Genetics, Vol. 157, 119-131, January 2001, Copyright © 2001

The Formamidase Gene of Aspergillus nidulans: Regulation by Nitrogen Metabolite Repression and Transcriptional Interference by an Overlapping Upstream Gene

James A. Frasera, Meryl A. Davisa, and Michael J. Hynesa
a Department of Genetics, University of Melbourne, Victoria, 3010 Australia

Corresponding author: Michael J. Hynes, Department of Genetics, University of Melbourne, Victoria, 3010 Australia., m.hynes{at}genetics.unimelb.edu.au (E-mail)

Communicating editor: R. H. DAVIS


*  ABSTRACT
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

The ability to utilize formamide as a sole nitrogen source has been found in numerous fungi. We have cloned the fmdS gene encoding a formamidase from Aspergillus nidulans and found that it belongs to a highly conserved family of proteins separate from the major amidase families. The expression of fmdS is primarily regulated via AreA-mediated nitrogen metabolite repression and does not require the addition of exogenous inducer. Consistent with this, deletion analysis of the 5' region of fmdS has confirmed the presence of multiple AreA-binding sites containing a characteristic core GATA sequence. Under carbon starvation conditions the response to nitrogen starvation is eliminated, indicating that the lack of a carbon source may result in inactivation of AreA. Sequence analysis and isolation of cDNAs show that a gene of unknown function lies directly 5' of fmdS with its transcript overlapping the fmdS coding region. Disruption of the 5' gene and analysis of the effects of overexpression of this gene on fmdS expression has shown that expression of this upstream gene interferes with fmdS transcription, resulting in a strong dependence on AreA activation for expression. Therefore the relative position of these two genes is essential for normal regulation of fmdS.


THE hydrolysis of amides via amidase activities has been characterized in the filamentous fungus Aspergillus nidulans (HYNES 1975A Down; HYNES and PATEMAN 1970 Down). A wide variety of amides can be hydrolyzed via a number of distinct enzyme activites (HYNES 1975A Down). The acetamidase enzyme encoded by the amdS gene allows growth on acetamide as a carbon and/or nitrogen source by producing ammonium and acetate. Regulation of amdS expression is complex, involving multiple induction signals as well as control by carbon and nitrogen metabolites (for a review, see HYNES and DAVIS 1996 Down). The general amidase encoded by gmdA contributes to growth on longer chain amides, producing ammonium and the corresponding carboxylic acid (HYNES 1975A Down). A formamidase enzyme (formamide amidohydrolase, EC 2.5.1.49) mediates the highly specific hydrolysis of formamide to produce formate and ammonium (HYNES 1975A Down). Formamide therefore serves only as a nitrogen source as formate is a single carbon molecule and hence not a carbon source for Aspergillus spp. The fmdS gene on chromosome III was defined by isolation of the formamide nonutilizing fmdS1 mutant lacking detectable formamidase activity (HYNES and PATEMAN 1970 Down).

In filamentous fungi the activities of many nitrogen catabolic enzymes, including the amidases, have been shown to be highly regulated in response to nitrogen levels in the cell through nitrogen metabolite repression, which results in the preferential utilization of the nitrogen sources ammonium and L-glutamine (for a review, see MARZLUF 1997 Down). In A. nidulans the positively acting product of the areA gene is the major regulatory factor involved in this control mechanism (ARST and COVE 1973 Down; KUDLA et al. 1990 Down). Loss-of-function areA mutants are unable to grow on most nitrogen sources other than ammonium, including formamide (HYNES 1972 Down; ARST and COVE 1973 Down; HYNES 1975B Down). In the absence of a preferred nitrogen source this GATA zinc-finger-type DNA-binding protein recognizes and activates expression through the consensus sequence HGATAR in the promoters of over 100 genes encoding permeases and enzymes required for the catabolism of secondary nitrogen sources (WILSON and ARST 1998 Down).

Regulation by AreA gives rise to a hierarchy of gene expression, with the expression of some genes being more highly activated than others. Mutations within the DNA-binding domain of AreA have been isolated that alter this hierarchy. The areA102 (L683V) mutation gives rise to a product that has a higher affinity for TGATAR sites, allowing stronger growth on acetamide and reduced growth on uric acid (HYNES 1972 Down, HYNES 1975B Down; KUDLA et al. 1990 Down; RAVAGNANI et al. 1997 Down). Analysis of the amdS promoter has revealed the presence of TGATAR sites (CORRICK et al. 1987 Down), while the promoters of the purine permeases contain primarily CGATAR sites (GORFINKIEL et al. 1993 Down; DIALLINAS et al. 1995 Down). Mirror-image mutants have been isolated (L683M) that show an opposite-yet-weaker phenotype with better growth on substrates dependent on transcription of genes whose promoters contain CGATAR sites (RAVAGNANI et al. 1997 Down).

The expression of areA itself is controlled by autoregulation and by regulation at the mRNA stability level, with the areA transcript half-life being significantly reduced under nitrogen-sufficient conditions through an element in the 3' untranslated region (UTR) of the transcript (LANGDON et al. 1995 Down; PLATT et al. 1996A Down). The activity of AreA is also affected by the NmrA protein (ANDRIANOPOULOS et al. 1998 Down). In Neurospora crassa, the NmrA homologue NMR1 has been shown to be required for nitrogen metabolite repression through interaction with the zinc finger and 12 carboxyl-terminal residues of the AreA homologue NIT2 (DUNN-COLEMAN et al. 1981 Down; XIAO et al. 1995 Down). Mutations affecting nmr-1 or altering the interacting residues of NIT2 result in nitrogen-derepressed phenotypes. The relevant regions of both AreA and NmrA are highly conserved in A. nidulans, suggesting both organisms share this regulatory mechanism (PLATT et al. 1996B Down; ANDRIANOPOULOS et al. 1998 Down). Deletion of the C-terminal amino acids of AreA thus partially relieves nitrogen metabolite repression while almost complete relief of repression is obtained when the stability-mediating element in the 3' UTR of the areA transcript is also mutated (PLATT et al. 1996A Down). In addition, the product of the tamA gene is believed to act as a coactivator of AreA function and to contribute to the activation of a subset of nitrogen metabolite repression regulated genes and has also been shown to interact with the carboxyl terminus of AreA (DAVIS et al. 1996 Down; SMALL et al. 1999 Down). The formamidase of A. nidulans was previously shown to be strongly regulated by AreA-dependent nitrogen metabolite repression (HYNES 1972 Down, HYNES 1975B Down). No evidence for induction by exogenous formamide was found and furthermore the response to nitrogen limitation was greatly reduced when carbon was also limiting (HYNES 1970 Down, HYNES 1972 Down).

Using published sequences for formamidases from Methylophilus methylotrophus and Mycobacterium smegmatis we have identified an A. nidulans expressed sequence tag (EST) sequence with high similarity. This has enabled us to characterize the structure and regulation of the fmdS gene of A. nidulans.


*  MATERIALS AND METHODS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

A. nidulans strains, growth media, and transformation:
Strains used in this study are shown in Table 1. Growth media and conditions were as described by COVE 1966 Down. Nitrogen sources were used at a final concentration of 10 mM and carbon sources at 1% w/v unless stated otherwise. Mycelia for assays were grown at 37° for 16 hr, washed with carbon-free media, and transferred to the assayed growth condition for 4 hr. Genetic analysis was carried out using techniques as described by CLUTTERBUCK 1974 Down. A. nidulans protoplast preparation and DNA transformation was performed using the method of ANDRIANOPOULOS and HYNES 1988 Down. Arabidopsis thaliana media was prepared as described in COBBETT et al. 1998 Down with nitrogen sources added at 5 mM. Growth tests used the Columbia ecotype. Schizosaccharomyces pombe Edinburgh minimal media was prepared as described in ALFA et al. 1993 Down with nitrogen sources added at 100 mM.


 
View this table:
In this window
In a new window

 
Table 1. A. nidulans strains used in this study

Molecular techniques:
Standard methods were as described by SAMBROOK et al. 1989 Down. Restriction enzymes and Mung Bean Exonuclease (Promega, Madison, WI) were used with the supplied buffers. DNA fragments were purified from agarose gels using the BresaClean DNA purification kit (Gene Works) following the manufacturer's specifications. DNA dephosphorylation was performed by addition of 1 unit of Arctic shrimp alkaline phosphatase (U.S. Biochemicals, Cleveland) to 50 ng DNA in the recommended buffer.

