- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Standiford, D. M.
- Articles by Emerson, C. P.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Standiford, D. M.
- Articles by Emerson, C. P., , Jr.
Positive and Negative Intronic Regulatory Elements Control Muscle-Specific Alternative Exon Splicing of Drosophila Myosin Heavy Chain Transcripts
David M. Standiforda, Wei Tao Suna, Mary Beth Davisa, and Charles P. Emerson, Jr.aa Department of Cell and Developmental Biology, University of Pennsylvania School of Medicine, Philadelphia, Pennyslvania 19104
Corresponding author: Charles P. Emerson, Jr., Department of Cell and Developmental Biology, 245 Anatomy and Chemistry Bldg., University of Pennsylvania School of Medicine, Philadelphia, PA 19104-6058., emersonc{at}mail.med.upenn.edu (E-mail)
Communicating editor: A. J. LOPEZ
| ABSTRACT |
|---|
Alternative splicing of Drosophila muscle myosin heavy chain (MHC) transcripts is precisely regulated to ensure the expression of specific MHC isoforms required for the distinctive contractile activities of physiologically specialized muscles. We have used transgenic expression analysis in combination with mutagenesis to identify cis-regulatory sequences that are required for muscle-specific splicing of exon 11, which is encoded by five alternative exons that produce alternative "converter" domains in the MHC head. Here, we report the identification of three conserved intronic elements (CIE1, -2, and -3) that control splicing of exon 11e in the indirect flight muscle (IFM). Each of these CIE elements has a distinct function: CIE1 acts as a splice repressor, while CIE2 and CIE3 behave as splice enhancers. These CIE elements function in combination with a nonconsensus splice donor to direct IFM-specific splicing of exon 11e. An additional cis-regulatory element that is essential in coordinating the muscle-specific splicing of other alternative exon 11s is identified. Therefore, multiple interacting intronic and splice donor elements establish the muscle-specific splicing of alternative exon 11s.
THE regulated splicing of alternative exons in pre-mRNAs is a widely utilized genetic mechanism for generating tissue-specific protein isoforms (![]()
![]()
![]()
![]()
![]()
![]()
![]()
-tropomyosin (
-TM) in smooth muscle cells requires purine-rich exonic splicing enhancers (![]()
![]()
![]()
![]()
![]()
![]()
![]()
These same models have also been instrumental in defining the factors that interact with cis-acting elements to mediate the proper recognition of the alternative exons. For instance, the cTNT ESE has been shown to interact with several members of the SR family of splicing factors (![]()
- and ß-TM transcripts has shown the involvement of hnRNP proteins as regulators of alternative splicing (![]()
![]()
![]()
![]()
![]()
![]()
The analysis of muscle-specific alternative splicing has also contributed to the discovery that interactions between cis-acting elements and trans-acting factors can be influenced by cell or tissue-specific conditions. For instance, polypyrimidine tract binding protein is constitutively expressed, yet can specifically antagonize the use of
-tropomyosin alternative exon 3 in smooth muscle (![]()
![]()
![]()
![]()
![]()
![]()
We have developed an in vivo model for studying the mechanism that regulates muscle-specific alternative splicing that is based on the analysis of Drosophila skeletal muscle myosin heavy chain (MHC) gene transcripts. Drosophila has a single Mhc gene consisting of 19 exons, 5 of which are represented as 2 to 5 alternatively spliced exons encoding related sequences (Fig 1A; ![]()
![]()
![]()
![]()
|
In studies preliminary to this report, we developed Mhc transgene reporters to investigate the regulatory sequences required for the alternative splicing of exon 11 alternatives in specialized muscles (Fig 1B; ![]()
| MATERIALS AND METHODS |
|---|
Constructs:
The construction of the gD1048, gD1060, gD1120, gD1168, gD1105, gD1090, gD1177, and gD1222 Mhc minigene constructs has been described previously (![]()
Drosophila methods:
All Drosophila cultures were maintained at 25° on standard cornmeal molasses medium (![]()
![]()
Reverse transcriptase-dependent PCR:
RT-PCR methods were essentially those followed in ![]()
- Exon 2 sense: GACTCGAAGAAGTCTTGCTG
- Exon 12 inner antisense: CTGACCCAGGACACCGGCGCG
- Exon 12 outer antisense: GGACATGATCTTGCCCAGACGC
- Skip-specific primer: CTACGCCACAAGAAGGCG
| RESULTS |
|---|
Disruption of exon 11e splicing leads to exon 1012 skip splicing in the IFM:
