- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Lippai, M.
- Articles by Szabad, J.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Lippai, M.
- Articles by Szabad, J.
The Ketel Gene Encodes a Drosophila Homologue of Importin-ß
Mónika Lippaia, László Tiriána, Imre Borosb, József Mihályb, Miklós Erdélyib, István Belecza, Endre Máthéa, János Pósfaib, Adam Nagya, Andor Udvardyb, Efrosyni Paraskevac, Dirk Görlichc, and János Szabadaa Faculty of General Medicine, Department of Biology, University of Szeged, H-6720 Szeged, Hungary,
b Biological Research Center of the Hungarian Academy of Sciences, H-6701 Szeged, Hungary
c Zentrum für Molekulare Biologie, Universität Heidelberg, Heidelberg 69120, Germany
Corresponding author: János Szabad, Faculty of General Medicine, Department of Biology, University of Szeged, H-6720 Szeged, Somogyi B. u. 4, Hungary., szabad{at}comser.szote.u-szeged.hu (E-mail)
Communicating editor: T. C. KAUFMAN
| ABSTRACT |
|---|
The Drosophila melanogaster Ketel gene was identified via the KetelD dominant female sterile mutations and their ketelr revertant alleles that are recessive zygotic lethals. The maternally acting KetelD mutations inhibit cleavage nuclei formation. We cloned the Ketel gene on the basis of a common breakpoint in 38E1.2-3 in four ketelr alleles. The Ketel+ transgenes rescue ketelr-associated zygotic lethality and slightly reduce KetelD-associated dominant female sterility. Ketel is a single copy gene. It is transcribed to a single 3.6-kb mRNA, predicted to encode the 97-kD Ketel protein. The 884-amino-acid sequence of Ketel is 60% identical and 78% similar to that of human importin-ß, the nuclear import receptor for proteins with a classical NLS. Indeed, Ketel supports import of appropriately designed substrates into nuclei of digitonin-permeabilized HeLa cells. As shown by a polyclonal anti-Ketel antibody, nurse cells synthesize and transfer Ketel protein into the oocyte cytoplasm from stage 11 of oogenesis. In cleavage embryos the Ketel protein is cytoplasmic. The Ketel gene appears to be ubiquitously expressed in embryonic cells. Western blot analysis revealed that the Ketel gene is not expressed in several larval cell types of late third instar larvae.
ALONG a genetic dissection of maternal effects in Drosophila, we isolated 75 dominant female sterile (Fs) mutations (![]()
![]()
![]()
The Ketel gene, which was identified by four Fs(2)Ketel (= KetelD) mutations, is one of the 21 genes mentioned above (![]()
![]()
![]()
As described in this article, the Ketel gene encodes for the Drosophila homologue of importin-ß, a key player in nuclear protein import. (For recent reviews on nuclear protein import see ![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
, an adapter molecule, that binds to the cNLS-containing import substrate. Importin-ß forms 19 HEAT- and armadillo-resembling repeats and wraps around the importin-ß-binding (IBB) domain of importin-
(![]()
-importin-ß complex docks, in an energy-independent manner, on the cytoplasmic side of the nuclear pore complexes (NPCs). During translocation through the NPCs, importin-ß interacts with a number of nucleoporins with its NPC binding domains located toward the N terminus (![]()
![]()
-importin-ß complex disassembles. (Ran is a Ras-related G protein without a membrane anchoring site. For a recent review see ![]()
and importin-ß are recycled to initiate a new import cycle: importin-ß returns to the cytoplasm in a complex with Ran-GTP. In the cytoplasm Ran-GTP dissociates from importin-ß and is converted to Ran-GDP by RanGTP-ase activating protein (RanGAP) and the Ran binding protein 1 (RanBP1); thus importin-ß can participate in a new transport cycle (![]()
![]()
This article describes a combined genetic, molecular, and cell biological approach and reveals novel features of importin-ß. The Ketel protein shows characteristic features of importin-ß: (i) it supports import of a cNLS-containing substrate into nuclei of digitonin-permeabilized HeLa cells and (ii) it is largely cytoplasmic with pronounced accumulation in the NE. Surprisingly, the highly "toxic" KetelD egg cytoplasm, which prevents NE assembly following mitosis, does not prevent nuclear protein import. Unexpectedly, as revealed by Western blot analysis, the Ketel gene is not expressed in most cells of the larvae and adults, raising questions about cellular functions of importin-ß and nuclear import of the cNLS-containing proteins.
| MATERIALS AND METHODS |
|---|
The Ketel mutant alleles:
The EMS-induced KetelD alleles were isolated following EMS mutagenesis in a screen for dominant female-sterile mutations (![]()
![]()
![]()
![]()
![]()
![]()
Molecular cloning of the Ketel gene:
DNA manipulations, plasmid constructions, restriction mapping, Southern and Northern hybridizations, and Western blotting were done according to standard procedures. For identification of the breakpoints in the four ketelrX-associated rearrangements, we isolated DNA from ketelrX/+ adult flies. The DNA was digested with EcoRV and hybridized on Southern blots. The 32P-labeled probes for Southern hybridizations were generated by random primer labeling of restriction fragments that had been isolated from a
EMBL4 library and from CoSpeR clones identified in a chromosomal walk. The chromosomal walk initiated from a clone that hybridized to the 38E1.2-3 cytological region and was kindly provided by Dr. P. Maróy. Cloning the Ketel gene was also confirmed by in situ hybridizations on salivary gland chromosomes of the ketelrX/+ larvae. A detailed restriction map of the Ketel region was constructed and the subfragments were cloned into pBluescriptII KS+ vector. We used the subclones to precisely map the ketelrX-associated breakpoints for sequencing and screening cDNA libraries.