PCR protocols:
Sequences of primers referred to in the text are as follows:

  • BTUB2: AGT TGT TAC CAG CAC CGG AC

  • BTUB3: GCT CCG GTG TTT ACA ATG G

  • FMD1: GCC GAG CCT GGA GAT GTC

  • FMD2: TCG CCG ATT CCA CTC AGC

  • FMDlac1: CCA AAC TCG AGG ACC CCC CAC CCA GC

  • FMDlac2: GCG GAG CTC GAG GGT TTT GC

  • FMDlac3: GCA GCG CTC GAG CAA CCC

  • FMDlac4: GCG ACC TCG AGG TAA CCG

  • FMDlac5: GCA ATG CTC GAG ACG GAA GG

  • fmdsGSP1: CAG ATA GCT TTT GCA GG

  • fmdsGSP4: TGC CGT AGC TAG GGA TAT CT

  • fmdSrt1: GGC ATC CAG ATA TCC CTA GC

  • USG1: TGA AGG TAC CCT GAG AGT GAG CC

  • USG2: TTA TCA GAT CTC GCA CGG CTA CG

  • USGrt1: GTG GTT GGC ACC GTG CGA GC

  • USGrt2: GGG AGT CCA TGA ATA TCT CGT C

5' rapid amplification of cDNA ends (RACE) was performed using the 5' RACE System v2 kit (GIBCO BRL, Gaithersburg, MD) with the nested gene specific primers fmdsGSP1 and fmdsGSP4, using total RNA from A. nidulans strain MH1 collected after transfer to nitrogen starvation, carbon-sufficient conditions. Semiquantitative RT-PCR was performed as described in HA et al. 1999 Down using the Superscript One-step RT-PCR system (GIBCO BRL). A total of 22 PCR cycles were used for the benA control (BTUB2 and BTUB3), 26 for usgS (USGrt1 and USGrt2), and 28 or 30 for fmdS (fmdSrt1 and FMD2) with all reactions stopped while in their linear phase.

Plasmid construction:
The 7-kb BamHI and 3.3-kb ClaI fmdS-hybridizing fragments from cosmid L19H02 were cloned into pBluescript SK+ to create pJAF4136 and pJAF4510, respectively. A minimal fmdS subclone was created by subcloning the 1.7-kb ScaI fragment from pJAF4136 into pBluescript SK+ cut with EcoRV to create pJAF4155. usgS inactivation plasmids were created by inserting a 2.4-kb BglII/SmaI riboB fragment from pPL1 (OAKLEY et al. 1987B Down) into pJAF4510 digested completely with BglII and partially with HincII. The HincII site at -1221 was used to create pJAF4472 and the HincII site at -1023 to create pJAF4473. Nucleotide positions are with reference to the fmdS ATG at +1. usgS cDNA clones were isolated from a {lambda}ZAP library constructed by Dr. Rodolfo Aramayo at Texas A&M University, which used RNA from a mixed vegetative and 24-hr asexual development culture of A. nidulans strain FGSC A26. Plaque lifts were probed with the 3.3-kb ClaI fragment from pJAF4510. Clones were excised as described in SHORT et al. 1988 Down.

All fmdS::lacZ constructs were created through fusion of fmdS at the BglII site at +472 in frame to the BamHI site in the lacZ reporter construct pJS3524. pJAF4241 was constructed using the XhoI site at -599 bp, inserting into pJS3524 cut with XhoI and BamHI. pJAF4504 was created by inserting the 2.5-kb XhoI fragment, including the rest of usgS, into the XhoI site of pJAF4241. pJAF4242 and pJAF4243 were created by digesting pJS3524 with KpnI, blunting with mung bean endonuclease, cutting with BglII, and inserting fmdS fragments starting at the EcoRV site at -123 and the ScaI site at -62, respectively. The remaining fmdS fusion constructs were created by introducing a KpnI site via PCR within the promoter that was used (in conjunction with the BglII site) to clone the sequenced PCR products into pJS3524. All PCR reactions used primer FMD2 in conjunction with a construct-specific primer. Constructs included pJAF4503 (primer FMDlac1), pJAF4502 (FMDlac2), pJAF4501 (FMDlac3), pJAF4500 (FMDlac4), and pJAF4499 (FMDlac5). A similar approach was taken to create the usgS::lacZ construct pJAF4622, using primer USG1 to introduce a KpnI site at -1330 and USG2 to create a BglII site at +144 relative to the usgS start codon, with this fragment sequenced and subcloned into pJS3524.

The usgS overexpression plasmids were made using a three-step cloning procedure. The usgS overexpression plasmid pJAF4869 was generated by inserting a 400-bp EcoRI/BamHI alcA promoter fragment from pAL3 (FILLINGER et al. 1995 Down) into pJAF4510 digested with EcoRI/BglII. A 1.4-kb EcoRI/BamHI pyrG-containing fragment from pARB4342 was then inserted into EcoRI/BamHI-digested pJAF4869 to give pJAF4870. The gene replacement plasmid pJAF4871 was created by inserting the 3.8-kb BamHI/ClaI fragment from pJAF4870 into the usgS subclone pJAF4510 digested fully with BglII and partially with ClaI.

lacZ reporter gene assays:
Reporter gene studies used strains carrying a single copy of the relevant construct in single copy at the argB locus as described by PUNT et al. 1990 Down. ß-Galactosidase assays were carried out by the method of DAVIS et al. 1988 Down.

Nucleotide sequence accession number:
The sequence for the fmdS and usgS genes has been deposited in GenBank under accession no. AF274009.


*  RESULTS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Cloning of fmdS:
A BLAST search performed on the University of Oklahoma A. nidulans EST database (http://www.genome.ou.edu/asper.html) revealed a sequence (EST c8h05a1.r1) with a high level of similarity to the formamidases of the bacteria M. methylotrophus and M. smegmatis (MAHENTHIRALINGAM et al. 1993 Down; WYBORN et al. 1996 Down). Primers FMD1 and FMD2 based upon the EST sequence were used to amplify a 317-bp product from A. nidulans genomic DNA, which was then used to probe colony lifts of a chromosome III specific cosmid library (BRODY et al. 1991 Down). Two hybridizing cosmids were identified, L19H02 and L20G07. Both cosmids were shown to complement the A. nidulans fmdS1 mutant (MH8375) in transformants directly selected on formamide as the sole nitrogen source. Neither of these cosmids lay within the region of the ordered minimal library indicated to contain the fmdS region of the chromosome (PRADE et al. 1997 Down), nor were these cosmids adjacent to each other.

A 7-kb BamHI fragment capable of complementing the fmdS1 mutation was subcloned from cosmid L19H02. Sequencing 3.5 kb of the end of the clone to which the PCR fragment hybridized in Southern blots revealed that the fmdS gene contained four introns that were confirmed by cDNA sequence. Complementation of the fmdS1 mutation with the minimal 1.7-kb ScaI subclone (pJAF4155) confirmed the function of this sequence.

Two major startpoints of fmdS transcription within the fmdS promoter region were identified in multiple independent clones generated by 5' RACE. The startpoints of transcription (at -21 and -12 relative to the predicted ATG) corresponded to the existence of two possible TATA boxes (both with the sequence TTATAC) lying at -59 and -48. An additional startpoint was detected within the first exon at nucleotide +7, which did not correspond to any recognized TATA sequence.

fmdS belongs to a highly conserved gene family:
The predicted 45-kD 411-amino-acid FmdS does not share significant similarity with AmdS (CORRICK et al. 1987 Down) but has 56% identity and 77% similarity to the formamidase of M. methylotrophus, with conservation across the entire protein. Similarity to the M. smegmatis enzyme is lower (66%), with no homology at the carboxyl terminus (Fig 1). Database searches using the predicted FmdS protein sequence identified previously uncharacterized highly conserved formamidase-like sequences in the genomes of prokaryotic, eukaryotic, and archaeal species (Fig 1). Full sequences have been isolated as part of the genome sequencing projects of Bordetella pertussis, B. bronchiseptica, Aeropyrum pernix, S. pombe, Candida albicans and two (in tandem) from A. thaliana. Tests on defined media showed that S. pombe could use formamide as a sole nitrogen source and that formamide enhanced growth of A. thaliana relative to growth in the absence of added nitrogen source, indicating that these formamidase sequences are likely to be functional. Incomplete sequences were also identified as ESTs from the plant species Oryza sativa (accession nos. C72046, D49000, D49028, and D46854), Zea mays (AI714639 and AI739746), Medicago truncatula (AW256497), Lotus japonicus (AW720090, AW720252, and AW719264), Sorghum bicolor (AW564921), and Lycopersicon esculentum (AI782257). All of these proteins are distinct from the two major amidase families (the nitrilase and amidase signature group) and more closely resemble ureases (NOVO et al. 1995 Down).



View larger version (78K):
In this window
In a new window
Download PPT slide
 
Figure 1. Alignment of 10 predicted formamidase-type enzymes. Identical residues are indicated by dark shading; similar residues are indicated by light shading. The alignment was generated using Pileup (GCG software package, DEVEREAUX et al. 1984 Down) and viewed with Boxshade (Bioinformatics group, ISREC). At1, A. thaliana formamidase 1 (accession no. CAB38294); At2, A. thaliana formamidase 2 (CAB38295); An, A. nidulans; Ap, A. pernix (BAA79495); Bb, B. bronchiseptica; Bp, B. pertussis; Ca, C. albicans; Mm, M. methylotrophus (Q50228); Ms, M. smegmatis (Q07238); Sp, S. pombe (CAB60014). Preliminary sequence data for C. albicans, B. pertussis, and B. bronchiseptica was obtained from The Institute for Genomic Research website at http://www.tigr.org.