Previously, we established that a Mhc minigene containing the entire exon 11 domain (gD1048; Fig 1B) has sufficient regulatory sequences to direct the correct alternative slicing of exon 11 alternatives in their appropriate muscles (![]()
![]()
A key observation from these earlier studies was that the deletion of exon 11e from the gD1048 transgene does not lead to default splicing of other alternative exon 11s in the IFM nor does this deletion effect the splicing of any other alternative exon 11 in their specific muscle types (![]()
|
Distal intronic sequences have IFM-specific and global regulatory activities in exon 11e splicing:
Exon 1012 skip splicing provides a sensitive method for monitoring disruptions in IFM-specific splicing and we have applied this assay in combination with a series of mutated minigene constructs to identify further cis-acting elements required for the IFM-specific splicing of exon 11e. A large conserved intronic domain in the exon 11 domain (CIE3; Fig 1) located between exon 11d and exon 12 was examined earlier for its role in directing IFM-specific splicing of exon 11e (ICR; ![]()
![]()
|
Interestingly, while the loss of CIE3 appears to disrupt the splicing of only exon 11e, a larger 3' deletion that removes 11c through CIE3 was found to have more global effects on exon 11 alternative splicing (gD1242; Fig 3). This deletion disables the normal processing of all remaining exons (11e, 11a, 11b) and only skip-spliced products are detected in the IFM and larval muscles. In contrast, a further deletion (gD1060) that leaves exon 11e as the only alternative is normally spliced in the IFM, but is skipped in all other muscles (see Fig 6). Thus, sequences deleted by the gD1242 construct appear to be important in coordinating the selection of alternatives in a multi-exon context. We refer to this activity as the splicing coordinator (SC).
|
|
|
Exon 11e splice selection is controlled exclusively through intronic elements:
As seen in Fig 3, exon 11e selection in the IFM is specifically promoted by the CIE3 splicing enhancer and its loss leads to the activation of skip splicing in the IFM. However, alternative spliced exons are often regulated through the use of ESEs (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
CIE1 and CIE2 elements have distinct negative and positive regulatory functions for IFM-specific, alternative splicing of exon 11e:
The CIE1 element is proximal to exon 11e and consists of a twice-repeated ATGTACC sequence in D. melanogaster and D. virilis (Fig 1C), but is represented as a single element in D. hydei (![]()
20 nt in D. melanogaster and D. virilis, but is contiguous with CIE1 in D. hydei. To determine whether CIE1 and CIE2 elements are required for exon 11e splicing in the IFM, mutations were introduced into CIE1 and CIE2 in the gD1048 background, and transcripts from IFM of transgenic flies were tested for exon 11e splicing and skip splicing using RT-PCR. As shown in Fig 5A, the substitution of a random linker in CIE1 (CCGTCCTTCTCCAC; gD1175) or CIE2 (GAACTATCCC; gD1176) does not promote exon 11e skip splicing or lead to the misexpression of any other alternative in the IFM (not shown), suggesting that these CIE elements do not participate in splicing regulation in this context or are redundant with other elements in the gD1048 transgene.
However, when further examined using the truncated gD1060 background, both CIE1 and CIE2 were found to be critical for the proper use of exon 11e in the IFM. When the same CIE2 mutation from gD1176 was placed in the truncated context (gD1254; Fig 5B), there was a significant loss of exon 11e splicing in the IFM, with
50% of the transcripts undergoing exon 1012 skip splicing, while the substitution of CIE1 with random sequence did not alter the IFM-specific splicing of exon 11e or induce any detectable skip splicing (gD1256; Fig 5B). However, when the CIE1 and CIE2 mutations were combined in the gD1265 transgene, skip splicing was greatly reduced from that observed in the CIE2 substitution alone. These results indicate that CIE2 is required to promote exon 11e use in the IFM and that CIE1 can act to repress this activity. The substitutions of CIE1 and CIE2 made here do not result in the activation of splicing in larval muscles (Fig 5C) or in the TDT (not shown), showing that these substitutions do not themselves confer gain-of-function effects, and sequence analysis of the spliced products revealed products that resulted from only exon 11e to 12 (normal) or exon 10 to 12 (skip) splice reactions, suggesting that no new splice sites were added or activated by the CIE1 and CIE2 substitutions. Thus, these mutations appear to specifically affect the activity of these elements.