The Ketel cDNA clones were isolated from a
gt10 cDNA library constructed from mRNAs of 0- to 4-hr-old Drosophila embryos. (The cDNA library was a kind gift from Dr. J. Tamkun.) The screening of
1.5 x 105 independent plaques resulted in 17 cDNA clones that hybridized with at least one of the subclones covering part of the Ketel gene. The overlapping cDNA clones were identified and subcloned into the pBluescriptII KS+ vector. Sequencing of genomic and cDNA clones were done by the dideoxy method in an IBI automated sequenator on both strands. The 5' end of the mRNA was determined by primer extension. The primer extension was done by using total mRNA isolated from adult females and the synthetic olygonucleotide 5'GCTCTTTTGCTCCTATATGATTTCTAC3', which hybridized close to the 5' end of the isolated cDNA. The 3' end was present in some of the isolated cDNAs as revealed by the poly(A) tail. The intron-exon composition of the region that encodes the 3.6-kb Ketel mRNA was determined by sequencing and analyzing a 7870-bp genomic fragment. For developmental Northern analysis poly(A) mRNAs were purified, blotted, and probed with the cDNA that corresponds to the 3.6-kb Ketel mRNA. Digoxigenin (DIG)-labeled Ketel cDNA was used for the detection of Ketel mRNA during oogenesis and embryogenesis, according to standard procedures.
Homology search and putative function of the Ketel gene:
Having the above-mentioned sequences and to establish possible function of the Ketel protein, we screened databases with the BLAST service of the National Center for Biotechnology Information for identifying sequences displaying homology with the Ketel cDNA. Protein alignments were done using the MaxHom EMBL multiple sequence alignment program.
The Ketel+ transgenes:
We constructed three different types of Ketel+ (K+) transgenes. The first type included the entire 22-kb fragment shown in Fig 1A. The second type covered a 13.8-kb Xba genomic fragment (Fig 1B). In the third type a 4.0-kb Xba-BamHI genomic fragmentincluding the Ketel promoter and the 5' segment of the Ketel coding regionwas combined with a 2.3-kb cDNA fragment that corresponded to the rest of the transcribed part of the Ketel gene (see Fig 1B). The above sequences were cloned into the CaSpeR vector with the mini-white marker gene and germline transformants were generated by standard procedures. The K+ transgene-carrying flies have light to orange-yellowish eyes on the white genetic background. The K+ transgenes were used for the construction of K+; ketelr/- and K+; KetelD/- as well as K+; KetelD/+ and K+/K+; KetelD/+ zygotes. Their viability and the fertility of the females were tested.
|
Production of the Ketel protein in bacteria and the generation of anti-Ketel polyclonal antibodies:
A pGEX-Ketel plasmid was constructed first by the insertion of the BamHI-EcoRI fragment of the Ketel cDNA (Fig 1A) into the corresponding sites of a pGEX4T-1 vector and glutathione-S-transferase (GST)-Ketel fusion protein was produced in Escherichia coli. The fusion protein consisted of the GST moiety fused in frame with the 147884 amino-acid encoding segment of the Ketel protein. The GST-Ketel fusion protein was purified by affinity chromatography on a glutathion-agarose column and used for immunization of rabbits for the production of anti-Ketel polyclonal antibodies following standard protocols. After several boosts, the crude sera were analyzed for the presence of anti-Ketel antibody by Western blots. Two rabbits produced good titers of anti-Ketel sera by virtue of their ability to recognize the Ketel protein in E. coli extracts from strains with pGEX-Ketel but not in the control bacterial extracts.
For production of a nearly full-length Ketel protein, we made use of the pET-His3A expression system (![]()
The anti-Ketel antibody was purified in two steps: first on a protein-A and afterward on a Ketel protein affinity column. The affinity-purified anti-Ketel antibody was used both in Western blots and in confocal microscopy for the detection of Ketel protein. For Western blots protein extracts were prepared from embryos, larvae, and adults as well as from different organs of late third instar larvae. For laser scanning microscopy ovaries were dissected, fixed, and treated with antibodies. The Ketel protein was detected by the affinity-purified polyclonal anti-Ketel rabbit antibody that was made visible by a goat anti-rabbit rhodamin-labeled secondary antibody (Jackson Laboratories, West Grove, PA). The NE was made visible with a primary monoclonal anti-lamin mouse antibody (![]()
![]()
The in vitro nuclear protein import assay:
Drosophila importin-ß cDNA was cloned into the SphI-XmaI sites of pQE30 (QIAGEN, Valencia, CA), expressed with an NH2-terminal His tag and purified, on nickel-NTA agarose, followed by chromatography on a Superdex 200 gel filtration column.