Regulation of fmdS by nitrogen metabolite repression:
Previous studies of the regulation of formamidase activity showed a lack of induction by formamide yet strong regulation by nitrogen metabolite repression (HYNES 1970 Down, HYNES 1972 Down). In an attempt to localize the promoter elements responsible for this response, an fmdS::lacZ promoter deletion series was constructed and integrated in single copy at argB as described by PUNT et al. 1990 Down. Each strain was assayed under growth conditions of nitrogen and carbon starvation or sufficiency (Fig 2). The longest fmdS::lacZ fusion (pJAF4241, with 599 bp of fmdS promoter) displayed a 10-fold increase in expression during nitrogen starvation. Four potential AreA recognition sequences (HGATAR) were identified within the fmdS promoter, and the deletion series was used to determine the relative contribution of each site. The sites at -70 (TGATAG), -145 (CGATAA) and -160 (AGATAA) relative to the predicted fmdS start codon all contribute to fmdS::lacZ expression under nitrogen-limiting conditions, with the site at -145 only playing a minor role. The site at -315 (TGATAA) appeared to have little effect on the regulation of fmdS, with the deletion of this region actually corresponding to a slight increase in the basal levels of ß-galactosidase activity, perhaps through the removal of other regulatory sequences (Fig 2).



View larger version (30K):
In this window
In a new window
Download PPT slide
 
Figure 2. Deletion analysis of fmdS::lacZ regulation. Reporter gene constructs with varying fmdS promoter lengths were targeted in single copy at the argB locus (PUNT et al. 1990 Down). Constructs were designed to sequentially remove potential regulatory elements (represented by the indicated symbols) with the expression of each construct assayed in areA+ and areA217 genetic backgrounds under different growth conditions. Mycelium was grown in 100 ml of 1% glucose and 10 mM ammonium tartrate medium at 37° for 16 hr, washed with carbon-free/nitrogen-free media, and then transferred to the indicated growth media for 4 hr. When present after transfer, glucose was at 1% w/v. NH4 indicates 10 mM ammonium tartrate; -N is nitrogen free. Values are given in units per minute per milligram of protein and represent the results of at least three separate experiments with standard errors shown.

The areA217 loss-of-function allele abolished the response to nitrogen starvation for all constructs showing that the response was AreA dependent. Expression of fmdS::lacZ was unaffected by the tamA{Delta} mutation (results not shown) in agreement with previous studies (ARST and SHEERINS 1996 Down).

Effects of carbon starvation on fmdS expression:
The absence of a carbon source led to loss of response to nitrogen starvation of fmdS::lacZ expression (Fig 2). Earlier studies on formamidase levels showed a reduced response to nitrogen starvation in the absence of an added carbon source (HYNES 1972 Down). This was observed with all fusion constructs, indicating that the effect was not due to a specific site in the fmdS promoter. Reduced fmdS::lacZ expression was observed only upon complete carbon starvation, with the poorer carbon sources, lactose, fructose, or limiting glucose (0.1% w/v), giving expression equivalent to 1% glucose (results not shown). In A. nidulans carbon catabolite repression (CCR) is mediated by the zinc-finger repressor protein CreA (DOWZER and KELLY 1991 Down). Analysis of the fmdS promoter identified possible tandem CreA recognition sites at -409 and -399 (CCCCACCCAGCCCCGCGGA) (CUBERO and SCAZZOCCHIO 1994 Down; PANOZZO et al. 1998 Down). Equivalent sites with almost identical flanking sequence (CTCCAGCCCAACTCCGCGGA) are also seen in the niaD promoter (JOHNSTONE et al. 1990 Down). HYNES 1973 Down showed that nitrate reductase levels are also low under carbon starvation conditions. Introduction of the creA204 loss-of-function allele led to a reduction of fmdS::lacZ expression although the response to AreA was still apparent (Table 2). Removal of the tandem CreA sites had no detectable effect on expression of the reporter construct (Fig 2).


 
View this table:
In this window
In a new window

 
Table 2. Effect of various regulatory mutations on pJAF4241 fmds::lacZ expression: ß-Galactosidase activity

A time course analysis of the effect of carbon starvation on fmdS::lacZ expression was performed (Fig 3). Following transfer of mycelia to carbon-sufficient (1% glucose), nitrogen-free media, a short phase of no detectable change in expression was followed by ß-galactosidase levels increasing over a 3-hr period. Transfer of mycelia to carbon-free media at 2.5 hr led to a rapid loss of the response, comparable to that caused by the protein synthesis inhibitor cycloheximide. This effect was also observable irrespective of the time of transfer (data not shown). The nonmetabolizable glucose analogue 2-deoxyglucose (2-DOG) is sufficient at 0.5% w/v to cause CCR of amdS expression mediated by CreA (M. J. HYNES, unpublished results). Transfer of mycelia to carbon-free/nitrogen-free media containing 0.5% 2-DOG for 4 hr did not simulate carbon sufficiency and allow fmdS::lacZ expression (data not shown). The lack of effect of the creA204 mutation on the response to nitrogen starvation combined with the inability of 2-DOG to substitute for glucose implies that the loss of AreA control of fmdS expression is in response to a signal independent of carbon catabolite repression.



View larger version (24K):
In this window
In a new window
Download PPT slide
 
Figure 3. Time-course analysis of fmdS::lacZ expression. A strain carrying fmdS::lacZ fusion plasmid pJAF4241 was assayed using conditions as described in Fig 2, with mycelia collected at half-hour intervals and assayed for ß-galactosidase activity. Mycelia were transferred to 1% glucose/nitrogen-free growth media ({diamond}), carbon-free/nitrogen-free media ({square}), and carbon-free/nitrogen-free plus cycloheximide ({triangleup}). Mycelia were washed with carbon-free/nitrogen-free media prior to transfer. Values are given in units per minute per milligram of protein and represent the results of at least three separate experiments with standard errors shown.

Regulation of fmdS by AnCF:
The 5' region of fmdS has a CCAAT sequence (-112) that was shown to bind the A. nidulans CCAAT-binding factor (AnCF; PAPAGIANNOPOULOS et al. 1996 Down; STEIDL et al. 1999 Down) by electromobility shift assay (data not shown). The same site has been shown to be required in an AnCF-dependent manner for the formation of a nucleosome-free region in the fmdS promoter (NARENDJA et al. 1999 Down). A strain deleted for the hapC gene encoding one of the subunits of AnCF (PAPAGIANNOPOULOS et al. 1996 Down) displayed reduced growth on formamide as the sole nitrogen source. A hapC{Delta} background resulted in slightly reduced expression of the fmdS::lacZ fusion (Table 2). However, deletion of the CCAAT sequence had no noticeable effect on fmdS::lacZ expression (compare pJAF4242 with pJAF4499 in Fig 2). This could have been due to the deletion fortuitously bringing other regulatory sequences into the proximity of the fmdS promoter or more probably this is due to loss of usgS in this construct (see DISCUSSION).

The 5' end of fmdS contains an overlapping gene:
Previous studies of formamidase activity indicated a reduction of fmdS expression in areA102 strains, corresponding with a reduction in growth on formamide as a sole nitrogen source (HYNES 1972 Down). However, expression of the fmdS::lacZ construct was equivalent to wild type in an areA102 mutant background (Table 2). To investigate this discrepancy further analysis of the fmdS promoter was undertaken. Sequence analysis and searches of the A. nidulans EST database revealed the existence of a gene within the promoter of fmdS transcribed in the same direction as the fmdS transcript. To sequence the entire gene an additional 1.3 kb of fmdS upstream sequence was obtained through cloning of a 3.3-kb ClaI fragment (pJAF4510) from cosmid L19H02. Isolation of three independent cDNA clones confirmed that the upstream gene (usgS) contained four introns and encoded a predicted 362-amino acid highly hydrophobic 41-kD product (Fig 4A). The usgS/fmdS intergenic region (from the stop codon of usgS to the start codon of fmdS) is only 242 bp and the usgS transcript overlaps that of fmdS by up to 150 bp, terminating within either the first exon or first intron of fmdS (Fig 4C). Database searches with usgS revealed a single homologue of unidentified function as an EST from the fungus Botrytus cinerea (accession nos. CNS01D74 and CNS019CV). Application of a hidden Markov topology prediction algorithm (TUSNADY and SIMON 1998 Down) indicated that usgS is likely to encode a six-transmembrane helix protein with a long extracellular C-terminal tail.



