Genetics, Vol. 156, 1889-1900, December 2000, Copyright © 2000

The Ketel Gene Encodes a Drosophila Homologue of Importin-ß

Mónika Lippaia, László Tiriána, Imre Borosb, József Mihályb, Miklós Erdélyib, István Belecza, Endre Máthéa, János Pósfaib, Adam Nagya, Andor Udvardyb, Efrosyni Paraskevac, Dirk Görlichc, and János Szabada
a Faculty of General Medicine, Department of Biology, University of Szeged, H-6720 Szeged, Hungary,
b Biological Research Center of the Hungarian Academy of Sciences, H-6701 Szeged, Hungary
c Zentrum für Molekulare Biologie, Universität Heidelberg, Heidelberg 69120, Germany

Corresponding author: János Szabad, Faculty of General Medicine, Department of Biology, University of Szeged, H-6720 Szeged, Somogyi B. u. 4, Hungary., szabad{at}comser.szote.u-szeged.hu (E-mail)

Communicating editor: T. C. KAUFMAN


*  ABSTRACT
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

The Drosophila melanogaster Ketel gene was identified via the KetelD dominant female sterile mutations and their ketelr revertant alleles that are recessive zygotic lethals. The maternally acting KetelD mutations inhibit cleavage nuclei formation. We cloned the Ketel gene on the basis of a common breakpoint in 38E1.2-3 in four ketelr alleles. The Ketel+ transgenes rescue ketelr-associated zygotic lethality and slightly reduce KetelD-associated dominant female sterility. Ketel is a single copy gene. It is transcribed to a single 3.6-kb mRNA, predicted to encode the 97-kD Ketel protein. The 884-amino-acid sequence of Ketel is 60% identical and 78% similar to that of human importin-ß, the nuclear import receptor for proteins with a classical NLS. Indeed, Ketel supports import of appropriately designed substrates into nuclei of digitonin-permeabilized HeLa cells. As shown by a polyclonal anti-Ketel antibody, nurse cells synthesize and transfer Ketel protein into the oocyte cytoplasm from stage 11 of oogenesis. In cleavage embryos the Ketel protein is cytoplasmic. The Ketel gene appears to be ubiquitously expressed in embryonic cells. Western blot analysis revealed that the Ketel gene is not expressed in several larval cell types of late third instar larvae.


ALONG a genetic dissection of maternal effects in Drosophila, we isolated 75 dominant female sterile (Fs) mutations (ERDELYI and SZABAD 1989 Down; SZABAD et al. 1989 Down). In 32 of the Fs mutations the Fs/+ females deposit normal-looking eggs, and although the eggs are fertilized embryogenesis does not commence or ceases after a few abnormal cleavage divisions. The 32 Fs mutations identify 21 genes, suggesting that products of several genes are required for commencement and the initial steps of embryogenesis. This conclusion is supported by the fact that very few, if any, of the zygotic genes are expressed during early embryogenesis and evidently the initial steps of embryogenesis are under maternal control (WIESCHAUS 1996 Down).

The Ketel gene, which was identified by four Fs(2)Ketel (= KetelD) mutations, is one of the 21 genes mentioned above (SZABAD et al. 1989 Down; ERDELYI et al. 1997 Down). As described in the accompanying article (TIRIAN et al. 2000 Down), embryogenesis is terminated in KetelD eggs, which are deposited by the KetelD/+ females, soon after fertilization due to the failure of cleavage nuclei formation. When injected into wild-type cleavage embryos, the KetelD egg cytoplasm is toxic: it hinders formation of cleavage nuclei following mitosis most likely through the prevention of nuclear envelope (NE) assembly and/or function. The mutant phenotype suggests involvement of the Ketel gene in a NE-related function and motivated cloning of the gene.

As described in this article, the Ketel gene encodes for the Drosophila homologue of importin-ß, a key player in nuclear protein import. (For recent reviews on nuclear protein import see CORBETT and SILVER 1997 Down; GORLICH and MATTAJ 1997 Down; MATTAJ and ENGLMEIER 1998 Down; MELCHIOR and GERACE 1998 Down; PEMBERTON et al. 1998 Down; WEIS 1998 Down; WOZNIAK et al. 1998 Down; GORLICH and KUTAY 1999 Down). Briefly, importin-ß, the founding member of the importin-ß superfamily, was originally described to participate in import of proteins that carry a classical nuclear localization signal (cNLS) into the nucleus. The C-terminal section of importin-ß associates with importin-{alpha}, an adapter molecule, that binds to the cNLS-containing import substrate. Importin-ß forms 19 HEAT- and armadillo-resembling repeats and wraps around the importin-ß-binding (IBB) domain of importin-{alpha} (CINGOLANI et al. 1999 Down). The substrate-importin-{alpha}-importin-ß complex docks, in an energy-independent manner, on the cytoplasmic side of the nuclear pore complexes (NPCs). During translocation through the NPCs, importin-ß interacts with a number of nucleoporins with its NPC binding domains located toward the N terminus (KUTAY et al. 1997 Down; WOZNIAK et al. 1998 Down). Import of the cNLS-containing nuclear protein is completed on the nuclear surface of the NPCs, where following interaction of the transport complex with Ran-GTP, the substrate-importin-{alpha}-importin-ß complex disassembles. (Ran is a Ras-related G protein without a membrane anchoring site. For a recent review see AZUMA and DASSO 2000 Down.) The import substrate stays in the nucleus, while importin-{alpha} and importin-ß are recycled to initiate a new import cycle: importin-ß returns to the cytoplasm in a complex with Ran-GTP. In the cytoplasm Ran-GTP dissociates from importin-ß and is converted to Ran-GDP by RanGTP-ase activating protein (RanGAP) and the Ran binding protein 1 (RanBP1); thus importin-ß can participate in a new transport cycle (BISCHOFF and GORLICH 1997 Down; AZUMA and DASSO 2000 Down).

This article describes a combined genetic, molecular, and cell biological approach and reveals novel features of importin-ß. The Ketel protein shows characteristic features of importin-ß: (i) it supports import of a cNLS-containing substrate into nuclei of digitonin-permeabilized HeLa cells and (ii) it is largely cytoplasmic with pronounced accumulation in the NE. Surprisingly, the highly "toxic" KetelD egg cytoplasm, which prevents NE assembly following mitosis, does not prevent nuclear protein import. Unexpectedly, as revealed by Western blot analysis, the Ketel gene is not expressed in most cells of the larvae and adults, raising questions about cellular functions of importin-ß and nuclear import of the cNLS-containing proteins.


*  MATERIALS AND METHODS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

The Ketel mutant alleles:
The EMS-induced KetelD alleles were isolated following EMS mutagenesis in a screen for dominant female-sterile mutations (SZABAD et al. 1989 Down). The 27 recessive ketelr alleles were generated through second mutagenesis of the KetelD alleles (ERDELYI et al. 1997 Down; SZABAD et al. 1989 Down). The ketelr/- and the KetelD/- hemizygotes were produced by crossing y/y; ketelrX32/y+CyO females with y/Y; ketelr/y+CyO and y/Y; KetelD/y+CyO males, respectively. [The ketelrX32 allele, abbreviated as -, is a small deficiency that removes the Ketel and a few adjacent loci (ERDELYI et al. 1997 Down). The y+CyO balancer chromosome carries a y+ transgene (TIMMONS et al. 1993 Down).] Head skeleton and ventral setae of the descending ketelr/- and the KetelD/- larvae are yellow and allow their separation from the heterozygous nonyellow (y+CyO) siblings that have dark chitinous structures. For an explanation of the genetic symbols see LINDSLEY and ZIMM 1992 Down and the FlyBase website (http://flybase.bio.indiana.edu). All experiments were carried out at 25°.