The nuclear protein import assay was conducted as follows. Permeabilized HeLa cells were prepared by a modification of a published protocol (![]()
(IBB core pentamer). Import reaction samples contained 0.24 µM fluorescein-labeled IBB core pentamer. In the indicated reactions 1.2 µM Drosophila importin-ß, Ran, and an energy-regenerating system were added. Reactions were stopped after 5 min by fixation in 3% paraformaldehyde (w/v) in PBS, washed in PBS and water, and mounted with 2 µl of vectorshield mounting medium (Vector, Burlingame, CA).
The digitonin-permeabilized HeLa cell system was also used to follow nuclear import of the cNLS-phycoerythrin (cNLS-PE; ![]()
| RESULTS |
|---|
Molecular cloning of the Ketel gene of Drosophila:
Four of the X-ray-induced ketelrX revertant alleles have a common breakpoint in the 38E1.2-3 cytological region (![]()
60 kb and resulted in a 5.5-kb genomic BglII-BamHI fragment that included all four of the ketelrX-associated breakpoints (Fig 1A). The corresponding region of the Drosophila genome is included in a cosmid clone that we isolated from a CoSpeR Not-Bam-Not cosmid library (Fig 1A). On Northern blots, the BglII-BamHI fragment strongly hybridized to a 3.6-kb mRNA specimen that most likely represents the Ketel gene. The 3.6-kb mRNA is abundant in females and young embryos and appears to be present, although in much reduced concentrations, throughout development (data not shown).
To isolate cDNA clones that correspond to the 3.6-kb Ketel mRNA, overlapping genomic fragments covering the Xba-EcoRV 10.7-kb region (Fig 1A) were used for the screening of a cDNA library prepared from 0- to 4-hr-old embryos. The longest isolated cDNA was 2858 bp long. However, it did not contain poly(A) tail. Overlaps of the 2858-bp cDNA clone with poly(A)-containing cDNAs allowed the reconstruction of a 3378-bp-long cDNA. In vitro extension was done on the basis of the mRNAs isolated from adult females and of a primer complementary to the 5' end of the 2858-bp-long cDNA. The primer extension indicated a major transcription initiation site 478 bp upstream from the 5' end of the 2858-bp cDNA. We concluded, after finding out about the missing 3' and 5' ends of the 2858-bp cDNA, that the encoded Ketel mRNA is 3656 nucleotides long and corresponds to the 3.6-kb mRNA detected in Northern analysis.
To determine molecular organization of the Ketel locus, we sequenced a 7870-bp long genomic DNA region that corresponds to the encoded cDNA and the surrounding sequences (Fig 1A). The nucleotide sequence is available in the EMBL nucleotide sequence database under the accession no. AJ002729. Comparison of the cDNA and the genomic sequences revealed that the Ketel gene contains 5 introns. The Ketel mRNA is composed from a 444-bp leader sequence, a 2652-bp open reading frame (ORF), and a 560-nucleotide-long trailer sequence (Fig 1A). To decide whether Ketel is a single copy gene or is present in multiple copies, we digested genomic DNA with three different restriction enzymes (EcoRI, Xba, and BglII) and carried out Southern analyses with 32P-labeled cDNA fragments. In every case, the labeled cDNA fragments hybridized with a single band, making it very likely that Ketel is a single copy gene (data not shown). The finding that under high stringency conditions the Ketel cDNA hybridized exclusively to the 38E1.2-3 region on salivary gland chromosomes supports the above conclusion.
The Ketel+ transgenes:
To prove that the cloned gene is indeed Ketel, we generated three different types of altogether 21 Ketel+ (K+) transgenes (Fig 1B and Table 1) and analyzed their effects on both ketelr and KetelD mutations. Nine of the 12 tested K+ transgenes brought about full rescue of lethality associated with the loss-of-function ketelrX13/- genotype: the K+; ketelrX13/- flies developed with the expected frequencies and were fully fertile, showing that the cloned gene is Ketel (Table 1; ketelrX13 is a null allele).