View larger version (23K):
In this window
In a new window
Download PPT slide
 
Figure 4. Identification of usgS, an upstream gene, within the promoter of fmdS. (A) Schematic representation and restriction map of the fmdS region. Exons are shown as shaded boxes (usgS dark, fmdS light). The presence of a divergent EST is indicated. Directions of transcription (arrows) are shown. B, BamHI; Bg, BglII; C, ClaI; H, HincII; S, ScaI; and X, XhoI. (B) usgS deletion constructs. Constructs allowed disruption of usgS through deletion of the first two exons (pJAF4472) and first three exons (pJAF4473) of usgS while still maintaining an uninterrupted fmdS promoter region. (C) Nucleotide and conceptual protein sequence of the area surrounding the usgS/fmdS intergenic region, showing UsgS residues 238–362 and FmdS residues 1–65. Putative fmdS TATA boxes are underlined and AreA recognition sites boxed. A CCAAT site shown to be required for the formation of a nucleosome-free region (NARENDJA et al. 1999 Down) is doubly underlined. usgS transcript polyadenylation sites are indicated with down arrows and fmdS transcriptional startpoints as determined by RACE with solid circles. Nucleotides are numbered with reference to the +1 at the start of the fmdS coding region. Lowercase letters indicate intron sequences.

Characterization of a usgS deletion strain:
Two disruption constructs of usgS were created by replacing either the first two (pJAF4472) or first three exons (pJAF4473) of usgS in plasmid pJAF4510 with a riboB+ fragment from plasmid pPL1 (OAKLEY et al. 1987B Down; Fig 4B). The riboB+-containing fragment was inserted in reverse orientation to ensure that no novel usgS transcripts were generated. For each construct a linear ClaI fragment containing the usgS::riboB insert was used to transform an areA102; pyroA4; riboB2 strain (MH50), selecting for riboflavin prototrophy. No obvious morphological phenotype could be seen in any RiboB+ transformants. Southern blot analysis of 30 transformants for each construct revealed one disruptant for each containing the desired integration event at usgS (data not shown).

Plate tests were used to determine if loss of usgS function gave rise to an altered growth phenotype on different carbon or nitrogen sources. Apart from formamide utilization, no other phenotypes were detected. Growth on either 10 mM or 50 mM formamide was noticeably stronger, particularly when comparing the usgS{Delta} areA102 double mutant (MH4473) to the parental areA102 strain (MH50), which showed poor growth and reduced mycelial density on formamide as the sole nitrogen source (Fig 5). Phenotypes of disruptants generated with either of the deletion constructs were identical, indicating that the new phenotype was not due to the particular positioning of the riboB+ fragment. The usgS{Delta} mutation was introduced by genetic crosses into an areA+ background. usgS{Delta} areA+ (MH9510) colonies grew slightly better than wild type (MH1). Therefore loss of usgS results in increased formamide utilization in both areA102 and areA+ backgrounds.



View larger version (129K):
In this window
In a new window
Download PPT slide
 
Figure 5. Effects of deletion of the usgS gene on formamide utilization. Colonies were grown for 2 days at 37° on 1% glucose minimal medium. Nitrogen sources and concentrations are indicated. WT is wild-type strain MH97. The usgS{Delta} strain is MH9510, generated with the usgS knockout plasmid pJAF4473. areA102 usgS{Delta} [usgS] designates strain MH9467 (areA102 usgS{Delta}) transformed with multiple ectopic copies of usgS subclone pJAF4510 to give strain MH9487.

The plasmid pJAF4510 bearing usgS was cotransformed with the pyroA+ plasmid pI4 (MAY et al. 1989 Down) into the areA102 usgS{Delta} strain. All cotransformants were phenotypically identical to the usgS{Delta} strains. Southern blot analysis indicated that the usgS+ plasmid had integrated ectopically into the genome and the genomic usgS was still disrupted, showing that the effects of the usgS{Delta} could not be restored in trans (MH9487, Fig 5). To confirm the lack of a trans-acting regulatory role for the usgS product on fmdS expression, the usgS{Delta} allele was introduced into an fmdS::lacZ background and no change in fmdS::lacZ expression was observed (results not shown). These results are compatible with usgS having a cis-acting effect on fmdS expression.

Analysis of transcription of fmdS and usgS by semiquantitaive RT-PCR showed that the fmdS product increased with nitrogen starvation and that levels were lower with carbon starvation (in agreement with the data presented in Fig 2). The usgS transcript was present in high levels on ammonium and showed only a slight response to nitrogen starvation and no change in response to carbon starvation (Fig 6). The loss-of-function areA217 allele resulted in levels of fmdS product not responding to nitrogen starvation. In agreement with usgS having a cis-acting effect, the fmdS product level was increased under both nitrogen limitation and sufficiency in the usgS{Delta} mutant. This response was most noticeable in repressing (glucose and ammonium grown) conditions.



View larger version (49K):
In this window
In a new window
Download PPT slide
 
Figure 6. Semiquantitative RT-PCR analysis of fmdS and usgS transcription. All reactions were stopped while in their linear phase as described in HA et al. 1999 Down. Twenty-two PCR cycles were used for the benA control (using the primers BTUB2 and BTUB3), 26 cycles for usgS (USGrt1 and USGrt2), and 28 cycles for fmdS (fmdSrt1 and FMD2) except for the areA217 mutant where 30 cycles were used to enhance the signal. Wild-type RNA was isolated from strain MH1, areA217 RNA from strain MH341, and usgS{Delta} RNA from MH9510. Transcription of the constitutively expressed ß-tubulin gene benA (MAY et al. 1987 Down) was used as a loading control. Growth conditions were as described in Fig 2.

As none of the fmdS fusion constructs studied thus far had included the upstream gene, additional constructs were generated: a usgS::lacZ fusion (pJAF4622) and a usgS-fmdS::lacZ fusion (pJAF4504) that contained 3.1 kb of fmdS promoter, incorporating the upstream gene and its promoter (Fig 7). The expression of usgS::lacZ (pJAF4622) was not strongly regulated in agreement with the RT-PCR data (Fig 7). ß-Galactosidase levels increased less than twofold under nitrogen starvation conditions, and this increase was eliminated by the areA217 mutation, indicating that usgS expression is weakly regulated by AreA. No major effects of carbon starvation were evident.



View larger version (21K):
In this window
In a new window
Download PPT slide
 
Figure 7. Effects of the presence of usgS on fmdS::lacZ expression. ß-Galactosidase assays of the three lacZ constructs under different growth conditions in the presence of different areA alleles were performed as described in Fig 2. Construct nucleotide coordinates are given relative to the ATG of fmdS. Wild-type data are reproduced from Fig 2 and Table 2. The lacZ fusions were crossed into the relevant mutant genetic background. Values are given in units per minute per milligram of protein and represent the results of at least three separate experiments with standard errors shown.

Inclusion of the upstream gene in the usgS-fmdS::lacZ construct (pJAF4504) led to a reduction in ß-galactosidase levels under all growth conditions assayed compared to those observed for the construct lacking the entire usgS gene (pJAF4241, Fig 7). Under nitrogen-sufficient conditions expression of fmdS::lacZ was easily observed in the absence of usgS, whereas inclusion of the entire usgS gene reduced fmdS::lacZ expression to almost undetectable levels. The levels of usgS-fmdS::lacZ considered in conjunction with the phenotype of the usgS{Delta} strain on formamide suggested that transcription of the upstream gene was interfering with expression of fmdS. Despite little change in usgS::lacZ expression, expression of usgS-fmdS::lacZ was highly dependent on an AreA-mediated response to nitrogen starvation (Fig 7). Inclusion of usgS therefore changed fmdS from having leaky expression to being tightly regulated by nitrogen metabolite repression.

Alteration of usgS regulation affects fmdS expression:
The areA102 mutation was previously found to result in ~50% of wild-type formamidase activity (HYNES 1972 Down, HYNES 1975B Down). This was not found for the assays of fmdS::lacZ fusions lacking usgS (Table 2). The areA102 mutant background resulted in increased usgS::lacZ expression under conditions of nitrogen limitation (Fig 7), consistent with the usgS promoter containing three potential TGATAR AreA recognition sites (at -305, -676, and -821 relative to the usgS predicted start codon). When usgS was present in the fmdS promoter (as in pJAF4504) the presence of the areA102 allele resulted in an ~50% reduction in fmdS expression (Fig 7), consistent with the effects of areA102 on formamide utilization being due to increased usgS transcription that interferes with fmdS expression.