While CIE2 appears required for the normal utilization of exon 11e, particularly in the presence of CIE1, these experiments also show that normal splicing can occur in its absence, suggesting either that the alternative splicing regulatory mechanism also includes additional positive-acting regulatory elements found elsewhere in the gD1060 interval or that a default splicing mechanism that includes any alternative exon is engaged in the absence of CIE1 and CIE2. This second possibility, however, is not favored since a construct that is similar to gD1060 except that it contains exon 11b and its flanking introns is completely skipped in the IFM (not shown).
CIE3 is a positive regulator of IFM-specific exon 11e splicing:
CIE3 is required in the context of the full-length exon 11 to properly promote the inclusion of exon 11e in the IFM. The ability of this element to function in a truncated context was determined in Fig 6 to test whether CIE3 acts directly with exon 11e or whether additional elements within the domain are also needed for its function. When placed into a gD1060 background where both CIE1 and CIE2 are intact (gD1152), no misexpression or skipping of exon 11e can be detected. When CIE3 is present in the absence of the CIE2 splicing enhancer (gD1356), exon 11e is normally spliced in the IFM and no exon 1012 skipping is detected, indicating that CIE3 can functionally substitute for CIE2 in this context. Consistent with this observation is the fact that CIE3 also directs the inclusion of exon 11e into the IFM in the absence of both CIE1 and CIE2 (gD1357). Further, when the 3' half of CIE3 is deleted in combination with the CIE2 substitution (gD1362), some skipping occurs, but this appears less than that seen in the gD1254 construct (Fig 5), where CIE3 is fully deleted. Thus, CIE3 appears to enhance the ability of the splicing apparatus to recognize exon 11e in the IFM in the absence of CIE1 and CIE2 and independently of any additional information contained in the interval removed by the gD1060 deletion. Interestingly, the 5' domain of the CIE3 is well conserved and contains several purine-rich elements that could serve as sites for interactions with SR proteins (![]()
| DISCUSSION |
|---|
In this study we have utilized transgenic analysis and mutagenesis to identify the intronic regulatory elements in Mhc transcripts that control the muscle-specific splicing of the alternative exon 11, which encodes the "converter domain" of Drosophila MHC isoforms (![]()
![]()
Exon 11e splicing involves a IFM-specific mechanism:
In contrast to other known alternatively spliced transcripts, where competitive interactions involving splice site strengths or the abundance and state of various binding proteins can influence the balance of exon selection within a specific tissue, alternative splicing of Mhc exon 11e appears to involve discrete, muscle-specific interactions that ensure the exact and exclusive use of the correct exon. This property is clearly shown in the splicing behavior of the gD1168 transgene, where exon 11e alone is removed (Fig 2). In this case, the IFM splicing machinery does not select any other exon 11 in the transgene transcript but instead completely defaults to the skip-splicing mode, showing that the IFM has an intrinsic requirement for a specific alternative exon and cannot replace this with another in its absence. The same also appears true for other non-IFM muscles, which do not utilize exon 11e in the transcripts from the gD1060 transgene, but instead default to skip splicing.
Exon 11e is positively selected in the IFM:
The basis for the IFM exclusivity of exon 11e splicing likely involves exon 11e-specific splicing factors that are uniquely present in the IFM and absent in all other muscles. We hypothesize that such IFM-specific factors would interact with the CIE elements and potentially other intronic regulatory sequences in the exon 11 domain to promote exon 11e splicing. Alternatively, the IFM specificity of exon 11e splicing could involve additional negative regulatory factors that repress the splicing of other exon 11s in the IFM and/or repress exon 11e splicing in non-IFM muscles. At this time we do not favor this possibility since, to date, we have not identified mutations in regulatory elements that induce the misexpression of exon 11e in non-IFM muscles or misexpression of other exon 11s in the IFM. An exception to this conclusion is the finding that the conversion of the nonconsensus exon 11e splice donor to a consensus donor leads to the exclusive selection of exon 11e in all muscles. This finding demonstrates the intrinsic weakness of the normal nonconsensus 5' splice donor sequences and suggests that the activation of the donor is the regulatory focus of the alternative splicing mechanism. Thus, our model of exon 11 alternative splicing regulation is predicated upon the muscle-specific activation of donor sites to effect the splicing of the appropriate alternative exon.