Molecular cloning of the Ketel gene:
DNA manipulations, plasmid constructions, restriction mapping, Southern and Northern hybridizations, and Western blotting were done according to standard procedures. For identification of the breakpoints in the four ketelrX-associated rearrangements, we isolated DNA from ketelrX/+ adult flies. The DNA was digested with EcoRV and hybridized on Southern blots. The 32P-labeled probes for Southern hybridizations were generated by random primer labeling of restriction fragments that had been isolated from a {lambda}EMBL4 library and from CoSpeR clones identified in a chromosomal walk. The chromosomal walk initiated from a clone that hybridized to the 38E1.2-3 cytological region and was kindly provided by Dr. P. Maróy. Cloning the Ketel gene was also confirmed by in situ hybridizations on salivary gland chromosomes of the ketelrX/+ larvae. A detailed restriction map of the Ketel region was constructed and the subfragments were cloned into pBluescriptII KS+ vector. We used the subclones to precisely map the ketelrX-associated breakpoints for sequencing and screening cDNA libraries.

The Ketel cDNA clones were isolated from a {lambda}gt10 cDNA library constructed from mRNAs of 0- to 4-hr-old Drosophila embryos. (The cDNA library was a kind gift from Dr. J. Tamkun.) The screening of ~1.5 x 105 independent plaques resulted in 17 cDNA clones that hybridized with at least one of the subclones covering part of the Ketel gene. The overlapping cDNA clones were identified and subcloned into the pBluescriptII KS+ vector. Sequencing of genomic and cDNA clones were done by the dideoxy method in an IBI automated sequenator on both strands. The 5' end of the mRNA was determined by primer extension. The primer extension was done by using total mRNA isolated from adult females and the synthetic olygonucleotide 5'GCTCTTTTGCTCCTATATGATTTCTAC3', which hybridized close to the 5' end of the isolated cDNA. The 3' end was present in some of the isolated cDNAs as revealed by the poly(A) tail. The intron-exon composition of the region that encodes the 3.6-kb Ketel mRNA was determined by sequencing and analyzing a 7870-bp genomic fragment. For developmental Northern analysis poly(A) mRNAs were purified, blotted, and probed with the cDNA that corresponds to the 3.6-kb Ketel mRNA. Digoxigenin (DIG)-labeled Ketel cDNA was used for the detection of Ketel mRNA during oogenesis and embryogenesis, according to standard procedures.

Homology search and putative function of the Ketel gene:
Having the above-mentioned sequences and to establish possible function of the Ketel protein, we screened databases with the BLAST service of the National Center for Biotechnology Information for identifying sequences displaying homology with the Ketel cDNA. Protein alignments were done using the MaxHom EMBL multiple sequence alignment program.

The Ketel+ transgenes:
We constructed three different types of Ketel+ (K+) transgenes. The first type included the entire 22-kb fragment shown in Fig 1A. The second type covered a 13.8-kb Xba genomic fragment (Fig 1B). In the third type a 4.0-kb Xba-BamHI genomic fragment—including the Ketel promoter and the 5' segment of the Ketel coding region—was combined with a 2.3-kb cDNA fragment that corresponded to the rest of the transcribed part of the Ketel gene (see Fig 1B). The above sequences were cloned into the CaSpeR vector with the mini-white marker gene and germline transformants were generated by standard procedures. The K+ transgene-carrying flies have light to orange-yellowish eyes on the white genetic background. The K+ transgenes were used for the construction of K+; ketelr/- and K+; KetelD/- as well as K+; KetelD/+ and K+/K+; KetelD/+ zygotes. Their viability and the fertility of the females were tested.



View larger version (14K):
In this window
In a new window
Download PPT slide
 
Figure 1. Restriction map of a 22-kb genomic segment from the 38E1.2-3 cytological region comprising the Ketel gene. (A) One breakpoint of each of the four ketelrX revertant alleles with visible chromosome rearrangements fall within the 5.5-kb BglII-BamHI genomic fragment delineated by the top thick line. The box on the line below represents the Ketel mRNA encoding region. Detailed genomic map of the Ketel mRNA encoding region is shown below. Exons, introns, and the untranslated 5' and 3' regions are indicated by solid, open, and dotted boxes, respectively. (B). Structure of two of the three K+ transgenes. Type I comprises the entire 22-kb genomic fragment shown in A. Type II is the 13.8-kb Xba genomic fragment. Type III contains the Xba-BamHI 4.0-kb genomic fragment combined in frame with a 2.3-kb BamHI–EcoRI segment of the cDNA. The indicated restriction sites are as follows: B, BglII; BH, BamHI; E, EcoRI; RV, EcoRV; X, Xba.

Production of the Ketel protein in bacteria and the generation of anti-Ketel polyclonal antibodies:
A pGEX-Ketel plasmid was constructed first by the insertion of the BamHI-EcoRI fragment of the Ketel cDNA (Fig 1A) into the corresponding sites of a pGEX4T-1 vector and glutathione-S-transferase (GST)-Ketel fusion protein was produced in Escherichia coli. The fusion protein consisted of the GST moiety fused in frame with the 147–884 amino-acid encoding segment of the Ketel protein. The GST-Ketel fusion protein was purified by affinity chromatography on a glutathion-agarose column and used for immunization of rabbits for the production of anti-Ketel polyclonal antibodies following standard protocols. After several boosts, the crude sera were analyzed for the presence of anti-Ketel antibody by Western blots. Two rabbits produced good titers of anti-Ketel sera by virtue of their ability to recognize the Ketel protein in E. coli extracts from strains with pGEX-Ketel but not in the control bacterial extracts.

For production of a nearly full-length Ketel protein, we made use of the pET-His3A expression system (CHEN and HAI 1994 Down). The His-tagged Ketel protein, with amino acids 4–884, was purified by a Ni-chelating column and used for preparation of a Ketel protein affinity column.

The anti-Ketel antibody was purified in two steps: first on a protein-A and afterward on a Ketel protein affinity column. The affinity-purified anti-Ketel antibody was used both in Western blots and in confocal microscopy for the detection of Ketel protein. For Western blots protein extracts were prepared from embryos, larvae, and adults as well as from different organs of late third instar larvae. For laser scanning microscopy ovaries were dissected, fixed, and treated with antibodies. The Ketel protein was detected by the affinity-purified polyclonal anti-Ketel rabbit antibody that was made visible by a goat anti-rabbit rhodamin-labeled secondary antibody (Jackson Laboratories, West Grove, PA). The NE was made visible with a primary monoclonal anti-lamin mouse antibody (HAREL et al. 1989 Down; PADDY et al. 1996 Down) and a fluorescein-labeled anti-mouse secondary antibody (Jackson Laboratories). Optical sections were generated in a Zeiss (Thornwood, NY) LSM 410 confocal microscope.