Constructs were generated to determine the effects of overexpression of usgS by inserting a hybrid promoter fragment from the alcA gene (FILLINGER et al. 1995 Down) fused to the pyrG promoter and coding region (OAKLEY et al. 1987A Down; Fig 8A). Transformation of the usgS{Delta}/riboB+ pyrG- strain MH9755 with pJAF4870 yielded a large number of pyrG+ transformants, all of which had a wild-type phenotype on 0.1% glucose with the inducer 1% ethanol present. No phenotype produced by usgS overexpression was observed, indicating that expression of ectopic copies of usgS via the alcA promoter did not affect fmdS expression. The gene replacement plasmid pJAF4871 was then linearized via ClaI digestion and transformed into the same strain. Scoring 200 transformants for growth on 1% ethanol/10 mM formamide media and on media lacking riboflavin revealed three classes of pyrG+ transformants: wild type, those that were still riboB+ and displayed reduced formamide utilization on ethanol, and a third class that was riboB- with reduced formamide utilization. Southern analysis revealed that the second class had been generated by integration of circular pJAF4871 by a crossover event within usgS, introducing the pyrG/alcA::usgS fusion while retaining the deletion allele upstream in tandem. The third class was shown to be produced by a gene replacement event, with linearized pJAF4871 replacing usgS{Delta}/riboB+ with the pyrG/alcA::usgS fusion (Fig 8B). Both classes containing the alcA promoter fused to usgS in cis to fmdS were greatly impaired in formamide utilization (Fig 8C), indicating that increased usgS expression decreases fmdS expression.



View larger version (27K):
In this window
In a new window
Download PPT slide
 
Figure 8. Effects of overexpression of usgS on formamide utilization. (A) usgS overexpression constructs. pJAF4870 was designed for ectopic overexpression of usgS and pJAF4871 to integrate at the usgS genomic locus. Exons are shown as shaded boxes (usgS dark, fmdS light). The pyrG/alcA hybrid promoter was fused to usgS at the BglII site in the usgS 5'UTR, creating a hybrid BamHI/BglII site. B, BamHI; Bg, BglII; B/Bg, BamHI/BglII hybrid site; C, ClaI; H, HincII. (B) The alcA::usgS gene replacement event. Linearized pJAF4871 were transformed into the usgS{Delta}/pyrG- strain MH9755 with transformants selected for pyrG complementation (uridine and uracil prototrophy). The pyrG+transformants were screened for loss of the riboB+ selectable marker, causing riboflavin auxotrophy, and the integration event confirmed by Southern analysis. (C) Growth characteristics of alcA::usgS strains. Colonies were grown for 2 days at 37° on 1% glucose minimal medium, with 10 mM formamide as the nitrogen source. The ectopic alcA::usgS strain is a pJAF4870 transformant. usgS{Delta}::alcA::usgS was generated by integration of pJAF4871 via a single crossover event, giving the usgS{Delta} and alcA::usgS alleles in tandem. Generation of the alcA::usgS gene replacement strain is described in B.


*  DISCUSSION
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

The ability to utilize formamide as a nitrogen source via formamidase activity has been detected in both fungal and bacterial species (DRAPER 1967 Down; FRIEDRICH and MITRENGA 1981 Down; MUNOZ and AGOSIN 1993 Down; WYBORN et al. 1994 Down). We have found that the fmdS gene encodes a protein conserved within prokaryotes, eukaryotes, and archaea. Formamide has been shown to be a degradation product of both histidine and cyanide in various microorganisms (FERBER et al. 1988 Down; KUNZ et al. 1994 Down). Cyanide hydratase activity converts hydrogen cyanide to formamide (WANG et al. 1992 Down) and has been detected during infection of cyanogenic Sorghum spp. by the phytopathogenic fungus Gloeocercospora sorghi (MYERS and FRY 1978A Down; FRY and MYERS 1981 Down; WANG et al. 1999 Down). No formamidase activity is detected in this fungus but the formamide produced is not detectable as it is rapidly metabolized by other organisms (MYERS and FRY 1978B Down). Cyanide originating from cyanide-producing bacteria or cyanogenic glucosides in plants is likely to be a source of formamide for utilization by saprophytes. In the phytopathogenic fungi Leptosphaeria maculans and Fusarium solani, both cyanide and formamide can serve as a nitrogen source (BARCLAY et al. 1998 Down; SEXTON and HOWLETT 2000 Down). Our finding that formamidase homologues occur in many plant species may indicate a detoxification role for these enzymes in plants.

As had been shown previously, fmdS expression was strongly regulated in response to the nitrogen state of the cell (HYNES 1972 Down, HYNES 1975B Down). Deletion analysis of the fmdS promoter revealed multiple GATA sequences through which this effect was modulated by AreA, as found for other genes required for alternative nitrogen source utilization (DAVIS et al. 1993 Down; PUNT et al. 1995 Down; GONZALEZ et al. 1997 Down; HUTCHINGS et al. 1999 Down). Induction of fmdS expression by exogenous formamide does not occur and it is unlikely that formamide is generated by the cell as an endogenous inducer (HYNES 1970 Down, HYNES 1975A Down). In support of this the promoter deletion series shows dependence only on the GATA sites. This independence from pathway-specific induction has been observed for other nitrogen catabolic enzymes, e.g., histidase (POLKINGHORNE and HYNES 1982 Down) and the general amidase (HYNES 1975B Down). It is likely that, upon nitrogen starvation, the expression of many genes producing enzymes responsible for nitrogen scavenging is activated, irrespective of the presence of the relevant substrates.

Reduced formamidase expression in response to carbon starvation (HYNES 1972 Down) was further confirmed by this work. This has also been observed for nitrate reductase, NADP-GDH, and histidase (HYNES 1973 Down, HYNES 1974 Down; POLKINGHORNE and HYNES 1982 Down). Expression of the fmdS::lacZ fusion follows the same trend as formamidase levels and, together with the RT-PCR data, is consistent with an effect at the transcriptional level. The time-course analysis of fmdS::lacZ expression suggests that carbon starvation results in loss of activation by AreA. This is supported by the loss of dependence on AreA for expression under carbon starvation conditions and the finding that the element responsible for this regulation could not be localized to any specific sites in the fmdS promoter deletion series. It is highly unlikely that this is a general effect of carbon starvation on gene expression. Carbon starvation leads to increased levels of acetamidase activity even in areA loss-of-function mutants and relieves ammonium repression (HYNES 1972 Down, HYNES 1975B Down). This has been supported by more recent data using an amdS::lacZ fusion that shows that the response to carbon starvation is independent of AreA but dependent on an element in the 5' region of amdS (M. J. HYNES, M. A. DAVIS and J. A. SHARP, unpublished data).

These results suggest that AreA is rapidly inactivated in response to carbon starvation. Genes dependent on AreA, such as fmdS and other genes solely involved in nitrogen source utilization, will not respond to nitrogen starvation in the absence of a carbon source. Genes such as amdS, which are also involved in carbon source utilization, will respond to carbon starvation by activation by one or more other regulatory pathways. The mechanism for signaling AreA inactivation due to carbon starvation is yet to be determined. Due to its simplicity fmdS regulation provides an excellent system for the further study of this phenomenon. It is likely that in nature fungi may often face severe nutrient deprivation and derepress appropriate enzymes for the scavenging of trace sources of carbon and nitrogen.

Analysis of the fmdS promoter revealed the presence of an overlapping gene (usgS) whose transcript terminated within fmdS. The deletion of usgS resulted in increased growth on formamide and cis/trans tests showed that the effect of usgS was apparent only when in cis with fmdS. When considered in conjunction with the data obtained when usgS expression was increased (in an areA102 background and when overexpressed from the pyrG/alcA promoter), the results strongly suggest that expression of usgS results in transcriptional interference of the fmdS promoter. The fmdS::lacZ and RT-PCR analysis clearly indicate that the usgS effect is at the transcriptional level.

As discussed by EGGERMONT and PROUDFOOT 1993 Down a genuine interference effect should be seen only in cis and not in trans, which is clearly shown in the usgS/fmdS system and indicates that the intergenic region between usgS and fmdS lacks interference blocking elements such as transcriptional pause or polyadenylation sites. In fact, the usgS poly(A) sites within fmdS show little similarity to the characterized diffuse fungal polyadenylation sites rich in A and U bases (for a review, see PROUDFOOT 1991 Down). Multiple polyadenylation sites for the usgS transcript exist and by definition must be inefficient, because the fmdS transcript itself must pass through these sites. In contrast the fmdS gene appears to contain an efficient polyadenylation signal, although the definition of a fungal poly(A) site and the mechanisms involved are not as well understood as in mammalian systems (LEVITT et al. 1989 Down; PROUDFOOT 1991 Down).

One model that can be proposed is that there is a direct effect of transcription through a downstream promoter on transcription initiation of the downstream gene. Positive and negative supercoils generated by RNA polymerase could prevent access to the downstream promoter by RNA polymerase (WU et al. 1988 Down). This phenomenon, which has been called promoter occlusion (ADHYA and GOTTESMAN 1982 Down), has been characterized in the compact genomes of phage and bacteria (e.g., ADHYA and GOTTESMAN 1982 Down). There are also rare eukaryotic examples. In Saccharomyces cerevisiae it has been shown that expression from the promoter of the actin gene completely occludes a cryptic promoter in the first intron (IRNIGER et al. 1992 Down). The Drosophila melanogaster Adh larval promoter is also occluded in this case by transcription from the upstream adult promoter (CORBIN and MANIATIS 1989 Down). In these situations transcriptional interference is absolute with the downstream promoter being completely inactive.