Conserved intronic elements are specific regulators of exon 11e:
The ability of CIE1 to repress the selection of exon 11e occurs only in the IFM, and the removal of this element does not lead to the activation of exon 11e splicing in other muscles even in situations where exon 11e is the only alternative (gD1256, Fig 5). Typically, splicing repressors function to prevent the use of alternative exons in inappropriate tissue, and what role the IFM-specific repression of exon 11e splicing plays is an intriguing question. Given the length of the exon 11 domain and number of alternatives it contains, it is possible that this component of the mechanism is required to regulate and coordinate the timing of exon 11e splicing during the period when other alternatives in the domain are being transcribed, which serves to prevent the inappropriate definition of the exon 11e donor until the strong exon 12 splice acceptor becomes available (![]()
CIE2 has an activity reciprocal to that of CIE1 and likely positively regulates exon 11e splicing. This model is consistent with the observation that exon 11e is not efficiently spliced in the absence of CIE2 in the gD1254 transgene, resulting in exon 1012 skip splicing in the IFM. We find it particularly significant that the CIE1 and CIE2 sites are positioned immediately adjacent to one another in D. hydei and are only 24 nt apart in D. melanogaster and D. virilis, consistent with the possibility of interactions between these elements. However, the fact that IFM-specific use of 11e still occurs in the absence of CIE1 and CIE2 indicates that these elements do not encompass all the information for 11e activation, although our current data show that these will also reside in the intronic sequence found in gD1060. Further, we have not directly tested the role of secondary structure in exon 11e splicing and do not exclude the possibility that it plays a role in CIE1 and CIE2 function in particular or in exon 11 alternative splicing generally. However, stable RNA structures are not predicted to form within or between CIE1 and CIE2, suggesting that these elements do not themselves play a direct role in aspects of exon 11e splicing that may be regulated through secondary structure.
CIE3 is a large element located at the 3' end of the exon 11 domain that is required to direct the efficient use of exon 11e when the entire intron is present. Our analysis of the truncated exon 11 background demonstrates that this element also acts as a splicing enhancer to direct exon 11e use in the IFM and can substitute for CIE2 in this context. However, while both CIE2 and CIE3 appear to act as exon 11e-specific splicing enhancers, their dissimilar composition and positions within the primary transcript suggest that these two elements function through separate mechanisms. For instance, while CIE2 appears to be positioned where it can interact with the splice donor of exon 11e, the proximity of CIE3 to the putative branchpoint (AUCUAAC) and polypyrimidine tract for exon 12 might indicate that it acts to influence the activity of these elements in the IFM.
As seen in Fig 3, the loss of the domain containing exon 11c through CIE3 (gD1242) results in the failure of either remaining alternative (11e and 11b) to be processed and the induction of skip splicing in all muscles. Since a larger deletion that also removes exon 11b (gD1060) is permissive for exon 11e splicing in the IFM, these findings suggest that information removed in gD1242 is important for splicing regulation when multiple alternatives are present. How such a SC might function is unclear, but it may act to repress competition or other interactions among multiple alternatives that prevent efficient recognition of any alternative, which, in turn, promotes exon skipping. Experiments are in progress to localize the SC sequence element to define its function in Mhc exon 11 alternative splicing.
It is clear that a complex and interconnected regulatory hierarchy is required to ensure the proper selection of exon 11e and that perturbations in this regulation lead to alternative exon skipping. With this consideration in mind, alternative exon skipping could reflect disruptions in two classes of splicing regulatory processes: (1) fidelity mechanisms that control the specificity of alternative exon splicing (e.g., interaction of muscle-specific splicing factors, activators, and repressors with alternative exon-specific regulatory sequences) and (2) alternative/constitutive exon selection mechanisms that control the differential splicing of alternative exons over the splicing between flanking constitutive exons, which could involve active processes such as repressors that suppress exon skipping between constitutive exons or kinetic processes that favor formation of spliceosomes on alternative exons over formation of spliceosomes for flanking constitutive exons. The results of our mutagenesis studies of IFM-specific exon 11e splicing regulation have identified splicing regulatory elements that appear to fall into both the fidelity and differential selection classes of regulatory processes. A model to account for the role of the elements described here is presented in Fig 7.