The in vitro nuclear protein import assay:
Drosophila importin-ß cDNA was cloned into the SphI-XmaI sites of pQE30 (QIAGEN, Valencia, CA), expressed with an NH2-terminal His tag and purified, on nickel-NTA agarose, followed by chromatography on a Superdex 200 gel filtration column.

The nuclear protein import assay was conducted as follows. Permeabilized HeLa cells were prepared by a modification of a published protocol (ADAM et al. 1990 Down). Briefly, HeLa cells were grown on coverslips to 50–80% confluence, washed in ice-cold permeabilization buffer (20 mM HEPES/KOH pH 7.5, 110 mM potassium acetate, 5 mM magnesium acetate, 250 mM sucrose, 0.5 mM EGTA) and permeabilized for 15 min in the same buffer containing 60 µg/ml digitonin. The coverslips were washed three times in permeabilization buffer without digitonin. Coverslips were incubated as indicated with each 20 µl of import reaction. The import buffer contained 2 mg/ml nucleoplasmin core (to block nonspecific binding), 20 mM HEPES/KOH pH 7.5, 140 mM potassium acetate, 5 mM magnesium acetate, 250 mM sucrose, 0.5 mM EGTA. Where indicated, reactions were supplemented with an energy-regenerating system (0.5 mM ATP, 0.5 mM GTP, 10 mM creatine phosphate, 50 µg/ml creatine kinase) and Ran mix (3 µM Ran-GDP, 150 nM Rna1p, 300 nM NTF2, 150 nM RanBP1). Nuclear import of a fluorescent substrate was monitored in optical sections. The substrate was the pentamer of a fusion protein in which the nucleoplasmin core domain was combined with the importin-ß-binding domain from importin-{alpha} (IBB core pentamer). Import reaction samples contained 0.24 µM fluorescein-labeled IBB core pentamer. In the indicated reactions 1.2 µM Drosophila importin-ß, Ran, and an energy-regenerating system were added. Reactions were stopped after 5 min by fixation in 3% paraformaldehyde (w/v) in PBS, washed in PBS and water, and mounted with 2 µl of vectorshield mounting medium (Vector, Burlingame, CA).

The digitonin-permeabilized HeLa cell system was also used to follow nuclear import of the cNLS-phycoerythrin (cNLS-PE; CSERPAN and UDVARDY 1995 Down) substrate in presence of cytosol samples prepared from ovaries of wild-type and KetelD/+ females.


*  RESULTS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Molecular cloning of the Ketel gene of Drosophila:
Four of the X-ray-induced ketelrX revertant alleles have a common breakpoint in the 38E1.2-3 cytological region (ERDELYI et al. 1997 Down). The common breakpoint both delineated the Ketel locus and allowed molecular cloning of the Ketel gene. To identify the breakpoints in the four ketelrX alleles, we initiated a genomic walk from a nearby genomic fragment. The genomic walk covered ~60 kb and resulted in a 5.5-kb genomic BglII-BamHI fragment that included all four of the ketelrX-associated breakpoints (Fig 1A). The corresponding region of the Drosophila genome is included in a cosmid clone that we isolated from a CoSpeR Not-Bam-Not cosmid library (Fig 1A). On Northern blots, the BglII-BamHI fragment strongly hybridized to a 3.6-kb mRNA specimen that most likely represents the Ketel gene. The 3.6-kb mRNA is abundant in females and young embryos and appears to be present, although in much reduced concentrations, throughout development (data not shown).

To isolate cDNA clones that correspond to the 3.6-kb Ketel mRNA, overlapping genomic fragments covering the Xba-EcoRV 10.7-kb region (Fig 1A) were used for the screening of a cDNA library prepared from 0- to 4-hr-old embryos. The longest isolated cDNA was 2858 bp long. However, it did not contain poly(A) tail. Overlaps of the 2858-bp cDNA clone with poly(A)-containing cDNAs allowed the reconstruction of a 3378-bp-long cDNA. In vitro extension was done on the basis of the mRNAs isolated from adult females and of a primer complementary to the 5' end of the 2858-bp-long cDNA. The primer extension indicated a major transcription initiation site 478 bp upstream from the 5' end of the 2858-bp cDNA. We concluded, after finding out about the missing 3' and 5' ends of the 2858-bp cDNA, that the encoded Ketel mRNA is 3656 nucleotides long and corresponds to the 3.6-kb mRNA detected in Northern analysis.

To determine molecular organization of the Ketel locus, we sequenced a 7870-bp long genomic DNA region that corresponds to the encoded cDNA and the surrounding sequences (Fig 1A). The nucleotide sequence is available in the EMBL nucleotide sequence database under the accession no. AJ002729. Comparison of the cDNA and the genomic sequences revealed that the Ketel gene contains 5 introns. The Ketel mRNA is composed from a 444-bp leader sequence, a 2652-bp open reading frame (ORF), and a 560-nucleotide-long trailer sequence (Fig 1A). To decide whether Ketel is a single copy gene or is present in multiple copies, we digested genomic DNA with three different restriction enzymes (EcoRI, Xba, and BglII) and carried out Southern analyses with 32P-labeled cDNA fragments. In every case, the labeled cDNA fragments hybridized with a single band, making it very likely that Ketel is a single copy gene (data not shown). The finding that under high stringency conditions the Ketel cDNA hybridized exclusively to the 38E1.2-3 region on salivary gland chromosomes supports the above conclusion.

The Ketel+ transgenes:
To prove that the cloned gene is indeed Ketel, we generated three different types of altogether 21 Ketel+ (K+) transgenes (Fig 1B and Table 1) and analyzed their effects on both ketelr and KetelD mutations. Nine of the 12 tested K+ transgenes brought about full rescue of lethality associated with the loss-of-function ketelrX13/- genotype: the K+; ketelrX13/- flies developed with the expected frequencies and were fully fertile, showing that the cloned gene is Ketel (Table 1; ketelrX13 is a null allele).


 
View this table:
In this window
In a new window

 
Table 1. The K+ transgenes and their rescue effects on ketelr/--associated zygotic lethality

Type I and each of the three tested type III K+ transgenes brought about slight rescue of the KetelD2-associated dominant female sterility. In ~1% of the eggs deposited by the K+; KetelD2/+ females embryogenesis progressed to the stage of embryonic cuticle formation and even a few offspring developed from the K+; KetelD2/+ females. However, the rate of offspring production was as low as 2–4 x 10-3 offspring/(female x day), as compared to the ~50 offspring/(female x day) control value. (It should be noted that cuticle and offspring did not develop from tens of thousands of eggs deposited by KetelD2/+ females.) One copy of the K+ transgenes had no effects on the other three KetelD mutations. However, two copies of the K+ transgenes brought about slight reduction of female sterility when sperm with two normal Ketel gene copies fertilized the eggs (TIRIAN et al. 2000 Down). The slight rescue of the K+ transgenes on KetelD-associated dominant female sterility clearly shows that (i) the cloned gene is Ketel and (ii) the normal and the KetelD-encoded gene products participate in the same process and hence the KetelD alleles are strong dominant-negative mutations.