|
Type I and each of the three tested type III K+ transgenes brought about slight rescue of the KetelD2-associated dominant female sterility. In
1% of the eggs deposited by the K+; KetelD2/+ females embryogenesis progressed to the stage of embryonic cuticle formation and even a few offspring developed from the K+; KetelD2/+ females. However, the rate of offspring production was as low as 24 x 10-3 offspring/(female x day), as compared to the
50 offspring/(female x day) control value. (It should be noted that cuticle and offspring did not develop from tens of thousands of eggs deposited by KetelD2/+ females.) One copy of the K+ transgenes had no effects on the other three KetelD mutations. However, two copies of the K+ transgenes brought about slight reduction of female sterility when sperm with two normal Ketel gene copies fertilized the eggs (![]()
The Ketel gene encodes the Drosophila homologue of importin-ß:
The Ketel cDNA contains a 2652-nucleotide-long ORF encoding for a protein of 884 amino acids with a molecular mass of 97 kD. Comparison of the Ketel protein amino acid sequence with known sequences revealed a 60.3% amino acid identity and a 78.2% similarity with human importin-ß, a known component of nuclear protein import (Fig 2; ![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
|
The Ketel protein supports nuclear protein import:
To decide whether the Ketel protein does indeed function as importin-ß we monitored (i) the docking on the cytoplasmic surface of the NE and (ii) import into nuclei of digitonin-permeabilized HeLa cells of a fluorescent-labeled nuclear substrate in the presence of the Ketel protein and other components of the nuclear protein import apparatus (see MATERIALS AND METHODS). As shown on Fig 3B, the substrate docked on the NE in presence of the Ketel protein, and when Ran and an energy source were added the substrate was imported into the nuclei (Fig 3B and Fig D). The permeabilized HeLa cell experiments clearly showed that the Ketel protein molecules function as importin-ß: they can assist docking and import of nuclear proteins into the nuclei.
|
To understand effects of the KetelD mutations on nuclear protein import, we prepared cytosol from ovaries of both KetelD/+ and wild-type females. All the four KetelD mutations were included in this study. The cytosol preparations were used in the permeabilized HeLa cell assay and import of the cNLS-PE substrate was monitored (see MATERIALS AND METHODS). In presence of the wild-type ovary cytosol the cNLS-PE substrate entered the nuclei of HeLa cells within a few minutes (Fig 4B). Surprisingly, the KetelD/+-derived cytosol preparations just as efficiently supported nuclear import of the cNLS-PE substrate as the wild-type ovary cytosol, showing that the KetelD-encoded mutant molecules do not interfere with import of the cNLS-PE substrate. Note that when injected into wild-type cleavage embryos, traces of the KetelD egg cytoplasm prevent the formation of cleavage nuclei at the end of mitosis (![]()
|
Expression pattern of the Ketel gene:
To study the expression pattern of the Ketel gene, we detected both Ketel mRNA and Ketel protein during oogenesis and embryogenesis. Some Ketel mRNA, as detected with the DIG-labeled Ketel cDNA, is present in nurse cells of the stage 9 egg primordia. The concentration of Ketel mRNA becomes rather high by stage 10 (Fig 5A) when dumping of the Ketel mRNA into the oocyte cytoplasm begins. Beyond stage 11 the Ketel mRNA is homogeneously distributed in the oocyte cytoplasm (Fig 5B). The Ketel gene appears to be ubiquitously expressed in every blastoderm cell (Fig 5C) and, as far as it can be deduced from the staining patterns, also during later stages of embryogenesis (Fig 5, DF). The Ketel gene seems to be intensively expressed in the central nervous system and in the larval gonads (Fig 5E and Fig F). The larval gonads include both ovaries and testes since the gonads possess intensive staining in each of the embryos.
|
We also followed Ketel gene expression through the detected Ketel protein with the affinity-purified polyclonal anti-Ketel antibody. The anti-Ketel antibody detected a single 97-kD protein band on Western blots with extracts prepared from different developmental stages (Fig 6). The Ketel protein is abundant in the ovaries and in the newly deposited eggs throughout embryogenesis and is present throughout all stages of development. However, when compared, e.g., to ovaries, the relative Ketel protein concentration was rather low in larvae and adult females from which the ovaries were removed. To clarify the low Ketel protein content we dissected different organs from late third instar larvae and subjected them to Western blot analysis. As shown in Fig 6, while, e.g., the imaginal discs contained significant amounts of the Ketel protein, there were no detectable amounts of Ketel protein present in a number of larval tissues including the salivary glands, gut, Malpighian tubules, or the larval epidermis with the overlying larval musculature.
|
Formation and localization of the Ketel protein was also followed in the course of oogenesis and embryogenesis by immunocytology and confocal microscopy. The Ketel protein is first detectable in nurse cells during stage 8 of oogenesis (not shown). By stage 10 the nurse cells contain large quantities of the Ketel protein. The protein is cytoplasmic with pronounced accumulation in the NEs (Fig 7A and Fig C). Nurse cells dump their Ketel protein contents into the oocyte cytoplasm from stage 11 of oogenesis. The follicle cells also contain Ketel protein (Fig 7A). Cytoplasm of a newly deposited egg contains stockpiles of the Ketel protein. During cleavage divisions the Ketel protein is present throughout the cleavage cycles. It is cytoplasmic and shows accumulation in the NE (Fig 7D and Fig F).
|
Immunoreactive features of the KetelD-encoded protein molecules are not different from wild type: amount and size of the immunoreactive components in wild-type and KetelD/+ ovary and egg extracts appear identical on Western blots (data not shown). These observations suggest that the EMS-induced KetelD mutations (i) did not alter the expression pattern of the gene and (ii) did not change the size of the encoded protein molecules.