A second but not mutually exclusive model is that expression of an upstream gene affects the chromatin structure of the downstream regulatory region and promoter such that access by transcription factors and/or RNA polymerase is altered. Studies in S. cerevisiae have generally indicated that transcript overlap of convergent genes has little effect on transcriptional levels (e.g., PETERSON and MYERS 1993 Down), although some exceptions have been observed (PUIG et al. 1999 Down). Recent studies of the convergent POT1 and YIL161w open reading frames (ORFs; with 84–115-bp transcript overlap) showed that deletion of the YIL161w promoter leads to a twofold increase in POT1 expression and alteration of the intergenic chromatin structure (PUIG et al. 1999 Down). If this imposed alteration in nucleosome structure occurred instead over the promoter of a tandemly arrayed gene, the effects could be expected to be more significant through the alteration of transcription factor accessibilty. In the unr/N-ras system in Mus musculus, the unr transcript, although shown to interfere with expression of the downstream N-ras promoter, actually terminates 150 bp before the N-ras transcription initiation sites (BOUSSADIA et al. 1997 Down). The effect observed in this instance is proposed to occur through interference with upstream promoter elements, and this could be via the enforcement of an altered chromatin structure.

The fmdS promoter has been shown to have an ordered nucleosome structure centered around the CCAAT sequence, which may be required for overcoming such an effect (NARENDJA et al. 1999 Down). Reporter gene assays in this study revealed that the CCAAT-binding complex AnCF has a relatively minor role when usgS is absent. In a genomic context the role of AnCF may be much greater and be required, in conjunction with AreA, to open up the fmdS promoter to overcome the negative effects of the upstream gene. Expression of usgS altering nucleosome positioning would enforce a greater dependence on both AnCF and AreA binding, resulting in tightly controlled fmdS expression. It has been recently shown that the effects of readthrough transcripts from the S. cerevisiae GAL10 gene into the adjacent GAL7 promoter result from displacement of the Gal4p transcriptional activator (GREGER et al. 2000 Down).

The effects of transcriptional interference result in expression of the usgS and fmdS genes being functionally linked. Alterations in expression of usgS result in altered fmdS expression. In an evolutionary sense selection might maintain the tandem gene arrangement in order to retain appropriate controlled expression of fmdS. Alteration of this gene arrangement would result in position effects on fmdS expression as demonstrated here. Position effects are often seen with ectopic integration of genes and with directed gene rearrangements that result in alterations of gene regulation (e.g., MILLER et al. 1987 Down). In general, in lower eukaryotes genes can be relatively close together. In S. cerevisiae the average distance betweeen tandemly oriented open reading frames is only 517 bp (DUJON 1996 Down), indicating that transcription overlap and interference may occur in some cases. Gene clusters occur commonly in fungi, an example of which is in A. nidulans sterigmatocystin biosynthesis where the 25 genes involved are clustered within only 50 kb (BROWN et al. 1996 Down). The relative positions of genes within these clusters may affect their expression via transcriptional interference.


*  ACKNOWLEDGMENTS

J.A.F. was a recipient of an Australian Postgraduate Award. This work was supported by a grant from the Australian Research Council.

Manuscript received June 19, 2000; Accepted for publication September 18, 2000.


*  LITERATURE CITED
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

ADHYA, S. and M. GOTTESMAN, 1982  Promoter occlusion: transcription through a promoter may inhibit its activity. Cell 29:939-944[Medline].

ALFA, C., P. FANTES, J. HYAMS, M. MCLEOD and E. WARBRICK (Editors), 1993 Experiments with Fission Yeast: A Laboratory Course Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

ANDRIANOPOULOS, A. and M. J. HYNES, 1988  Cloning and analysis of the positively acting regulatory gene amdR from Aspergillus nidulans.. Mol. Cell. Biol. 8:3532-3541[Abstract/Free Full Text].

ANDRIANOPOULOS, A., S. KOURAMBAS, J. A. SHARP, M. A. DAVIS, and M. J. HYNES, 1998  Characterization of the Aspergillus nidulans nmrA gene involved in nitrogen metabolite repression. J. Bacteriol. 180:1973-1977[Abstract/Free Full Text].

ARST, H. N., JR. and D. J. COVE, 1973  Nitrogen metabolite repression in Aspergillus nidulans.. Mol. Gen. Genet. 126:111-141[Medline].

ARST, H. N., JR. and A. SHEERINS, 1996  Nitrogen metabolite repression in Aspergillus nidulans: A farewell to tamA? Curr. Genet. 6:245-257.

BARCLAY, M., V. A. TETT, and C. J. KNOWLES, 1998  Metabolism and enzymology of cyanide/metallocyanide biodegradation by Fusarium solani under neutral and acidic conditions. Enzyme Microbiol. Technol. 23:321-330.

BOUSSADIA, O., F. AMIOT, S. CASES, G. TRIQUENEAUX, and H. JACQUEMIN-SABLON et al., 1997  Transcription of unr (upstream of N-ras) down-modulates N-ras expression in vivo. FEBS Lett. 420:20-24[Medline].

BRODY, H., J. GRIFFITH, A. J. CUTICCHIA, J. ARNOLD, and W. E. TIMBERLAKE, 1991  Chromosome-specific recombinant DNA libraries from the fungus Aspergillus nidulans.. Nucleic Acids Res. 19:3105-3109[Abstract/Free Full Text].

BROWN, D. W., J. H. YU, H. S. KELKAR, M. FERNANDES, and T. C. NESBITT et al., 1996  Twenty-five coregulated transcripts define a sterigmatocystin gene cluster in Aspergillus nidulans.. Proc. Natl. Acad. Sci. USA 93:1418-1422[Abstract/Free Full Text].

CLUTTERBUCK, J. A., 1974 Aspergillus nidulans Genetics. Plenum Publishing Corp., New York.

COBBETT, C. S., M. J. MAY, R. HOWDEN, and B. ROLLS, 1998  The glutathione-deficient, cadmium-sensitive mutant, cad2-1, of Arabidopsis thaliana is deficient in gamma-glutamylcysteine synthetase. Plant J. 16:73-78[Medline].

CORBIN, V. and T. MANIATIS, 1989  Role of transcriptional interference in the Drosophila melanogaster Adh promoter switch. Nature 337:279-282[Medline].

CORRICK, C. M., A. P. TWOMEY, and M. J. HYNES, 1987  The nucleotide sequence of the amdS gene of Aspergillus nidulans and the molecular characterization of 5' mutations. Gene 53:63-71[Medline].

COVE, D. J., 1966  The induction and repression of nitrate reductase in the fungus Aspergillus nidulans.. Biochim. Biophys. Acta 113:51-56[Medline].

CUBERO, B. and C. SCAZZOCCHIO, 1994  Two different, adjacent and divergent zinc finger binding sites are necessary for CREA-mediated carbon catabolite repression in the proline gene cluster of Aspergillus nidulans.. EMBO J. 13:407-415[Medline].

DAVIS, M. A., C. S. COBBETT, and M. J. HYNES, 1988  An amdS-lacZ fusion for studying gene regulation in Aspergillus.. Gene 63:199-212[Medline].

DAVIS, M. A., J. M. KELLY, and M. J. HYNES, 1993  Fungal catabolic gene regulation: molecular genetic analysis of the amdS gene of Aspergillus nidulans.. Genetica 90:133-145[Medline].

DAVIS, M. A., A. J. SMALL, S. KOURAMBAS, and M. J. HYNES, 1996  The tamA gene of Aspergillus nidulans contains a putative zinc cluster motif which is not required for gene function. J. Bacteriol. 178:3406-3409[Abstract/Free Full Text].

DEVEREAUX, J., P. HAEBERLI, and O. SMITHIES, 1984  A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res. 12:387-395.

DIALLINAS, G., L. GORFINKIEL, H. N. ARST, JR., G. CECCHETTO, and C. SCAZZOCCHIO, 1995  Genetic and molecular characterization of a gene encoding a wide specificity purine permease of Aspergillus nidulans reveals a novel family of transporters conserved in prokaryotes and eukaryotes. J. Biol. Chem. 270:8610-8622[Abstract/Free Full Text].

DOWZER, C. E. and J. M. KELLY, 1991  Analysis of the creA gene, a regulator of carbon catabolite repression in Aspergillus nidulans.. Mol. Cell. Biol. 11:5701-5709[Abstract/Free Full Text].

DRAPER, P., 1967  The aliphatic acylamide amidohydrolase of Mycobacterium smegmatis: its inducible nature and relation to acyl-transfer to hydroxylamine. J. Gen. Microbiol. 46:111-123[Abstract/Free Full Text].

DUJON, B., 1996  The yeast genome project: What did we learn? Trends Genet. 12:263-270[Medline].

DUNN-COLEMAN, N. S., A. B. TOMSETT, and R. H. GARRETT, 1981  The regulation of nitrate assimilation in Neurospora crassa: biochemical analysis of the nmr-1 mutants. Mol. Gen. Genet. 182:234-239[Medline].