The Ketel gene encodes the Drosophila homologue of importin-ß:
The Ketel cDNA contains a 2652-nucleotide-long ORF encoding for a protein of 884 amino acids with a molecular mass of 97 kD. Comparison of the Ketel protein amino acid sequence with known sequences revealed a 60.3% amino acid identity and a 78.2% similarity with human importin-ß, a known component of nuclear protein import (Fig 2; ADAM and ADAM 1994 Down; CHI et al. 1995 Down; GORLICH et al. 1995A Down, GORLICH et al. 1995B Down; IMAMOTO et al. 1995 Down; IOVINE et al. 1995 Down; RADU et al. 1995 Down). The high level of homology suggests that Ketel encodes the Drosophila homologue of importin-ß, the founding member of the importin-ß superfamily (WOZNIAK et al. 1998 Down, GORLICH and KUTAY 1999 Down).



View larger version (97K):
In this window
In a new window
Download PPT slide
 
Figure 2. Alignment of the Ketel protein, human, rat, Caenorhabditis elegans, and yeast importin-ß amino acid sequences. Boldface letters in boxes label amino acid identities among all sequences. Boxes alone indicate identity but one. The sources are as follows: Drosophila: this article, accession no. AJ002729; human: GORLICH et al. 1995A Down, GORLICH et al. 1995B Down, accession no. L38951, nucleotide identity no. (NID) G893287; rat: RADU et al. 1995 Down, accession no. L38644; C. elegans: WILSON et al. 1994 Down, accession no. AF003136, NID G2088700; Saccharomyces cerevisiae: KAP95 protein, ENENKEL et al. 1995 Down, accession no. S51350, Cosmid 8300, NID G2088700, EMBL U19028.

The Ketel protein supports nuclear protein import:
To decide whether the Ketel protein does indeed function as importin-ß we monitored (i) the docking on the cytoplasmic surface of the NE and (ii) import into nuclei of digitonin-permeabilized HeLa cells of a fluorescent-labeled nuclear substrate in the presence of the Ketel protein and other components of the nuclear protein import apparatus (see MATERIALS AND METHODS). As shown on Fig 3B, the substrate docked on the NE in presence of the Ketel protein, and when Ran and an energy source were added the substrate was imported into the nuclei (Fig 3B and Fig D). The permeabilized HeLa cell experiments clearly showed that the Ketel protein molecules function as importin-ß: they can assist docking and import of nuclear proteins into the nuclei.



View larger version (83K):
In this window
In a new window
Download PPT slide
 
Figure 3. Drosophila Ketel protein functions as importin-ß since it promotes the docking on the NE and nuclear import of a fluorescent IBB-nucleoplasmin fusion protein as detected in optical sections. Without addition of Ran and energy supply (A) or with Ran and energy supply (C) only background signals appear due to residual components in the digitonin-permeabilized HeLa cells. When importin-ß is added and no energy is supplied the substrate docks on the cytoplasmic surface of the NE (B). When, however, Ran, energy supply, and importin-ß are added the substrate is imported into the nuclei (D). Bar, 10 µm.

To understand effects of the KetelD mutations on nuclear protein import, we prepared cytosol from ovaries of both KetelD/+ and wild-type females. All the four KetelD mutations were included in this study. The cytosol preparations were used in the permeabilized HeLa cell assay and import of the cNLS-PE substrate was monitored (see MATERIALS AND METHODS). In presence of the wild-type ovary cytosol the cNLS-PE substrate entered the nuclei of HeLa cells within a few minutes (Fig 4B). Surprisingly, the KetelD/+-derived cytosol preparations just as efficiently supported nuclear import of the cNLS-PE substrate as the wild-type ovary cytosol, showing that the KetelD-encoded mutant molecules do not interfere with import of the cNLS-PE substrate. Note that when injected into wild-type cleavage embryos, traces of the KetelD egg cytoplasm prevent the formation of cleavage nuclei at the end of mitosis (TIRIAN et al. 2000 Down). However, nuclei of the digitonin-permeabilized HeLa cells remained intact for at least 4 hr in presence of the KetelD/+-derived ovary cytosol.



View larger version (107K):
In this window
In a new window
Download PPT slide
 
Figure 4. Nuclear import of the cNLS-PE substrate into nuclei of digitonin-permeabilized HeLa cells in the presence of cytosol prepared from Drosophila ovaries. (A) At 0° and in the absence of ATP the cNLS-PE substrate molecules are not imported into the nuclei and do not even accumulate around the NE. (B) At 30°, the cNLS-PE substrate molecules are imported into the nuclei even in the absence of ATP. (C) Nuclear import of the cNLS-PE substrate is very effective on 30° when extraneous ATP is added. The nuclear import patterns shown on B and C are identical for wild-type and KetelD/+-derived ovary cytosol preparations. (D) Wheat germ agglutinin (200 µg/ml) effectively blocks nuclear protein import on 30° even in the presence of ATP.

Expression pattern of the Ketel gene:
To study the expression pattern of the Ketel gene, we detected both Ketel mRNA and Ketel protein during oogenesis and embryogenesis. Some Ketel mRNA, as detected with the DIG-labeled Ketel cDNA, is present in nurse cells of the stage 9 egg primordia. The concentration of Ketel mRNA becomes rather high by stage 10 (Fig 5A) when dumping of the Ketel mRNA into the oocyte cytoplasm begins. Beyond stage 11 the Ketel mRNA is homogeneously distributed in the oocyte cytoplasm (Fig 5B). The Ketel gene appears to be ubiquitously expressed in every blastoderm cell (Fig 5C) and, as far as it can be deduced from the staining patterns, also during later stages of embryogenesis (Fig 5, D–F). The Ketel gene seems to be intensively expressed in the central nervous system and in the larval gonads (Fig 5E and Fig F). The larval gonads include both ovaries and testes since the gonads possess intensive staining in each of the embryos.



View larger version (51K):
In this window
In a new window
Download PPT slide
 
Figure 5. In situ hybridizations for the detection of Ketel mRNA during oogenesis (A and B) and different stages of embryogenesis: cellular blastoderm, stage 5 (C), stage 8 (D), stage 14 (E), and stage 17 (F) embryos. Lateral (C, D, and F; anterior left and dorsal up) and dorsal (E) views. nc, nurse cells; oc, oocyte; pc, pole cells; am, anterior midgut primordium; pm, posterior midgut primordium; m, mesoderm; lg, larval gonad; spg, supra oesophageal ganglion; vnc, ventral nerve cord (embryos were staged as described in CAMPOS-ORTEGA and HARTENSTEIN 1997 Down). Bar, 50 µm.

We also followed Ketel gene expression through the detected Ketel protein with the affinity-purified polyclonal anti-Ketel antibody. The anti-Ketel antibody detected a single 97-kD protein band on Western blots with extracts prepared from different developmental stages (Fig 6). The Ketel protein is abundant in the ovaries and in the newly deposited eggs throughout embryogenesis and is present throughout all stages of development. However, when compared, e.g., to ovaries, the relative Ketel protein concentration was rather low in larvae and adult females from which the ovaries were removed. To clarify the low Ketel protein content we dissected different organs from late third instar larvae and subjected them to Western blot analysis. As shown in Fig 6, while, e.g., the imaginal discs contained significant amounts of the Ketel protein, there were no detectable amounts of Ketel protein present in a number of larval tissues including the salivary glands, gut, Malpighian tubules, or the larval epidermis with the overlying larval musculature.



View larger version (27K):
In this window
In a new window
Download PPT slide
 
Figure 6. Western blot analysis to detect Ketel protein with a polyclonal anti-Ketel antibody. Equal amounts of protein samples (as measured by photometry and confirmed with Ponceau-stained control gels) were loaded in the different slots. With respect to third instar larval organs, the central nervous system (cns) did not include the ring gland and the larval gonads were removed from the fat body (fb) sample. sg, salivary glands; id, imaginal discs; g + Mt, gut and Malpighian tubules; le + lm, larval epidermis with the overlaying larval musculature.