| DISCUSSION |
|---|
The Ketel gene encodes the Drosophila homologue of importin-ß:
The Ketel gene was identified by four EMS-induced Fs(2)Ketel (= KetelD) dominant female sterile mutations and their ketelr revertant alleles (![]()
![]()
![]()
![]()
To show that the cloned gene is indeed Ketel, we generated different types of K+ transgenes. Because the transgenes bring about rescue of ketelr-associated lethality, it is safe conclude that the cloned gene is Ketel. Furthermore, the K+ transgenes slightly reduce KetelD-associated dominant female sterility, showing that the normal and the KetelD-encoded mutant gene products participate in the same pathway. The slight rescue of KetelD-associated dominant female sterility implies a dominant-negative nature of the KetelD mutations; i.e., the KetelD-encoded molecules impede function of the normal Ketel gene products (![]()
Comparison of nucleotide and amino acid sequences of the Ketel gene and the Ketel protein revealed strong homology with human importin-ß, a component of nuclear protein import: in the two protein sequences 60% of the amino acids are identical and 78% are of similar nature.
Importin-ß (also called karyopherin-ß) is a major component of nuclear protein import and has been known from biochemical studies in which components of nuclear protein import were identified (![]()
![]()
![]()
![]()
![]()
![]()
Transport of macromolecules between the cytoplasm and the nucleus proceeds through the NPCs and is mediated by shuttling receptors of the importin-ß superfamily (for reviews see ![]()
![]()
![]()
![]()
![]()
, in the cytoplasm and release them in the nucleus. A RanGTP gradient provides the driving force for transport: importins bind their cargo in the cytoplasm where RanGTP levels are low and release it upon encountering high RanGTP concentration in the nucleus. The conversion of RanGTP to RanGDP in the cytoplasm is catalyzed by RanGAP1 and is further stimulated by RanBPs. RanGTP is generated from RanGDP in the nucleus by RCC1 (regulator of chromatin condensation), a chromatin-associated nucleotide exchange factor. Importin-ß is engaged in nuclear import of proteins with cNLS through importin-
, an adapter molecule. Importin-ß can also operate as an autonomous receptor independently of importin-
. A number of types of proteins have been identified that can directly bind to importin-ß and are imported into the nucleus, e.g., some ribosomal proteins and the HIV Rev protein (![]()
![]()
![]()
![]()
![]()
, importin-ß also uses other adapter molecules: snurportin1 for the import of m3G-capped UsnRNPs (![]()
![]()
Several members of the importin-ß superfamily have been identified mainly in yeast and vertebrates (![]()
![]()
![]()
![]()
![]()
|
The Ketel protein is cytoplasmic and is not present in every cell type:
As other members of the importin-ß family, the Ketel protein is largely cytoplasmic (![]()
![]()
![]()
The possible mode of action of the KetelD-encoded proteins:
When injected into wild-type cleavage embryos, traces of the KetelD egg cytoplasm exert deleterious effects through the prevention of cleavage nuclei formation (![]()
![]()
![]()
Indeed, the deleterious effects of the KetelD mutations become apparent at the end of cleavage mitosis when the NE reassemble and daughter nuclei form. Remarkably, the KetelD cytosol did not disrupt HeLa cell nuclei and, along with this observation, Drosophila wild-type interphase cleavage nuclei remained intact in presence of the KetelD egg cytoplasm. Because the digitonin-permeabilized HeLa cells do not divide, they are inadequate to detect defects associated with NE assembly. It appears as if the KetelD mutations identify a novel function of importin-ß required during reassembly of the NE at the end of mitosis. Perhaps importin-ß is not only engaged in nuclear protein import but is also a structural component of the NPCs, as ![]()
NE assembly is a stepwise process (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
| ACKNOWLEDGMENTS |
|---|
We thank Dr. A. Shearn for the y+CyO chromosome, Drs. Y. Gruenbaum and H. Saumweber for the anti-lamin antibody samples, J. Tamkun for the cosmid library, and P. Maróy for the clone to initiate the genomic walk. We thank the excellent technical help of Révész Kati and Kissné Ani. We express our gratitude to Dr. David Glover, who organized support through the Préadhésion pour les Dix Pays d'Europe Centrale et Orientale no. CEC ERB CIPD CT 94 0049 EC Cell Cycle Network program. Support for the "Ketel project" came from the following additional sources: OTKA 922, OTKA T5537, and OTKA T32540 from the Hungarian National Science Foundation, FKFP grant 1348/1997 from the Hungarian Education and Science Foundation and the Poland and Hungary: Action for the Restructuring of the Economy-ACCORD Program no. H-9112-0528.