|
Multiple strategies exist to direct Mhc alternative splicing:
The cis-mechanism that directs the alternative splicing for several different Mhc alternative exons has been examined (![]()
![]()
![]()
![]()
![]()
![]()
![]()
A surprising result from our study is the stringent requirement by the IFM for exon 11e and the discrete shift to a skip-splicing pathway when required regulatory elements such as CIEs are replaced or removed. The single response mode of exon skipping when confronted with a number of different regulatory defects provides a unique opportunity to define multiple components of the alternative splicing apparatus in the IFM using genetic screens designed to identify skip splicing. Having defined the specific intronic and splice donor elements that are required for IFM-specific exon 11e splicing, the challenge now is to identify the splicing factors that determine the precise muscle specificity of alternative exon 11 splicing in Drosophila.
| ACKNOWLEDGMENTS |
|---|
We thank Beth Bucher (University of Pennsylvania) for advice and comments on the manuscript and members of the laboratory for their interest and discussion throughout the course of this project. This work was supported by a U.S. Army Breast Cancer Initiative Postdoctoral Fellowship (to D.M.S.), a Muscular Dystrophy Association Postdoctoral Fellowship (to M.B.D.), an American Cancer Society grant NP 841 (to C.P.E.), and a National Institutes of Health R01-AR42363 grant (to C.P.E.).
Manuscript received May 2, 2000; Accepted for publication September 28, 2000.
| LITERATURE CITED |
|---|
ASHBURNER, M., 1989 Drosophila: A Laboratory Handbook. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
BANDMAN, E., 1992 Contractile protein isoforms in muscle development. Dev. Biol. 154:273-283[Medline].
BERNSTEIN, S. and R. MILLIGAN, 1997 Fine tuning a molecular motor: the location of alternative domains in the Drosophila myosin head. J. Mol. Biol. 217:1-6.
CHABOT, B., 1996 Directing alternative splicing: cast and scenarios. Trends Genet. 12:472-478[Medline].
CHEN, C. D., R. KOBAYASHI, and D. M. HELFMAN, 1999 Binding of hnRNP H to an exonic splicing silencer is involved in the regulation of alternative splicing of the rat beta-tropomyosin gene. Genes Dev. 13:593-606
CLOUET D'ORVAL, B., Y. D'AUBENTON-CARAFA, J. M. BRODY, and E. BRODY, 1991 Determination of an RNA structure involved in splicing inhibition of a muscle-specific exon. J. Mol. Biol. 221:837-856[Medline].
DAVIS, M. B., J. DIETZ, D. M. STANDIFORD, and C. P. EMERSON, JR., 1998 Transposable element insertions respecify alternative exon splicing in three Drosophila myosin heavy chain mutants. Genetics 150:1105-1114
DOMINGUEZ, R., Y. FREYZON, K. M. TRYBUS, and C. COHEN, 1998 Crystal structure of a vertebrate smooth muscle myosin motor domain and its complex with the essential light chain: visualization of the pre-power stroke state. Cell 94:559-571[Medline].
DU, C., M. E. MCGUFFIN, B. DAUWALDER, L. RABINOW, and W. MATTOX, 1998 Protein phosphorylation plays an essential role in the regulation of alternative splicing and sex determination in Drosophila. Mol. Cell 2:741-750[Medline].
DYE, B. T., M. BUVOLI, S. A. MAYER, C. H. LIN, and J. G. PATTON, 1998 Enhancer elements activate the weak 3' splice site of alpha-tropomyosin exon 2. RNA 4:1523-1536[Abstract].
GALLEGO, M. E., R. GATTONI, J. STEVENIN, J. MARIE, and A. EXPERT-BEZANCON, 1997 The SR splicing factors ASF/SF2 and SC35 have antagonistic effects on intronic enhancer-dependent splicing of the beta-tropomyosin alternative exon 6A. EMBO J. 16:1772-1784[Medline].