Formation and localization of the Ketel protein was also followed in the course of oogenesis and embryogenesis by immunocytology and confocal microscopy. The Ketel protein is first detectable in nurse cells during stage 8 of oogenesis (not shown). By stage 10 the nurse cells contain large quantities of the Ketel protein. The protein is cytoplasmic with pronounced accumulation in the NEs (Fig 7A and Fig C). Nurse cells dump their Ketel protein contents into the oocyte cytoplasm from stage 11 of oogenesis. The follicle cells also contain Ketel protein (Fig 7A). Cytoplasm of a newly deposited egg contains stockpiles of the Ketel protein. During cleavage divisions the Ketel protein is present throughout the cleavage cycles. It is cytoplasmic and shows accumulation in the NE (Fig 7D and Fig F).



View larger version (92K):
In this window
In a new window
Download PPT slide
 
Figure 7. Distribution of the Ketel protein, as detected in optical sections, in a stage 10 egg primordium and in an interphase cleavage embryo. The Ketel protein is shown in red (A and D), the nuclear lamina appears in green (B and E). Merged signals are shown on C and F where yellow coloration results from superimposition of green and red signals. nc, nurse cells; oc, oocyte; fc, follicle cells. Bar, 50 µm for A–C and 5 µm for D–F. As shown by the lamin signal in C and D the oocyte nucleus contains uniformly distributed lamin molecules inside (ASHERY-PADAN et al. 1997 Down).

Immunoreactive features of the KetelD-encoded protein molecules are not different from wild type: amount and size of the immunoreactive components in wild-type and KetelD/+ ovary and egg extracts appear identical on Western blots (data not shown). These observations suggest that the EMS-induced KetelD mutations (i) did not alter the expression pattern of the gene and (ii) did not change the size of the encoded protein molecules.


*  DISCUSSION
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

The Ketel gene encodes the Drosophila homologue of importin-ß:
The Ketel gene was identified by four EMS-induced Fs(2)Ketel (= KetelD) dominant female sterile mutations and their ketelr revertant alleles (SZABAD et al. 1989 Down; ERDELYI et al. 1997 Down). The KetelD alleles are gain-of-function type and bring about dominant female sterility by inhibiting the commencement of embryogenesis. The KetelD-encoded gene products prevent cleavage nuclei assembly at the end of mitosis by, as it appears, disrupted NE formation/function and suggest a NE-related function of the normal Ketel gene product (TIRIAN et al. 2000 Down). Most of the loss-of-function ketelr alleles are zygotic lethal mutations that cause death during second larval instar showing zygotic requirement of the Ketel gene (ERDELYI et al. 1997 Down). To understand Ketel gene function, we cloned the Ketel gene. A common breakpoint in four of the X-ray-induced ketelrX alleles localized the gene to the 38E1.2-3 cytological position and allowed, as an outcome of a genomic walk, cloning of the Ketel gene. Genomic Southern and developmental Northern and Western analyses revealed that the single-copy Ketel gene encodes a single type of 3.6-kb mRNA and synthesis of the corresponding 97-kD Ketel protein.

To show that the cloned gene is indeed Ketel, we generated different types of K+ transgenes. Because the transgenes bring about rescue of ketelr-associated lethality, it is safe conclude that the cloned gene is Ketel. Furthermore, the K+ transgenes slightly reduce KetelD-associated dominant female sterility, showing that the normal and the KetelD-encoded mutant gene products participate in the same pathway. The slight rescue of KetelD-associated dominant female sterility implies a dominant-negative nature of the KetelD mutations; i.e., the KetelD-encoded molecules impede function of the normal Ketel gene products (TIRIAN et al. 2000 Down).

Comparison of nucleotide and amino acid sequences of the Ketel gene and the Ketel protein revealed strong homology with human importin-ß, a component of nuclear protein import: in the two protein sequences 60% of the amino acids are identical and 78% are of similar nature.

Importin-ß (also called karyopherin-ß) is a major component of nuclear protein import and has been known from biochemical studies in which components of nuclear protein import were identified (ADAM and ADAM 1994 Down; CHI et al. 1995 Down; GORLICH et al. 1995A Down, GORLICH et al. 1995B Down; IMAMOTO et al. 1995 Down; RADU et al. 1995 Down). The Ketel gene does indeed encode the Drosophila importin-ß since the Ketel protein possesses characteristic features of importin-ß. In absence of an energy source the Ketel protein produced in bacteria supports docking of a IBB-nucleoplasmin core fusion protein on the NE of digitonin-permeabilized HeLa cells (Fig 3B). When an energy source is provided, the nuclear protein is imported into the nucleus.

Transport of macromolecules between the cytoplasm and the nucleus proceeds through the NPCs and is mediated by shuttling receptors of the importin-ß superfamily (for reviews see MATTAJ and ENGLMEIER 1998 Down; PEMBERTON et al. 1998 Down; WEIS 1998 Down; WOZNIAK et al. 1998 Down; GORLICH and KUTAY 1999 Down). The importins bind their cargo, directly or through adapter molecules like importin-{alpha}, in the cytoplasm and release them in the nucleus. A RanGTP gradient provides the driving force for transport: importins bind their cargo in the cytoplasm where RanGTP levels are low and release it upon encountering high RanGTP concentration in the nucleus. The conversion of RanGTP to RanGDP in the cytoplasm is catalyzed by RanGAP1 and is further stimulated by RanBPs. RanGTP is generated from RanGDP in the nucleus by RCC1 (regulator of chromatin condensation), a chromatin-associated nucleotide exchange factor. Importin-ß is engaged in nuclear import of proteins with cNLS through importin-{alpha}, an adapter molecule. Importin-ß can also operate as an autonomous receptor independently of importin-{alpha}. A number of types of proteins have been identified that can directly bind to importin-ß and are imported into the nucleus, e.g., some ribosomal proteins and the HIV Rev protein (HENDERSON and PERCIPALLE 1997 Down; JAKEL and GORLICH 1998 Down; TRUANT and CULLEN 1999 Down). Importin-ß can also form a complex with importin-7 and mediate histone H1 import (GORLICH et al. 1997 Down; JAKEL et al. 1999 Down). In addition, apart from importin-{alpha}, importin-ß also uses other adapter molecules: snurportin1 for the import of m3G-capped UsnRNPs (HUBER et al. 1998 Down) and XRIPa for the import of the Xenopus replication protein A (JULLIEN et al. 1999 Down).

Several members of the importin-ß superfamily have been identified mainly in yeast and vertebrates (WOZNIAK et al. 1998 Down; GORLICH and KUTAY 1999 Down). A search in the Drosophila genome (at http://flybase.bio.indiana.edu) for homologues of vertebrate importin-ß superfamily members identified 10 genes (Table 2). It appears that most members of the human importin-ß family are also present in Drosophila (Table 2). However, there is no apparent homologue of exportin-t that is engaged in export of tRNAs from the nuclei to the cytoplasm. The closely related human importin-5 and RanBP6 (GORLICH and KUTAY 1999 Down) have a single corresponding Drosophila homologue (Karybeta3). Similarly, human importin-7 and RanBP8 have a single Drosophila relative called dim-7. As in humans, there are two transportin genes in Drosophila (Table 2). Of the Drosophila importin-ß family members, functions have been assigned thus far to transportin (SIOMI et al. 1998 Down) and to a homologue of human CRM1 embargoed (FASKEN et al. 2000 Down) and, as described in this article, to Ketel.