Manuscript received January 27, 2000; Accepted for publication September 14, 2000.
| LITERATURE CITED |
|---|
ADAM, E. J. H. and S. A. ADAM, 1994 Identification of cytosolic factors required for nuclear location sequence-mediated binding to the nuclear envelope. J. Cell Biol. 125:547-555
ADAM, S. A., R. STERNE-MARR, and L. GERACE, 1990 Nuclear import in permeabilized mammalian cells requires soluble cytoplasmic factors. J. Cell Biol. 111:807-816
ASHERY-PADAN, R., N. ULITZUR, A. ARBEL, M. GOLDBERG, and A. M. WEISS et al., 1997 Localization and posttranslational modifications of otefin, a protein required for vesicle attachment to chromatin, during Drosophila melanogaster development. Mol. Cell. Biol. 17:4114-4123
AZUMA, Y. and M. DASSO, 2000 The role of Ran in nuclear function. Curr. Opin. Cell Biol. 12:302-307[Medline].
BISCHOFF, F. R. and D. GÖRLICH, 1997 RanBP1 is crucial for the release of RanGTP from importin-beta-related nuclear transport factors. FEBS Lett. 419:249-254[Medline].
BURKE, B. and L. GERACE, 1986 A cell free system to study reassembly of the nuclear envelope at the end of mitosis. Cell 44:639-652[Medline].
CAMPOS-ORTEGA, J. A., and V. HARTENSTEIN, 1997 The Embryonic Development of Drosophila melanogaster. Springer, Berlin.
CHEN, B. P. C. and T. HAI, 1994 Expression vectors for affinity purification and radiolabeling of proteins using E. coli as host. Gene 139:73-75[Medline].
CHI, N. C., E. J. H. ADAM, and S. A. ADAM, 1995 Sequence and characterization of cytoplasmic nuclear protein import factor p97. J. Cell Biol. 130:265-274
CINGOLANI, G., C. PETOSA, K. WEIS, and C. W. MÜLLER, 1999 Structure of importin-ß bound to the IBB domain of importin-
. Nature 399:221-229[Medline].
COLAS, J., Y. LAUNAY, and L. MAROTEAUX, 1999 Maternal and zygotic control of serotonin biosynthesis are both necessary for Drosophila germband extension. Mech. Dev. 87:67-76[Medline].
CORBETT, A. H. and P. A. SILVER, 1997 Nucleocytoplasmic transport of macromolecules. Microbiol. Mol. Biol. Rev. 61:193-211
CSERPÁN, I. and A. UDVARDY, 1995 The mechanism of nuclear transport of natural or artificial transport substances in digitonin permeabilized cell. J. Cell Sci. 108:1849-1861[Abstract].
ENENKEL, C., G. BLOBEL, and M. REXACH, 1995 Identification of a yeast karyopherin heterodimer that targets import substrate to mammalian nuclear pore complexes. J. Biol. Chem. 270:16499-16502
ERDÉLYI, M. and J. SZABAD, 1989 Isolation and characterization of dominant female sterile mutations of Drosophila melanogaster. I. Mutations on the third chromosome. Genetics 122:111-127
ERDÉLYI, M., E. MÁTHÉ, and J. SZABAD, 1997 Genetic and developmental analysis of mutant Ketel alleles that identify the Drosophila importin-ß homologue. Acta Biol. Hung. 48:323-338[Medline].
FASKEN, M. B., R. SAUNDERS, M. ROSENBERG, and D. W. BRIGHTY, 2000 A leptomycin B-sensitive homologue of human CRM1 promotes nuclear export of nuclear export sequence-containing proteins in Drosophila cells. J. Biol. Chem. 275:1878-1886
GANT, T. M., M. W. GOLDBERG, and T. D. ALLEN, 1998 Nuclear envelope and nuclear pore assembly: analysis of assembly intermediates by electron microscopy. Curr. Opin. Cell Biol. 10:409-415[Medline].
GOLDBERG, M. W., C. WIESE, T. D. ALLEN, and K. L. WILSON, 1997 Dimples, pores, star-rings, and thin rings on growing nuclear envelopes: evidence for structural intermediates in nuclear pore assembly. J. Cell Sci. 110:409-420[Abstract].
GÖRLICH, D. and U. KUTAY, 1999 Transport between the cell nucleus and the cytoplasm. Annu. Rev. Cell Dev. Biol. 15:607-660[Medline].
GÖRLICH, D. and I. MATTAJ, 1997 Nucleocytoplasmic transport. Science 271:1513-1518[Abstract].
GÖRLICH, D., F. VOGEL, A. D. MILLS, E. HARTMANN, and R. A. LASKEY, 1995a Distinct functions for the two importin-subunits in nuclear protein import. Nature 377:246-248[Medline].
GÖRLICH, D., S. KOSTKA, R. KRAFT, C. DINGWALL, and R. A. LASKEY et al., 1995b Two different subunits of importin-cooperate to recognize nuclear localization signals and bind them to the nuclear envelope. Curr. Biol. 5:383-392[Medline].
GÖRLICH, D., M. DABROWSKI, F. R. BISCHOFF, U. KUTAY, and P. BORK et al., 1997 A novel class of RanGTP binding proteins. J. Cell Biol. 138:65-80
HAREL, A., F. ZLOTKIN, S. NAINUDEL-EPSZTEYN, N. FEINSTEIN, and P. A. FISHER et al., 1989 Persistence of major nuclear envelope antigens in an envelope-like structure during mitosis in Drosophila melanogaster embryos. J. Cell Sci. 944:463-470.