EGGERMONT, J. and N. J. PROUDFOOT, 1993  Poly(A) signals and transcriptional pause sites combine to prevent interference between RNA polymerase II promoters. EMBO J. 12:2539-2548[Medline].

FERBER, D. M., F. KHAMBATY, and B. ELY, 1988  Utilization of histidine by Caulobacter crescentus.. J. Gen. Microbiol. 134:2149-2154[Abstract/Free Full Text].

FILLINGER, S., C. PANOZZO, M. MATHIEU, and B. FELENBOK, 1995  The basal level of transcription of the alc genes in the ethanol regulon in Aspergillus nidulans is controlled both by the specific transactivator AlcR and the general carbon catabolite repressor CreA. FEBS Lett. 368:547-550[Medline].

FRIEDRICH, C. G. and G. MITRENGA, 1981  Utilization of aliphatic amides and formation of two different amidases by Alcaligenes eutrophus.. J. Gen. Microbiol. 125:367-374.

FRY, W. E., and D. F. MYERS, 1981 Hydrogen cyanide metabolism by fungal pathogens of cyanogenic plants, pp. 321–334 in Cyanide in Biology, edited by B. VENNESLAND, E. E. CONN, C. J. KNOWLES, J. WESTLEY and F. WISSING. Academic Press, London.

GONZALEZ, R., V. GAVRIAS, D. GOMEZ, C. SCAZZOCCHIO, and B. CUBERO, 1997  The integration of nitrogen and carbon catabolite repression in Aspergillus nidulans requires the GATA factor AreA and an additional positive-acting element, ADA. EMBO J. 16:2937-2944[Medline].

GORFINKIEL, L., G. DIALLINAS, and C. SCAZZOCCHIO, 1993  Sequence and regulation of the uapA gene encoding a uric acid-xanthine permease in the fungus Aspergillus nidulans.. J. Biol. Chem. 268:23376-23381[Abstract/Free Full Text].

GREGER, I. H., A. ARANDA, and N. PROUDFOOT, 2000  Balancing transcriptional interference and initiation on the GAL7 promoter of Saccharomyces cerevisiae.. Proc. Natl. Acad. Sci. USA 97:8415-8420[Abstract/Free Full Text].

HA, S. B., A. P. SMITH, R. HOWDEN, W. M. DIETRICH, and S. BUGG et al., 1999  Phytochelatin synthase genes from Arabidopsis and the yeast Schizosaccharomyces pombe.. Plant Cell 11:1153-1164[Abstract/Free Full Text].

HUTCHINGS, H., K. P. STAHMANN, S. ROELS, E. A. ESPESO, and W. E. TIMBERLAKE et al., 1999  The multiply-regulated gabA gene encoding the GABA permease of Aspergillus nidulans: a score of exons. Mol. Microbiol. 32:557-568[Medline].

HYNES, M. J., 1970  Induction and repression of amidase enzymes in Aspergillus nidulans.. J. Bacteriol. 103:482-487[Abstract/Free Full Text].

HYNES, M. J., 1972  Mutants with altered glucose repression of amidase enzymes in Aspergillus nidulans.. J. Bacteriol. 111:717-722[Abstract/Free Full Text].

HYNES, M. J., 1973  The effect of lack of a carbon source on nitrate-reductase activity in Aspergillus nidulans.. J. Gen. Microbiol. 79:155-157[Free Full Text].

HYNES, M. J., 1974  The effects of carbon source on glutamate dehydrogenase activities in Aspergillus nidulans.. J. Gen. Microbiol. 81:165-170[Abstract/Free Full Text].

HYNES, M. J., 1975a  Amide utilization in Aspergillus nidulans: evidence for a third amidase enzyme. J. Gen. Microbiol. 91:99-109[Abstract/Free Full Text].

HYNES, M. J., 1975b  Studies on the role of the areA gene in the regulation of nitrogen catabolism in Aspergillus nidulans.. Aust. J. Biol. Sci. 28:301-313[Medline].

HYNES, M. J., and M. A. DAVIS, 1996 Regulation of acetamide catabolism, pp. 381–394 in The Mycota, edited by G. A. MARZLUF and R. BRAMBL. Springer-Verlag, Berlin.

HYNES, M. J. and J. A. PATEMAN, 1970  The use of amides as nitrogen sources by Aspergillus nidulans.. J. Gen. Microbiol. 63:317-324[Abstract/Free Full Text].

IRNIGER, S., C. M. EGLI, M. KUENZLER, and G. H. BRAUS, 1992  The yeast actin intron contains a cryptic promoter that can be switched on by preventing transcriptional interference. Nucleic Acids Res. 20:4733-4739[Abstract/Free Full Text].

JOHNSTONE, I. L., P. C. MCCABE, P. GREAVES, S. J. GURR, and G. E. COLE et al., 1990  Isolation and characterisation of the crnA-niiA-niaD gene cluster for nitrate assimilation in Aspergillus nidulans.. Gene 90:181-192[Medline].

KUDLA, B., M. X. CADDICK, T. LANGDON, N. M. MARTINEZ-ROSSI, and C. F. BENNETT et al., 1990  The regulatory gene areA mediating nitrogen metabolite repression in Aspergillus nidulans. Mutations affecting specificity of gene activation alter a loop residue of a putative zinc finger. EMBO J. 9:1355-1364[Medline].

KUNZ, D. A., C. S. WANG, and J. L. CHEN, 1994  Alternative routes of enzymic cyanide metabolism in Pseudomonas fluorescens NCIMB 11764. Microbiology 140:1705-1712[Abstract/Free Full Text].

LANGDON, T., A. SHEERINS, A. RAVAGNANI, M. GIELKENS, and M. X. CADDICK et al., 1995  Mutational analysis reveals dispensability of the N-terminal region of the Aspergillus transcription factor mediating nitrogen metabolite repression. Mol. Microbiol. 17:877-888. (erratum: Mol. Microbiol. 20: 239).[Medline].

LEVITT, N., D. BRIGGS, A. GIL, and N. J. PROUDFOOT, 1989  Definition of an efficient synthetic poly(A) site. Genes Dev. 3:1019-1025[Abstract/Free Full Text].

MAHENTHIRALINGAM, E., P. DRAPER, E. O. DAVIS, and M. J. COLSTON, 1993  Cloning and sequencing of the gene which encodes the highly inducible acetamidase of Mycobacterium smegmatis.. J. Gen. Microbiol. 139:575-583[Abstract/Free Full Text].

MARZLUF, G. A., 1997  Genetic regulation of nitrogen metabolism in the fungi. Microbiol. Mol. Biol. Rev. 61:17-32[Abstract].

MAY, G. S., M. L. TSANG, H. SMITH, S. FIDEL, and N. R. MORRIS, 1987  Aspergillus nidulans beta-tubulin genes are unusually divergent. Gene 55:231-243[Medline].

MAY, G. S., R. B. WARING, S. A. OSMANI, N. R. MORRIS and S. H. DENISON, 1989 Proceedings of the EMBO-Alko Workshop on Molecular Biology of Filamentous Fungi. Foundation for Biotechnical and Industrial Fermentation Research, Helsinki.

MILLER, B. L., K. Y. MILLER, K. A. ROBERTI, and W. E. TIMBERLAKE, 1987  Position-dependent and -independent mechanisms regulate cell-specific expression of the SpoC1 gene cluster of Aspergillus nidulans.. Mol. Cell. Biol. 7:427-434[Abstract/Free Full Text].

MUNOZ, G. A. and E. AGOSIN, 1993  Glutamine involvement in nitrogen control of giberellic acid production in Gibberella fujikuroi.. Appl. Environ. Microbiol. 59:4317-4322[Abstract/Free Full Text].

MYERS, D. F. and W. E. FRY, 1978a  The development of Gloecercospora sorghi in Sorghum. Phytopathology 68:1147-1155.

MYERS, D. F. and W. E. FRY, 1978b  Enzymatic release and metabolism of hydrogen cyanide in Sorghum infected by Gloeocercospora sorghi.. Phytopathology 68:1717-1722.

NARENDJA, F. M., M. A. DAVIS, and M. J. HYNES, 1999  AnCF, the CCAAT binding complex of Aspergillus nidulans, is essential for the formation of a DNase I-hypersensitive site in the 5' region of the amdS gene. Mol. Cell. Biol. 19:6523-6531[Abstract/Free Full Text].

NOVO, C., R. TATA, A. CLEMENTE, and P. R. BROWN, 1995  Pseudomonas aeruginosa aliphatic amidase is related to the nitrilase/cyanide hydratase enzyme family and Cys166 is predicted to be the active site nucleophile of the catalytic mechanism. FEBS Lett. 367:275-279[Medline].

