transgene. EMBO J. 12:4615-4623[Medline].

MARSHALL, N. F. and D. H. PRICE, 1995  Purification of P-TEFb, a transcription factor required for the transition into productive elongation. J. Biol. Chem. 270:12335-12338[Abstract/Free Full Text].

MCGLYNN, P. and R. G. LLOYD, 2000  Modulation of RNA polymerase by (p)ppGpp reveals a RecG-dependent mechanism for replication fork progression. Cell 101:35-45[Medline].

MINVIELLE-SEBASTIA, L. and W. KELLER, 1999  mRNA polyadenylation and its coupling to other RNA processing reactions and to transcription. Curr. Opin. Cell Biol. 11:352-357[Medline].

MYERS, L. C., C. M. GUFSTASSON, A. D. BUSHNELL, M. LUI, and H. ERDJUMENT-BROMAGE et al., 1998  The Med proteins of yeast and their function through the RNA polymerase II carboxyterminal domain. Genes Dev. 12:45-54[Abstract/Free Full Text].

NEVO-CASPI, Y. and M. KUPIEC, 1994  Transcriptional induction of Ty recombination in yeast. Proc. Natl. Acad. Sci. USA 91:12711-12715[Abstract/Free Full Text].

NICKOLOFF, J. A., 1992  Transcription enhances intrachromosomal homologous recombination in mammalian cells. Mol. Cell. Biol. 12:5311-5318[Abstract/Free Full Text].

OLTZ, E. M., F. W. ALT, W. C. LIN, J. CHEN, and G. TACCIOLO et al., 1993  A V(D)J recombinase-inducible B-cell line: role of transcriptional enhancer elements in directing V(D)J recombination. Mol. Cell. Biol. 13:6223-6230[Abstract/Free Full Text].

ORPHANIDES, G., G. LEROY, C. H. CHANG, D. S. LUSE, and D. REINBERG, 1998  FACT, a factor that facilitates transcript elongation through nucleosomes. Cell 92:105-116[Medline].

OTERO, G., J. FELLOWS, Y. LI, T. DE BIZEMONT, and A. M. DIRAC et al., 1999  Elongator, a multisubunit component of a novel RNA polymerase II holoenzyme for transcriptional elongation. Mol. Cell 3:109-118[Medline].

QUES, F. and J. E. HABER, 1999  Multiple pathways of recombination induced by double-strand breaks in Saccharomyces cerevisiae.. Microbiol. Mol. Biol. Rev. 63:349-404[Abstract/Free Full Text].

PIRUAT, J. I. and A. AGUILERA, 1998  A novel yeast gene, THO2, is involved in RNA pol II transcription and provides new evidence for transcriptional elongation-associated recombination. EMBO J. 17:4859-4872[Medline].

PIRUAT, J. I., S. CHAVEZ, and A. AGUILERA, 1997  The yeast HRS1 gene is involved in positive and negative regulation of transcription and shows genetic characteristics similar to SIN4 and GAL11.. Genetics 147:1585-1594[Abstract].

PRADO, F. and A. AGUILERA, 1995  Role of reciprocal exchange, one-ended invasion crossover and single-strand annealing on inverted and direct repeat recombination in yeast: different requirements for the RAD1, RAD10 and RAD52 genes. Genetics 139:109-123[Abstract].

PRADO, F., J. I. PIRUAT, and A. AGUILERA, 1997  Recombination between DNA repeats in yeast hpr1{Delta} cells is linked to transcription elongation. EMBO J. 16:2826-2835[Medline].

PRICE, D. H., A. E. SLUDER, and A. L. GREENLEAF, 1989  Dynamic interaction between a Drosophila transcription factor and RNA polymerase II. Mol. Cell. Biol. 9:1465-1475[Abstract/Free Full Text].

PROUDFOOT, N., 2000  Connecting transcription to messenger RNA processing. Trends Biochem. Sci. 25:290-293[Medline].

REINES, D., J. W. CONAWAY, and R. C. CONAWAY, 1996  The RNA polymerase II general elongation factors. Trends Biochem. Sci. 21:351-355[Medline].

SANTOS-ROSA, H. and A. AGUILERA, 1995  Isolation and genetic analysis of extragenic suppressors of the hyper-deletion phenotype of the Saccharomyces cerevisiae hpr1{Delta} mutation. Genetics 139:57-66[Abstract].

SANTOS-ROSA, H., B. CLEVER, W. D. HEYER, and A. AGUILERA, 1996  The yeast HRS1 gene encodes a polyglutamine-rich nuclear protein required for spontaneous and hpr1-induced deletions between direct repeats. Genetics 142:705-716[Abstract].

SCHIESTL, R. H. and R. D. GIETZ, 1989  High efficiency transformation of intact yeast cells using single stranded nucleic acids as a carrier. Curr. Genet. 16:339-346[Medline].

SC