- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Vinella, D.
- Articles by D'Ari, R.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Vinella, D.
- Articles by D'Ari, R.
Selected Amplification of the Cell Division Genes ftsQ-ftsA-ftsZ in Escherichia coli
Daniel Vinellaa, Michael Cashelb, and Richard D'Ariaa Institut Jacques Monod (CNRS, Université Paris 7, Université Paris 6), 75251 Paris Cedex 05, France
b Laboratory of Molecular Genetics, National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, Maryland 20892-2785
Corresponding author: Daniel Vinella, Institut Jacques Monod (CNRS, Université Paris 7, Université Paris 6), 2 place Jussieu, 75251 Paris Cedex 05, France., vinella{at}ijm.jussieu.fr (E-mail)
Communicating editor: P. L. FOSTER
| ABSTRACT |
|---|
Rapidly growing Escherichia coli is unable to divide in the presence of the antibiotic mecillinam, whose direct target is penicillin-binding protein 2 (PBP2), responsible for the elongation of the cylindrical portion of the cell wall. Division can be restored in the absence of PBP2 activity by increasing the concentration of the cell division proteins FtsQ, FtsA, and FtsZ. We tried to identify regulators of the ftsQ-ftsA-ftsZ operon among mecillinam-resistant mutants, which include strains overexpressing these genes. By insertional mutagenesis with mini-Tn10 elements, we selected for insertions that conferred mecillinam resistance. Among 15 such mutants, 7 suppressed the thermosensitivity of the ftsZ84(Ts) mutant, strongly suggesting that they had increased FtsZ activity. In all 7 cases, however, the mutants resulted from a duplication of the ftsQAZ region. These duplications seemed to result from multiple events, suggesting that no simple insertional inactivation can result in a mutant with sufficiently amplified ftsQAZ expression to confer mecillinam resistance. The structure of the duplications suggests a general method for constructing directed duplications of precise sequences.
GROWTH of rod-shaped bacteria such as Escherichia coli takes place in two different modes, lateral extension of the cylindrical portion of the rod and formation, at midcell, of a septum, or cross wall, which becomes the new pole of each daughter cell. The elongation phase of growth distinguishes bacilli from cocci, which grow and divide by pure septation. In E. coli, elongation specifically requires penicillin-binding protein 2 (PBP2; ![]()
![]()
![]()
![]()
![]()
![]()
The ftsQ, ftsA, and ftsZ genes are adjacent to each other on the chromosome (![]()
![]()
![]()
S, SdiA, and RcsB (for review, see ![]()
Inactivation of PBP2 can be brought about either genetically, by mutations in the structural gene pbpA, or by use of the highly specific ß-lactam mecillinam (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
relA
spoT strains are devoid of detectable ppGpp (![]()
![]()
We selected mutants that had become resistant to mecillinam through insertion of a mini-Tn10. Initially, we expected two classes of mutants, those with increased levels of FtsQ, FtsA, and FtsZ and those with increased ppGpp levels. Of 12 independent mutants isolated and characterized, 5 remained mecillinam-resistant in the complete absence of ppGpp (i.e., in a
relA
spoT genetic background). They were thus good candidates for affecting the level of expression of the ftsQ-ftsA-ftsZ operon. We present here a detailed analysis of these 5 mutants and 2 similar mutants previously selected. We show that their mecillinam resistance results from gene duplication via a novel mechanism that in principle could be used for specific, directed amplification of virtually any region of the chromosome.