OAKLEY, B. R., J. E. RINEHART, B. L. MITCHELL, C. E. OAKLEY, and C. CARMONA et al., 1987a  Cloning, mapping and molecular analysis of the pyrG (orotidine-5'-phosphate decarboxylase) gene of Aspergillus nidulans.. Gene 61:385-399[Medline].

OAKLEY, C. E., C. F. WEIL, P. L. KRETZ, and B. R. OAKLEY, 1987b  Cloning of the riboB locus of Aspergillus nidulans.. Gene 53:293-298[Medline].

PANOZZO, C., E. CORNILLOT, and B. FELENBOK, 1998  The CreA repressor is the sole DNA-binding protein responsible for carbon catabolite repression of the alcA gene in Aspergillus nidulans via its binding to a couple of specific sites. J. Biol. Chem. 273:6367-6372[Abstract/Free Full Text].

PAPAGIANNOPOULOS, P., A. ANDRIANOPOULOS, J. A. SHARP, M. A. DAVIS, and M. J. HYNES, 1996  The hapC gene of Aspergillus nidulans is involved in the expression of CCAAT-containing promoters. Mol. Gen. Genet. 251:412-421[Medline].

PETERSON, J. A. and A. M. MYERS, 1993  Functional analysis of mRNA 3' end formation signals in the convergent and overlapping transcription units of the S. cerevisiae genes RHO1 and MRP2. Nucleic Acids Res. 21:5500-5508[Abstract/Free Full Text].

PLATT, A., T. LANGDON, H. ARST, D. KIRK, and D. TOLLERVEY et al., 1996a  Nitrogen metabolite signalling involves the C-terminus and the GATA domain of the Aspergillus transcription factor AREA and the 3' untranslated region of its mRNA. EMBO J. 15:2791-2801[Medline].

PLATT, A., A. RAVAGNANI, H. ARST, JR., D. KIRK, and T. LANGDON et al., 1996b  Mutational analysis of the C-terminal region of AREA, the transcription factor mediating nitrogen metabolite repression in Aspergillus nidulans.. Mol. Gen. Genet. 250:106-114[Medline].

POLKINGHORNE, M. A. and M. J. HYNES, 1982  L-histidine utilization in Aspergillus nidulans.. J. Bacteriol. 149:931-940[Abstract/Free Full Text].

PRADE, R. A., J. GRIFFITH, K. KOCHUT, J. ARNOLD, and W. E. TIMBERLAKE, 1997  In vitro reconstruction of the Aspergillus (= Emericella) nidulans genome. Proc. Natl. Acad. Sci. USA 94:14564-14569[Abstract/Free Full Text].

PROUDFOOT, N., 1991  Poly(A) signals. Cell 64:671-674[Medline].

PUIG, S., J. E. PEREZ-ORTIN, and E. MATALLANA, 1999  Transcriptional and structural study of a region of two convergent overlapping yeast genes. Curr. Microbiol. 39:369-373[Medline].

PUNT, P. J., M. A. DINGEMANSE, A. KUYVENHOVEN, R. D. SOEDE, and P. H. POUWELS et al., 1990  Functional elements in the promoter region of the Aspergillus nidulans gpdA gene encoding glyceraldehyde-3-phosphate dehydrogenase. Gene 93:101-109[Medline].

PUNT, P. J., J. STRAUSS, R. SMIT, J. R. KINGHORN, and C. A. VAN DEN HONDEL et al., 1995  The intergenic region between the divergently transcribed niiA and niaD genes of Aspergillus nidulans contains multiple NirA binding sites which act bidirectionally. Mol. Cell. Biol. 15:5688-5699[Abstract].

RAVAGNANI, A., L. GORFINKIEL, T. LANGDON, G. DIALLINAS, and E. ADJADJ et al., 1997  Subtle hydrophobic interactions between the seventh residue of the zinc finger loop and the first base of an HGATAR sequence determine promoter-specific recognition by the Aspergillus nidulans GATA factor AreA. EMBO J. 16:3974-3986[Medline].

SAMBROOK, J., E. F. FRITSCH and T. MANIATIS, 1989 Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

SEXTON, A. C. and B. J. HOWLETT, 2000  Characterisation of a cyanide hydratase gene in the phytopathogenic fungus Leptosphaeria maculans.. Mol. Gen. Genet. 263:463-470[Medline].

SHORT, J. M., J. M. FERNANDEZ, J. A. SORGE, and W. D. HUSE, 1988  Lambda ZAP: a bacteriophage lambda expression vector with in vivo excision properties. Nucleic Acids Res. 16:7583-7600[Abstract/Free Full Text].

SMALL, A. J., M. J. HYNES, and M. A. DAVIS, 1999  The TamA protein fused to a DNA-binding domain can recruit AreA, the major nitrogen regulatory protein, to activate gene expression in Aspergillus nidulans.. Genetics 153:95-105[Abstract/Free Full Text].

STEIDL, S., P. PAPAGIANNOPOULOS, O. LITZKA, A. ANDRIANOPOULOS, and M. A. DAVIS et al., 1999  AnCF, the CCAAT binding complex of Aspergillus nidulans, contains products of the hapB, hapC, and hapE genes and is required for activation by the pathway-specific regulatory gene amdR.. Mol. Cell. Biol. 19:99-106[Abstract/Free Full Text].

TUSNADY, G. E. and I. SIMON, 1998  Principles governing amino acid composition of integral membrane proteins: application to topology prediction. J. Mol. Biol. 283:489-506[Medline].

WANG, P., D. E. MATTHEWS, and H. D. VANETTEN, 1992  Purification and characterization of cyanide hydratase from the phytopathogenic fungus Gloeocercospora sorghi.. Arch. Biochem. Biophys. 298:569-575[Medline].

WANG, P., R. W. SANDROCK, and H. D. VANETTEN, 1999  Disruption of the cyanide hydratase gene in Gloeocercospora sorghi increases its sensitivity to the phytoanticipin cyanide but does not affect its pathogenicity on the cyanogenic plant sorghum. Fungal Genet. Biol. 28:126-134[Medline].

WILSON, R. A. and H. N. ARST, JR., 1998  Mutational analysis of AREA, a transcriptional activator mediating nitrogen metabolite repression in Aspergillus nidulans and a member of the "streetwise" GATA family of transcription factors. Microbiol. Mol. Biol. Rev. 62:586-596[Abstract/Free Full Text].

WU, H. Y., S. H. SHYY, J. C. WANG, and L. F. LIU, 1988  Transcription generates positively and negatively supercoiled domains in the template. Cell 53:433-440[Medline].

WYBORN, N. R., D. J. SCHERR, and C. W. JONES, 1994  Purification, properties and heterologous expression of formamidase from Methylophilus methylotrophus.. Microbiology 140:191-195.

WYBORN, N. R., J. MILLS, S. G. WILLIAMS, and C. W. JONES, 1996  Molecular characterisation of formamidase from Methylophilus methylotrophus.. Eur. J. Biochem. 240:314-322[Medline].

XIAO, X., Y. H. FU, and G. A. MARZLUF, 1995  The negative-acting NMR regulatory protein of Neurospora crassa binds to and inhibits the DNA-binding activity of the positive-acting nitrogen regulatory protein NIT2. Biochemistry 34:8861-8868[Medline].




This article has been cited by other articles:


Home page
Eukaryot CellHome page
K. H. Wong, M. J. Hynes, and M. A. Davis
Recent Advances in Nitrogen Regulation: a Comparison between Saccharomyces cerevisiae and Filamentous Fungi
Eukaryot. Cell, June 1, 2008; 7(6): 917 - 925.
[Full Text] [PDF]


Home page
Eukaryot CellHome page
B. J. Monahan, M. C. Askin, M. J. Hynes, and M. A. Davis
Differential Expression of Aspergillus nidulans Ammonium Permease Genes Is Regulated by GATA Transcription Factor AreA
Eukaryot. Cell, February 1, 2006; 5(2): 226 - 237.
[Abstract] [Full Text] [PDF]


Home page
Appl. Environ. Microbiol.Home page
T. Sonke, S. Ernste, R. F. Tandler, B. Kaptein, W. P. H. Peeters, F. B. J. van Assema, M. G. Wubbolts, and H. E. Schoemaker
L-Selective Amidase with Extremely Broad Substrate Specificity from Ochrobactrum anthropi NCIMB 40321
Appl. Envir. Microbiol., December 1, 2005; 71(12): 7961 - 7973.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
R. B. Todd, J. A. Fraser, K. H. Wong, M. A. Davis, and M. J. Hynes
Nuclear Accumulation of the GATA Factor AreA in Response to Complete Nitrogen Starvation by Regulation of Nuclear Export
Eukaryot. Cell, October 1, 2005; 4(10): 1646 - 1653.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
H. Fukatsu, Y. Hashimoto, M. Goda, H. Higashibata, and M. Kobayashi
Amine-synthesizing enzyme N-substituted formamide deformylase: Screening, purification, characterization, and gene cloning
PNAS, September 21, 2004; 101(38): 13726 - 13731.
[Abstract] [Full Text] [PDF]