HENDERSON, B. R. and P. PERCIPALLE, 1997 Interactions between HIV Rev and nuclear import and export factors: the Rev nuclear localisation signal mediates specific binding to human importin-beta. J. Mol. Biol. 274:693-707[Medline].
HUBER, J., U. CRONSHAGEN, M. KADOKURA, C. MARSCHALLY, and T. WADA et al., 1998 Snurportin 1, an m3G-cap-specific nuclear import receptor with a novel domain structure. EMBO J. 17:4114-4126[Medline].
IMAMOTO, N., T. SHIMAMOTO, S. KOSE, T. TAKAO, and T. TACHIBANA et al., 1995 The nuclear pore targeting complex binds to nuclear pores after association with a karyophile. FEBS Lett. 368:415-419[Medline].
IOVINE, M. K., J. L. WATKINS, and S. R. WENTE, 1995 The GLFG repetitive region of the nucleoporin Nup116p interacts with Kap95p, an essential yeast nuclear import factor. J. Cell Biol. 131:1699-1731
JÄKEL, S. and D. GÖRLICH, 1998 Importin-ß, transportin, RanBP5 and RanBp7 mediate nuclear import of ribosomal proteins in mammalian cells. EMBO J. 17:4491-4502[Medline].
JÄKEL, S., W. ALBIG, U. KUTAY, F. R. BISCHOFF, and K. SCHWAMBORN et al., 1999 The importin-ß/importin-7 heterodimer is a functional nuclear import receptor for histone H1. EMBO J. 18:2411-2423[Medline].
JULLIEN, D., D. GÖRLICH, and D. GÖRLICHU. K. LAEMMLI AND Y. ADACHI, 1999 Nuclear import of RPA in Xenopus egg extracts requires a novel protein XRIPa but not importin-
. EMBO J. 18:4348-4358[Medline].
KOZLOVA, T., G. V. POKHOLKOVA, G. TZERTZINIS, J. D. SUTHERLAND, and I. F. ZHIMULEV et al., 1998 Drosophila hormone receptor 38 functions in metamorphosis: a role in adult cuticle formation. Genetics 149:1465-1475
KUTAY, U., E. IZAURRALDE, F. R. BISCHOFF, I. W. MATTAJ, and D. GÖRLICH, 1997 Dominant-negative mutants of importin-ß block multiple pathways of import and export through the nuclear pore complex. EMBO J. 16:1153-1163[Medline].
LINDSLEY, D. L., and G. G. ZIMM, 1992 The Genome of Drosophila melanogaster. Academic Press, San Diego and London.
MARSHALL, I. B. and K. L. WILSON, 1997 Nuclear envelope assembly after mitosis. Trends Cell Biol. 7:69-74.
MATTAJ, I. W. and L. ENGLMEIER, 1998 Nucleocytoplasmic transport: the soluble phase. Annu. Rev. Biochem. 67:265-306[Medline].
MELCHIOR, F. and L. GERACE, 1998 Two-trafficking with Ran. Trends Cell Biol. 8:175-179[Medline].
NORVELL, A., R. L. KELLEY, K. WEHR, and T. SCHUPBACH, 1999 Specific isoforms of squid, a Drosophila hnRNP, perform distinct roles in Gurken localization during oogenesis. Genes Dev. 13:864-876
PADDY, M. R., H. SAUMWEBER, D. A. AGARD, and J. W. SEDAT, 1996 Time-resolved, in vivo studies of mitotic spindle formation and nuclear lamina breakdown in Drosophila early embryos. J. Cell Sci. 109:591-607
PEMBERTON, L. F., G. BLOBEL, and J. ROSENBLUM, 1998 Transport through the nuclear pore complex. Curr. Opin. Cell Biol. 10:392-399[Medline].
RADU, A., G. BLOBEL, and M. S. MOORE, 1995 Identification of a protein complex that is required for nuclear protein import and mediates docking of import substrate to distinct nucleoporin. Proc. Natl. Acad. Sci. USA 92:1769-1773
SIOMI, M. C., M. FROMONT, J. C. RAIN, L. WAN, and F. WANG et al., 1998 Functional conservation of the transportin-nuclear import pathway in divergent organisms. Mol. Cell. Biol. 18:4141-4148
SPRADLING, A. C., D. STERN, A. BEATON, E. J. RHEM, and T. LAVERTY et al., 1999 The Berkeley Drosophila genome project gene disruption project: single P-element insertions mutating 25% of vital Drosophila genes. Genetics 153:135-177
SUTOVSKY, P., C. SIMERLY, L. HEWITSON, and G. SCHATTEN, 1998 Assembly of nuclear pore complexes and annulate lamellae promotes normal pronuclear development in fertilized mammalian oocytes. J. Cell Sci. 111:2841-2854[Abstract].