 
View this table:
In this window
In a new window

 
Table 2. Members of the Drosophila importin-ß family and their closest human homologues on the basis of amino acid sequence identities

The Ketel protein is cytoplasmic and is not present in every cell type:
As other members of the importin-ß family, the Ketel protein is largely cytoplasmic (GORLICH et al. 1995A Down) with pronounced accumulation in the NE (Fig 7). As predicted by features of the KetelD and ketelr mutant phenotypes (TIRIAN et al. 2000 Down), the Ketel protein is produced and is dumped into the oocyte cytoplasm during oogenesis and cleavage embryos make use of the Ketel maternal dowry. Surprisingly, however, the Ketel gene does not appear to be expressed in the fully differentiated larval cells. Apparently the Ketel protein appears to be present largely in mitotically active cells. Genetic requirement of the Ketel gene is discussed in the accompanying article by TIRIAN et al. 2000 Down.

The possible mode of action of the KetelD-encoded proteins:
When injected into wild-type cleavage embryos, traces of the KetelD egg cytoplasm exert deleterious effects through the prevention of cleavage nuclei formation (TIRIAN et al. 2000 Down). Toxic effects of the KetelD-encoded molecules are perhaps an outcome of arrested nuclear protein import. To elaborate this possibility, we prepared cytosol from ovaries of the KetelD/+ females and studied their effects on nuclear protein import. Unexpectedly, the KetelD cytosol preparations did not prevent nuclear import of the cNLS-PE substrate (Fig 4). In fact, the cNLS-PE molecules were equally efficiently imported into the nuclei in the presence of the KetelD or wild-type ovary cytosol. Consistent with this observation, the KetelD egg cytoplasm did not prevent import of the cNLS-PE molecules into interphase nuclei of wild-type cleavage embryos (TIRIAN et al. 2000 Down). Knowing that the KetelD alleles are strong dominant-negative mutations, the above results may be surprising. A number of possibilities may come to light to explain the former observation. It is very unlikely that all four of the EMS-induced KetelD alleles altered expression of the Ketel gene such that the cytosol preparations did not contain KetelD-encoded molecules. Although the KetelD-encoded molecules block function of the normal ones, perhaps the cNSL-PE substrate is imported into the nuclei via another nuclear protein import route powered by unidentified components of the ovary cytosol. The existence of parallel import pathways is well established. For example, the human ribosomal protein L25 is imported through at least four pathways (JAKEL and GORLICH 1998 Down). The KetelD-encoded molecules well may support nuclear protein import, a feature not known at present. It is also possible that although the KetelD-encoded molecules do not participate in nuclear protein import, they do not interfere with import function of the normal Ketel molecules, and their toxic effects become apparent when the importin-ß molecules perform a function other than nuclear protein import.

Indeed, the deleterious effects of the KetelD mutations become apparent at the end of cleavage mitosis when the NE reassemble and daughter nuclei form. Remarkably, the KetelD cytosol did not disrupt HeLa cell nuclei and, along with this observation, Drosophila wild-type interphase cleavage nuclei remained intact in presence of the KetelD egg cytoplasm. Because the digitonin-permeabilized HeLa cells do not divide, they are inadequate to detect defects associated with NE assembly. It appears as if the KetelD mutations identify a novel function of importin-ß required during reassembly of the NE at the end of mitosis. Perhaps importin-ß is not only engaged in nuclear protein import but is also a structural component of the NPCs, as CORBETT and SILVER 1997 Down proposed, and the KetelD mutations identify the nucleoporin function of the gene.

NE assembly is a stepwise process (MARSHALL and WILSON 1997 Down; GANT et al. 1998 Down; SUTOVSKY et al. 1998 Down; ZHANG and CLARKE 2000 Down). First, every chromosome associates with Ran-GDP (ZHANG et al. 1999 Down). The chromatin-associated Ran-GDP promotes binding to chromatin of membrane vesicles and recruits RCC1, the guanine nucleotide exchange factor for Ran, and promotes the association of nucleoporins (GOLDBERG et al. 1997 Down; GANT et al. 1998 Down). RCC1 generates Ran-GTP from Ran-GDP, and Ran-GTP causes fusion of the vesicles and formation of double nuclear membrane (GANT et al. 1998 Down; ZHANG and CLARKE 2000 Down). Formation of the NE with NPCs establishes a condition for resumed nuclear protein import and the formation of functional nuclei. The process takes place in vitro where NE forms from egg cytoplasm extract components over the demembranated sperm chromatin (BURKE and GERACE 1986 Down) in a process that is similar to NE assembly around the sperm chromatin during male pronucleus formation following fertilization (SUTOVSKY et al. 1998 Down). As described recently by ZHANG and CLARKE 2000 Down, functional NEs form over Sepharose beads loaded with Ran-GDP in Xenopus egg extract in the absence of DNA or chromatin. However, the role of importin-ß in NE/NPC assembly waits to be elucidated.


*  ACKNOWLEDGMENTS

We thank Dr. A. Shearn for the y+CyO chromosome, Drs. Y. Gruenbaum and H. Saumweber for the anti-lamin antibody samples, J. Tamkun for the cosmid library, and P. Maróy for the clone to initiate the genomic walk. We thank the excellent technical help of Révész Kati and Kissné Ani. We express our gratitude to Dr. David Glover, who organized support through the Préadhésion pour les Dix Pays d'Europe Centrale et Orientale no. CEC ERB CIPD CT 94 0049 EC Cell Cycle Network program. Support for the "Ketel project" came from the following additional sources: OTKA 922, OTKA T5537, and OTKA T32540 from the Hungarian National Science Foundation, FKFP grant 1348/1997 from the Hungarian Education and Science Foundation and the Poland and Hungary: Action for the Restructuring of the Economy-ACCORD Program no. H-9112-0528.

Manuscript received January 27, 2000; Accepted for publication September 14, 2000.


*  LITERATURE CITED
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

ADAM, E. J. H. and S. A. ADAM, 1994  Identification of cytosolic factors required for nuclear location sequence-mediated binding to the nuclear envelope. J. Cell Biol. 125:547-555[Abstract/Free Full Text].

ADAM, S. A., R. STERNE-MARR, and L. GERACE, 1990  Nuclear import in permeabilized mammalian cells requires soluble cytoplasmic factors. J. Cell Biol. 111:807-816[Abstract/Free Full Text].

ASHERY-PADAN, R., N. ULITZUR, A. ARBEL, M. GOLDBERG, and A. M. WEISS et al., 1997  Localization and posttranslational modifications of otefin, a protein required for vesicle attachment to chromatin, during Drosophila melanogaster development. Mol. Cell. Biol. 17:4114-4123[Abstract/Free Full Text].

AZUMA, Y. and M. DASSO, 2000  The role of Ran in nuclear function. Curr. Opin. Cell Biol. 12:302-307[Medline].

BISCHOFF, F. R. and D. GÖRLICH, 1997  RanBP1 is crucial for the release of RanGTP from importin-beta-related nuclear transport factors. FEBS Lett. 419:249-254[Medline].