GEORGE, E. L., M. B. OBER, and C. P. EMERSON, JR., 1989 Functional domains of the Drosophila melanogaster muscle myosin heavy-chain gene are encoded by alternatively spliced exons. Mol. Cell. Biol. 9:2957-2974
GERSAPPE, A. and D. J. PINTEL, 1999 CA- and purine-rich elements form a novel bipartite exon enhancer which governs inclusion of the minute virus of mice NS2-specific exon in both singly and doubly spliced mRNAs. Mol. Cell. Biol. 19:364-375
GOODING, C., G. C. ROBERTS, G. MOREAU, B. NADAL-GINARD, and C. W. SMITH, 1994 Smooth muscle-specific switching of alpha-tropomyosin mutually exclusive exon selection by specific inhibition of the strong default exon. EMBO J. 13:3861-3872[Medline].
GOODING, C., G. C. ROBERTS, and C. W. J. SMITH, 1998 Role of an inhibitory pyrimidine element and polypyrimidine tract binding protein in repression of a regulated
-tropomyosin exon. RNA 4:85-100[Abstract].
HASTINGS, G. A. and C. P. EMERSON, JR., 1991 Myosin functional domains encoded by alternative exons are expressed in specific thoracic muscles of Drosophila. J. Cell Biol. 114:263-276
HODGES, D. and S. I. BERNSTEIN, 1992 Suboptimal 5' and 3' splice sites regulate alternative splicing of Drosophila melanogaster myosin heavy chain transcripts in vitro. Mech. Dev. 37:127-140[Medline].
HODGES, D., R. M. CRIPPS, M. E. O'CONNOR, and S. I. BERNSTEIN, 1999 The role of evolutionarily conserved sequences in alternative splicing at the 3' end of Drosophila melanogaster myosin heavy chain RNA. Genetics 151:263-276
LABOURIER, E., E. ALLEMAND, S. BRAND, M. FOSTIER, and J. TAZI et al., 1999 Recognition of exonic splicing enhancer sequences by the Drosophila splicing repressor RSF1. Nucleic Acids Res. 27:2377-2386
LIBRI, D., A. PISERI, and M. Y. FISZMAN, 1991 Tissue-specific splicing in vivo of the beta-tropomyosin gene: dependence on RNA secondary structure. Science 252:1842-1845
LIN, C. H. and J. G. PATTON, 1995 Regulation of alternative 3' splice site selection by constitutive splicing factors. RNA 1:234-245[Abstract].
LIU, H. X., M. ZHANG, and A. R. KRAINER, 1998 Identification of functional exonic splicing enhancer motifs recognized by individual SR proteins. Genes Dev. 12:1998-2012
LOU, H., D. M. HELFMAN, R. F. GAGEL, and S. M. BERGET, 1999 Polypyrimidine tract-binding protein positively regulates inclusion of an alternative 3'-terminal exon. Mol. Cell. Biol. 19:78-85
MIEDEMA, K., H. HARHANGI, S. MENTZEL, M. WILBRINK, and A. AKHMANOVA et al., 1994 Interspecific sequence comparison of the muscle-myosin heavy-chain genes from Drosophila hydei and Drosophila melanogaster. J. Mol. Evol. 39:357-368[Medline].
MULLEN, M. P., C. W. SMITH, J. G. PATTON, and B. NADAL-GINARD, 1991 Alpha-tropomyosin mutually exclusive exon selection: competition between branchpoint/polypyrimidine tracts determines default exon choice. Genes Dev. 5:642-655
NADAL-GINARD, B., C. W. SMITH, J. G. PATTON, and R. E. BREITBART, 1991 Alternative splicing is an efficient mechanism for the generation of protein diversity: contractile protein genes as a model system. Adv. Enzyme Regul. 31:261-286[Medline].
NAGEL, R. J., A. M. LANCASTER, and A. M. ZAHLER, 1998 Specific binding of an exonic splicing enhancer by the pre-mRNA splicing factor SRp55. RNA 4:11-23[Abstract].
PATTON, J. G., S. A. MAYER, P. TEMPST, and B. NADAL-GINARD, 1991 Characterization and molecular cloning of polypyrimidine tract-binding protein: a component of a complex necessary for pre-mRNA splicing. Genes Dev. 5:1237-1251
PEREZ, I., C. H. LIN, J. G. MCAFEE, and J. G. PATTON, 1997 Mutation of PTB binding sites causes misregulation of alternative 3' splice site selection in vivo. RNA 3:764-778[Abstract].