| MATERIAL AND METHODS |
|---|
Bacterial strains and phages:
All strains used in this work are E. coli K12 derivatives; the genotypes of the principal strains are given in Table 1. The strains carrying various Tn10 transposons, kindly provided by D. Touati, are from the Singer collection (![]()
![]()
lacZ argA::Tn10 derivative of MG1655, selecting for kanamycin resistance (which is associated with the fusion), then
relA251::kan was introduced by cotransduction with Arg+, donor strain CF1651, selecting on minimal glucose plates and screening for transductants sensitive to serine, methionine, and glycine, a sensitivity associated with relA mutants (![]()
relA251::kan lacIpoZ
(Mlu) P1rrnB::lacZ spoT::kan] was constructed by transducing a pyrE zib-563::Tn10 derivative of strain CF6301 with a P1 stock grown on a relA1 spoT206::kan pyrE+ strain and selecting Pyr+ transductants on minimal glucose medium supplemented with Casamino acids; strain DV250 is a Pyr+ Tcs clone that cannot grow on minimal glucose plates lacking amino acids, indicating the absence of ppGpp (![]()
NK1324 (![]()
![]()
|
Media and growth conditions:
The rich and minimal media used in this work were, respectively, LB broth (containing 10 g/liter NaCl unless otherwise indicated) and M63 (![]()
DNA techniques and plasmids:
Plasmids were extracted and transformations were carried out as described by ![]()
![]()
Southern blots:
Chromosomal DNA extracted from the parental strain MG1655 and its mutant derivatives was completely digested by EcoRI and, after agarose (0.9%) electrophoresis of
5 µg, transferred onto hybond-N+ nylon membranes (Amersham Life Science, Rockville, MD) using the VacuGene- XL vacuum blotting system (Pharmacia Biotech, Piscataway, NJ). After DNA fixation by UV irradiation, the membranes were probed in tubes with four different probes using ECL gold buffer (Amersham Life Science) following the exact protocol described in the manual (primary wash solution without urea at 55°, secondary wash solution containing 0.2% SSC). The primers used to generate the probes by PCR were (5' to 3') fesUP, GGTCTACATCACTGGTGTGA; fesDO, CGCAT GATCATCGGCTCGCG; ftsZUP, GCGGTAAATACCGATGCA CAAGC; ftsZDO, CATTCGGCGGGCCAGTTTAG; yjjMUP, GCAAGGGTGGCATCAAGGTC; yjjMDO, GACATGATTCGG CTCTCCAC; ddlBUP, TCGCGCTACACGGTCGCGGCGGTG; and ddlBDO, CGTACTACCAACTGCGAGAAGCTC. The probes for the fes (899 bp), ftsZ (1088 bp), yjjM (980 bp), and ddlB (721 bp) genes were expected to hybridize with EcoRI-EcoRI fragments of 3048, 2232, 1812, and 838 bp, respectively. The probes were labeled with
[32P]ATP using T4 polynucleotide kinase (![]()
| RESULTS |
|---|
Isolation of mini-Tn10 insertions conferring mecillinam resistance:
To avoid isolating mutants whose mecillinam resistance resulted from increased RelA-dependent synthesis of ppGpp, we carried out our selection in the
relA strain CF6301, derived from the wild-type strain MG1655. We made random mini-Tn10 (Cmr) inserts and selected simultaneously for resistance to chloramphenicol and mecillinam (at 1 or 10 µg/ml), as described previously (![]()
Stability of the mutants:
We tested the stability of the mini-Tn10 insertions by growing the Cmr transductants at 37° for at least 10 generations in LB in the absence of chloramphenicol. The strains with insertions mcr-6, -7, -9, -10, -11, -13, and -14::cat did not segregate Cms clones in these conditions (0/48), whereas the five mutants with alleles mcr-4, -5, -8, -12, and -15::cat did (1571%), indicating that these insertions were unstable. Loss of chloramphenicol resistance was systematically accompanied by loss of mecillinam resistance.
We previously described the isolation of three similar mecillinam-resistant mutants, selected in a relA1 strain by insertion of mini-Tn10 (Kmr). Two of these mutants, mcr-1::kan and mcr-2::kan, were similarly unstable, and their instability was shown to be RecA dependent (VIN- ELLA et al. 1996); the recA1 mutation also stabilized the insertions mcr-4, -5, -8, -12, and -15::cat.