BURKE, B. and L. GERACE, 1986  A cell free system to study reassembly of the nuclear envelope at the end of mitosis. Cell 44:639-652[Medline].

CAMPOS-ORTEGA, J. A., and V. HARTENSTEIN, 1997 The Embryonic Development of Drosophila melanogaster. Springer, Berlin.

CHEN, B. P. C. and T. HAI, 1994  Expression vectors for affinity purification and radiolabeling of proteins using E. coli as host. Gene 139:73-75[Medline].

CHI, N. C., E. J. H. ADAM, and S. A. ADAM, 1995  Sequence and characterization of cytoplasmic nuclear protein import factor p97. J. Cell Biol. 130:265-274[Abstract/Free Full Text].

CINGOLANI, G., C. PETOSA, K. WEIS, and C. W. MÜLLER, 1999  Structure of importin-ß bound to the IBB domain of importin-{alpha}. Nature 399:221-229[Medline].

COLAS, J., Y. LAUNAY, and L. MAROTEAUX, 1999  Maternal and zygotic control of serotonin biosynthesis are both necessary for Drosophila germband extension. Mech. Dev. 87:67-76[Medline].

CORBETT, A. H. and P. A. SILVER, 1997  Nucleocytoplasmic transport of macromolecules. Microbiol. Mol. Biol. Rev. 61:193-211[Abstract/Free Full Text].

CSERPÁN, I. and A. UDVARDY, 1995  The mechanism of nuclear transport of natural or artificial transport substances in digitonin permeabilized cell. J. Cell Sci. 108:1849-1861[Abstract].

ENENKEL, C., G. BLOBEL, and M. REXACH, 1995  Identification of a yeast karyopherin heterodimer that targets import substrate to mammalian nuclear pore complexes. J. Biol. Chem. 270:16499-16502[Abstract/Free Full Text].

ERDÉLYI, M. and J. SZABAD, 1989  Isolation and characterization of dominant female sterile mutations of Drosophila melanogaster. I. Mutations on the third chromosome. Genetics 122:111-127[Abstract/Free Full Text].

ERDÉLYI, M., E. MÁTHÉ, and J. SZABAD, 1997  Genetic and developmental analysis of mutant Ketel alleles that identify the Drosophila importin-ß homologue. Acta Biol. Hung. 48:323-338[Medline].

FASKEN, M. B., R. SAUNDERS, M. ROSENBERG, and D. W. BRIGHTY, 2000  A leptomycin B-sensitive homologue of human CRM1 promotes nuclear export of nuclear export sequence-containing proteins in Drosophila cells. J. Biol. Chem. 275:1878-1886[Abstract/Free Full Text].

GANT, T. M., M. W. GOLDBERG, and T. D. ALLEN, 1998  Nuclear envelope and nuclear pore assembly: analysis of assembly intermediates by electron microscopy. Curr. Opin. Cell Biol. 10:409-415[Medline].

GOLDBERG, M. W., C. WIESE, T. D. ALLEN, and K. L. WILSON, 1997  Dimples, pores, star-rings, and thin rings on growing nuclear envelopes: evidence for structural intermediates in nuclear pore assembly. J. Cell Sci. 110:409-420[Abstract].

RLICH, D. and U. KUTAY, 1999  Transport between the cell nucleus and the cytoplasm. Annu. Rev. Cell Dev. Biol. 15:607-660[Medline].

RLICH, D. and I. MATTAJ, 1997  Nucleocytoplasmic transport. Science 271:1513-1518[Abstract].

RLICH, D., F. VOGEL, A. D. MILLS, E. HARTMANN, and R. A. LASKEY, 1995a  Distinct functions for the two importin-subunits in nuclear protein import. Nature 377:246-248[Medline].

RLICH, D., S. KOSTKA, R. KRAFT, C. DINGWALL, and R. A. LASKEY et al., 1995b  Two different subunits of importin-cooperate to recognize nuclear localization signals and bind them to the nuclear envelope. Curr. Biol. 5:383-392[Medline].

RLICH, D., M. DABROWSKI, F. R. BISCHOFF, U. KUTAY, and P. BORK et al., 1997  A novel class of RanGTP binding proteins. J. Cell Biol. 138:65-80[Abstract/Free Full Text].

HAREL, A., F. ZLOTKIN, S. NAINUDEL-EPSZTEYN, N. FEINSTEIN, and P. A. FISHER et al., 1989  Persistence of major nuclear envelope antigens in an envelope-like structure during mitosis in Drosophila melanogaster embryos. J. Cell Sci. 944:463-470.

HENDERSON, B. R. and P. PERCIPALLE, 1997  Interactions between HIV Rev and nuclear import and export factors: the Rev nuclear localisation signal mediates specific binding to human importin-beta. J. Mol. Biol. 274:693-707[Medline].

HUBER, J., U. CRONSHAGEN, M. KADOKURA, C. MARSCHALLY, and T. WADA et al., 1998  Snurportin 1, an m3G-cap-specific nuclear import receptor with a novel domain structure. EMBO J. 17:4114-4126[Medline].

IMAMOTO, N., T. SHIMAMOTO, S. KOSE, T. TAKAO, and T. TACHIBANA et al., 1995  The nuclear pore targeting complex binds to nuclear pores after association with a karyophile. FEBS Lett. 368:415-419[Medline].

IOVINE, M. K., J. L. WATKINS, and S. R. WENTE, 1995  The GLFG repetitive region of the nucleoporin Nup116p interacts with Kap95p, an essential yeast nuclear import factor. J. Cell Biol. 131:1699-1731[Abstract/Free Full Text].

KEL, S. and D. GÖRLICH, 1998  Importin-ß, transportin, RanBP5 and RanBp7 mediate nuclear import of ribosomal proteins in mammalian cells. EMBO J. 17:4491-4502[Medline].

KEL, S., W. ALBIG, U. KUTAY, F. R. BISCHOFF, and K. SCHWAMBORN et al., 1999  The importin-ß/importin-7 heterodimer is a functional nuclear import receptor for histone H1. EMBO J. 18:2411-2423[Medline].

JULLIEN, D., D. GÖRLICH, and D. GÖRLICHU. K. LAEMMLI AND Y. ADACHI, 1999  Nuclear import of RPA in Xenopus egg extracts requires a novel protein XRIPa but not importin-{alpha}. EMBO J. 18:4348-4358[Medline].

KOZLOVA, T., G. V. POKHOLKOVA, G. TZERTZINIS, J. D. SUTHERLAND, and I. F. ZHIMULEV et al., 1998  Drosophila hormone receptor 38 functions in metamorphosis: a role in adult cuticle formation. Genetics 149:1465-1475[Abstract/Free Full Text].

KUTAY, U., E. IZAURRALDE, F. R. BISCHOFF, I. W. MATTAJ, and D. GÖRLICH, 1997  Dominant-negative mutants of importin-ß block multiple pathways of import and export through the nuclear pore complex. EMBO J. 16:1153-1163[Medline].

LINDSLEY, D. L., and G. G. ZIMM, 1992 The Genome of Drosophila melanogaster. Academic Press, San Diego and London.

MARSHALL, I. B. and K. L. WILSON, 1997  Nuclear envelope assembly after mitosis. Trends Cell Biol. 7:69-74.