RAMCHATESINGH, J., A. M. ZAHLER, K. M. NEUGEBAUER, M. B. ROTH, and T. A. COOPER, 1995 A subset of SR proteins activates splicing of the cardiac troponin T alternative exon by direct interactions with an exonic enhancer. Mol. Cell. Biol. 15:4898-4907
ROBBERSON, B. L., G. J. COTE, and S. M. BERGET, 1990 Exon definition may facilitate splice site selection in RNAs with multiple exons. Mol. Cell. Biol. 10:84-94
RYAN, K. J. and T. A. COOPER, 1996 Muscle-specific splicing enhancers regulate inclusion of the cardiac troponin T alternative exon in embryonic skeletal muscle. Mol. Cell. Biol. 16:4014-4023
SCHAAL, T. D. and T. MANIATIS, 1999 Selection and characterization of pre-mRNA splicing enhancers: identification of novel SR protein-specific enhancer sequences. Mol. Cell. Biol. 19:1705-1719
SOUTHBY, J., C. GOODING, and C. W. SMITH, 1999 Polypyrimidine tract binding protein functions as a repressor to regulate alternative splicing of alpha-actinin mutually exclusive exons. Mol. Cell. Biol. 19:2699-2711
STANDIFORD, D., M. DAVIS, W. SUN, and J. C. EMERSON, 1997 Splice-junction elements and intronic sequences regulate alternative splicing of the Drosophila myosin heavy chain gene transcript. Genetics 147:725-741[Abstract].
STARK, J. M., T. A. COOPER, and M. B. ROTH, 1999 The relative strengths of SR protein-mediated associations of alternative and constitutive exons can influence alternative splicing. J. Biol. Chem. 274:29838-29842
XIAO, S. H. and J. L. MANLEY, 1998 Phosphorylation-dephosphorylation differentially affects activities of splicing factor ASF/SF2. EMBO J. 17:6359-6367[Medline].
XU, R., J. TENG, and T. A. COOPER, 1993 The cardiac troponin T alternative exon contains a novel purine-rich positive splicing element. Mol. Cell. Biol. 13:3660-3674
ZHENG, Z. M., M. HUYNEN, and C. C. BAKER, 1998 A pyrimidine-rich exonic splicing suppressor binds multiple RNA splicing factors and inhibits spliceosome assembly. Proc. Natl. Acad. Sci. USA 95:14088-14093
This article has been cited by other articles:
![]() |
J. M. Kreahling and B. R. Graveley The iStem, a Long-Range RNA Secondary Structure Element Required for Efficient Exon Inclusion in the Drosophila Dscam Pre-mRNA Mol. Cell. Biol., December 1, 2005; 25(23): 10251 - 10260. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z.-P. HUANG, H. ZHOU, H.-L. HE, C.-L. CHEN, D. LIANG, and L.-H. QU Genome-wide analyses of two families of snoRNA genes from Drosophila melanogaster, demonstrating the extensive utilization of introns for coding of snoRNAs RNA, August 1, 2005; 11(8): 1303 - 1316. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. Hooper and J. B. Thuma Invertebrate Muscles: Muscle Specific Genes and Proteins Physiol Rev, July 1, 2005; 85(3): 1001 - 1060. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Borchert, N. E. Savaskan, and H. Kuhn Regulation of Expression of the Phospholipid Hydroperoxide/Sperm Nucleus Glutathione Peroxidase Gene. TISSUE-SPECIFIC EXPRESSION PATTERN AND IDENTIFICATION OF FUNCTIONAL CIS- AND TRANS-REGULATORY ELEMENTS J. Biol. Chem., January 17, 2003; 278(4): 2571 - 2580. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Celotto and B. R. Graveley Alternative Splicing of the Drosophila Dscam Pre-mRNA Is Both Temporally and Spatially Regulated Genetics, October 1, 2001; 159(2): 599 - 608. [Abstract] [Full Text] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Standiford, D. M.
- Articles by Emerson, C. P.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Standiford, D. M.
- Articles by Emerson, C. P., , Jr.