SZABAD, J., M. ERDÉLYI, G. HOFFMANN, J. SZIDONYA, and T. R. F. WRIGHT, 1989 Isolation and characterization of dominant female sterile mutations of Drosophila melanogaster. II. Mutations on the second chromosome. Genetics 122:823-835
TIMMONS, L., E. HERSPERGER, E. WOODHOUSE, J. XU, and L. Z. LIU et al., 1993 The expression of the Drosophila awd gene during normal development and in neoplastic brain tumors caused by lgl mutations. Dev. Biol. 158:364-379[Medline].
TIRIÁN, L., J. PURO, M. ERDÉLYI, I. BOROS, and B. PAPP et al., 2000 The KetelD dominant-negative mutations identify maternal function of the Drosophila importin-ß gene required for cleavage nuclei formation. Genetics 156:1901-1912
TRUANT, R. and B. R. CULLEN, 1999 The arginine-rich domains present in human immunodeficiency virus type 1 tat and rev function as direct importin-beta-dependent nuclear localization signals. Mol. Cell. Biol. 19:1210-1217
WEIS, K., 1998 Importins and exportins. Trends Biol. Sci. 23:185-189.
WIESCHAUS, E., 1996 Embryonic transcription and the control of developmental pathways. Genetics 142:5-10[Medline].
WILSON, R., R. AINSCOUGH, K. ANDERSON, C. BAYNES, and M. BERKS et al., 1994 2.2 Mb of contiguous nucleotide sequence from chromosome III of C. elegans.. Nature 368:32-38[Medline].
WOZNIAK, R. W., M. P. ROUT, and J. D. AITCHISON, 1998 Karyopherins and kissing cousins. Trends Cell Biol. 8:184-188[Medline].
ZHANG, C., M. HUGHES, and P. R. CLARKE, 1999 Ran-GTP stabilizes microtubule asters and inhibits nuclear assembly in Xenopus egg extracts. J. Cell Sci. 112:2453-2461[Abstract].
ZHANG, C. and P. R. CLARKE, 2000 Chromatin-independent nuclear envelope assembly induced by Ran GTPase Xenopus egg extracts. Science 288:1429-1432
This article has been cited by other articles:
![]() |
K. R. Katsani, R. E. Karess, N. Dostatni, and V. Doye In Vivo Dynamics of Drosophila Nuclear Envelope Components Mol. Biol. Cell, September 1, 2008; 19(9): 3652 - 3666. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Sabri, P. Roth, N. Xylourgidis, F. Sadeghifar, J. Adler, and C. Samakovlis Distinct functions of the Drosophila Nup153 and Nup214 FG domains in nuclear protein transport J. Cell Biol., August 9, 2007; 178(4): 557 - 565. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Xylourgidis, P. Roth, N. Sabri, V. Tsarouhas, and C. Samakovlis The nucleoporin Nup214 sequesters CRM1 at the nuclear rim and modulates NF{kappa}B activation in Drosophila J. Cell Sci., November 1, 2006; 119(21): 4409 - 4419. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Shibata, M. Sasaki, T. Miki, A. Shimamoto, Y. Furuichi, J. Katahira, and Y. Yoneda Exportin-5 orthologues are functionally divergent among species Nucleic Acids Res., October 18, 2006; 34(17): 4711 - 4721. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Roth, N. Xylourgidis, N. Sabri, A. Uv, M. Fornerod, and C. Samakovlis The Drosophila nucleoporin DNup88 localizes DNup214 and CRM1 on the nuclear envelope and attenuates NES-mediated nuclear export J. Cell Biol., November 24, 2003; 163(4): 701 - 706. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Hunter, M. J. Aukerman, H. Sun, M. Fokina, and R. S. Poethig PAUSED Encodes the Arabidopsis Exportin-t Ortholog Plant Physiology, August 1, 2003; 132(4): 2135 - 2143. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. M. Bollman, M. J. Aukerman, M.-Y. Park, C. Hunter, T. Z. Berardini, and R. S. Poethig HASTY, the Arabidopsis ortholog of exportin 5/MSN5, regulates phase change and morphogenesis Development, April 15, 2003; 130(8): 1493 - 1504. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Timinszky, L. Tirian, F. T. Nagy, G. Toth, A. Perczel, Z. Kiss-Laszlo, I. Boros, P. R. Clarke, and J. Szabad The importin-{beta} P446L dominant-negative mutant protein loses RanGTP binding ability and blocks the formation of intact nuclear envelope J. Cell Sci., April 15, 2002; 115(8): 1675 - 1687. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Tirián, J. Puro, M. Erdélyi, I. Boros, B. Papp, M. Lippai, and J. Szabad The KetelD Dominant-Negative Mutations Identify Maternal Function of the Drosophila Importin-{beta} Gene Required for Cleavage Nuclei Formation Genetics, December 1, 2000; 156(4): 1901 - 1912. [Abstract] [Full Text] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Lippai, M.
- Articles by Szabad, J.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Lippai, M.
- Articles by Szabad, J.