MATTAJ, I. W. and L. ENGLMEIER, 1998  Nucleocytoplasmic transport: the soluble phase. Annu. Rev. Biochem. 67:265-306[Medline].

MELCHIOR, F. and L. GERACE, 1998  Two-trafficking with Ran. Trends Cell Biol. 8:175-179[Medline].

NORVELL, A., R. L. KELLEY, K. WEHR, and T. SCHUPBACH, 1999  Specific isoforms of squid, a Drosophila hnRNP, perform distinct roles in Gurken localization during oogenesis. Genes Dev. 13:864-876[Abstract/Free Full Text].

PADDY, M. R., H. SAUMWEBER, D. A. AGARD, and J. W. SEDAT, 1996  Time-resolved, in vivo studies of mitotic spindle formation and nuclear lamina breakdown in Drosophila early embryos. J. Cell Sci. 109:591-607[Abstract/Free Full Text].

PEMBERTON, L. F., G. BLOBEL, and J. ROSENBLUM, 1998  Transport through the nuclear pore complex. Curr. Opin. Cell Biol. 10:392-399[Medline].

RADU, A., G. BLOBEL, and M. S. MOORE, 1995  Identification of a protein complex that is required for nuclear protein import and mediates docking of import substrate to distinct nucleoporin. Proc. Natl. Acad. Sci. USA 92:1769-1773[Abstract/Free Full Text].

SIOMI, M. C., M. FROMONT, J. C. RAIN, L. WAN, and F. WANG et al., 1998  Functional conservation of the transportin-nuclear import pathway in divergent organisms. Mol. Cell. Biol. 18:4141-4148[Abstract/Free Full Text].

SPRADLING, A. C., D. STERN, A. BEATON, E. J. RHEM, and T. LAVERTY et al., 1999  The Berkeley Drosophila genome project gene disruption project: single P-element insertions mutating 25% of vital Drosophila genes. Genetics 153:135-177[Abstract/Free Full Text].

SUTOVSKY, P., C. SIMERLY, L. HEWITSON, and G. SCHATTEN, 1998  Assembly of nuclear pore complexes and annulate lamellae promotes normal pronuclear development in fertilized mammalian oocytes. J. Cell Sci. 111:2841-2854[Abstract].

SZABAD, J., M. ERDÉLYI, G. HOFFMANN, J. SZIDONYA, and T. R. F. WRIGHT, 1989  Isolation and characterization of dominant female sterile mutations of Drosophila melanogaster. II. Mutations on the second chromosome. Genetics 122:823-835[Abstract/Free Full Text].

TIMMONS, L., E. HERSPERGER, E. WOODHOUSE, J. XU, and L. Z. LIU et al., 1993  The expression of the Drosophila awd gene during normal development and in neoplastic brain tumors caused by lgl mutations. Dev. Biol. 158:364-379[Medline].

TIRIÁN, L., J. PURO, M. ERDÉLYI, I. BOROS, and B. PAPP et al., 2000  The KetelD dominant-negative mutations identify maternal function of the Drosophila importin-ß gene required for cleavage nuclei formation. Genetics 156:1901-1912[Abstract/Free Full Text].

TRUANT, R. and B. R. CULLEN, 1999  The arginine-rich domains present in human immunodeficiency virus type 1 tat and rev function as direct importin-beta-dependent nuclear localization signals. Mol. Cell. Biol. 19:1210-1217[Abstract/Free Full Text].

WEIS, K., 1998  Importins and exportins. Trends Biol. Sci. 23:185-189.

WIESCHAUS, E., 1996  Embryonic transcription and the control of developmental pathways. Genetics 142:5-10[Medline].

WILSON, R., R. AINSCOUGH, K. ANDERSON, C. BAYNES, and M. BERKS et al., 1994  2.2 Mb of contiguous nucleotide sequence from chromosome III of C. elegans.. Nature 368:32-38[Medline].

WOZNIAK, R. W., M. P. ROUT, and J. D. AITCHISON, 1998  Karyopherins and kissing cousins. Trends Cell Biol. 8:184-188[Medline].

ZHANG, C., M. HUGHES, and P. R. CLARKE, 1999  Ran-GTP stabilizes microtubule asters and inhibits nuclear assembly in Xenopus egg extracts. J. Cell Sci. 112:2453-2461[Abstract].

ZHANG, C. and P. R. CLARKE, 2000  Chromatin-independent nuclear envelope assembly induced by Ran GTPase Xenopus egg extracts. Science 288:1429-1432[Abstract/Free Full Text].




This article has been cited by other articles:


Home page
Mol. Biol. CellHome page
K. R. Katsani, R. E. Karess, N. Dostatni, and V. Doye
In Vivo Dynamics of Drosophila Nuclear Envelope Components
Mol. Biol. Cell, September 1, 2008; 19(9): 3652 - 3666.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
N. Sabri, P. Roth, N. Xylourgidis, F. Sadeghifar, J. Adler, and C. Samakovlis
Distinct functions of the Drosophila Nup153 and Nup214 FG domains in nuclear protein transport
J. Cell Biol., August 9, 2007; 178(4): 557 - 565.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
N. Xylourgidis, P. Roth, N. Sabri, V. Tsarouhas, and C. Samakovlis
The nucleoporin Nup214 sequesters CRM1 at the nuclear rim and modulates NF{kappa}B activation in Drosophila
J. Cell Sci., November 1, 2006; 119(21): 4409 - 4419.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
S. Shibata, M. Sasaki, T. Miki, A. Shimamoto, Y. Furuichi, J. Katahira, and Y. Yoneda
Exportin-5 orthologues are functionally divergent among species
Nucleic Acids Res., October 18, 2006; 34(17): 4711 - 4721.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
P. Roth, N. Xylourgidis, N. Sabri, A. Uv, M. Fornerod, and C. Samakovlis
The Drosophila nucleoporin DNup88 localizes DNup214 and CRM1 on the nuclear envelope and attenuates NES-mediated nuclear export
J. Cell Biol., November 24, 2003; 163(4): 701 - 706.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
C. A. Hunter, M. J. Aukerman, H. Sun, M. Fokina, and R. S. Poethig
PAUSED Encodes the Arabidopsis Exportin-t Ortholog
Plant Physiology, August 1, 2003; 132(4): 2135 - 2143.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
K. M. Bollman, M. J. Aukerman, M.-Y. Park, C. Hunter, T. Z. Berardini, and R. S. Poethig
HASTY, the Arabidopsis ortholog of exportin 5/MSN5, regulates phase change and morphogenesis
Development, April 15, 2003; 130(8): 1493 - 1504.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
G. Timinszky, L. Tirian, F. T. Nagy, G. Toth, A. Perczel, Z. Kiss-Laszlo, I. Boros, P. R. Clarke, and J. Szabad
The importin-{beta} P446L dominant-negative mutant protein loses RanGTP binding ability and blocks the formation of intact nuclear envelope
J. Cell Sci., April 15, 2002; 115(8): 1675 - 1687.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
L. Tirián, J. Puro, M. Erdélyi, I. Boros, B. Papp, M. Lippai, and J. Szabad
The KetelD Dominant-Negative Mutations Identify Maternal Function of the Drosophila Importin-{beta} Gene Required for Cleavage Nuclei Formation
Genetics, December 1, 2000; 156(4): 1901 - 1912.
[Abstract] [Full Text]