Mecillinam resistance and ppGpp:
Our insertions, isolated in a relA mutant, also conferred mecillinam resistance on the wild-type strain MG1655 (Table 2). It was possible that their mecillinam resistance was due to a SpoT-dependent increase of the ppGpp pool. The
relA strain cannot grow on minimal medium supplemented with glucose in the presence of serine, methionine, and glycine (SMGs; ![]()
![]()
![]()
relA mutant CF6301, suggesting that they did not sufficiently increase the ppGpp pool. However, we could distinguish in the CF6301 strain two classes of insertions on the basis of the expression of the P1rrnB::lacZ fusion, which is strongly repressed by ppGpp (Table 2): one class of mutations (mcr-7, -9, -10, and -14) strongly decreased the intensity of the blue coloration of the colonies obtained on LB plates containing X-gal, as if they increased the ppGpp pool, while none of the five unstable insertions (mcr-4, -5, -8, -12, and -15::cat) significantly affected the expression of the P1rrnB::lacZ fusion, indicating that they did not affect the ppGpp level.
|
We transduced the insertions into a
relA spoT206::kan derivative of MG1655 that is completely devoid of ppGpp and therefore auxotrophic for several amino acids (![]()
![]()
relA strain (original selection) and also on transductants of the wild-type strain MG1655 (Table 2). In the ppGpp-deficient
relA spoT206::kan strain, however, only the 5 unstable insertions conferred mecillinam resistance, whereas none of the 6 stable, viable insertions tested did so (Table 2). We conclude that the mecillinam resistance due to the unstable class of insertions mcr-4, -5, -8, -12, and -15::cat does not require ppGpp.
In conclusion, we found three classes of insertional mutants: class 1, mutants that had an increased ppGpp pool and required the presence of the nucleotide to be mecillinam resistant; class 2, mutants that seemed to have a normal ppGpp pool but, nevertheless, required the nucleotide to be mecillinam resistant; and class 3, mutants for which mecillinam resistance did not require an increased ppGpp pool and, furthermore, did not require the nucleotide at all. We have previously reported the characterization of mutants of the first two classes. Aminoacyl-tRNA synthetase mutants belong to the first class: the mecillinam resistance of these mutants (argS, alaS, and leuS) is due to a RelA-dependent increase of the ppGpp pool (![]()
![]()
![]()
Mecillinam resistance and FtsZ activity:
To test whether the mecillinam resistance conferred by the unstable insertions is associated with an increase in FtsZ activity, we first looked to see whether the insertions suppress the phenotype of an ftsZ84(Ts) mutant, since increased production of the mutant FtsZ84 protein is known to restore division in nonpermissive conditions (![]()
![]()
Genetic mapping of the unstable insertions:
We first carried out Hfr mapping of the five mcr::cat unstable insertions. We transduced the mcr::cat alleles into Hfr strains injecting an early Tcr marker (![]()
relA::kan, selecting either Tcr Kmr or Cmr Kmr exconjugants on appropriately supplemented LB plates. All five Cmr markers cotransferred efficiently with the thr::Tn10 marker (0 min) of strain BW6164 (HfrRa2), with >64% linkage between Cmr and Tetr, whereas no cotransfer occurred, for example, with the ilv::Tn10 marker (85 min) of strain BW6159 (KL14; <2% linkage). The insertions thus all seemed to be near 0 min. The mcr-1::kan and mcr-2::kan insertions isolated previously were also found to be linked to thr (data not shown).
We next transduced the insertions into strains carrying Tn10 markers regularly spaced (every 11.5 min) from 89.4 min (argE::Tn10) to 8.7 min (aroL::Tn10), selecting transductants on chloramphenicol- or kanamycin-containing LB plates. We never obtained Tcs clones among at least 48 Cmr or (in the case of mcr-1 and mcr-2) 48 Kmr clones analyzed for each transduction.
Determination of the insertion sites:
To determine the location of the unstable mini-Tn10 insertions, we first cloned their Cmr marker. Chromosomal DNA of strains carrying the unstable class 3 insertions was extracted, completely digested with the restriction enzyme PstI, which does not cut within the transposable element, and cloned in the vector pCL1920 (Spcr). These genomic libraries were used to transform strain XL1Blue, selecting on LB plates containing spectinomycin and chloramphenicol. Plasmid DNA was extracted from the Spcr Cmr clones and used to transform the same strain, XL1Blue, to verify that the plasmids carried both the Spcr and the Cmr markers. These plasmids were then partially sequenced using primers CmD and CmF to determine the joint between vector DNA and the cloned insert and to identify the adjacent chromosomal sequence. The sequences adjacent to the insertions, determined in this way, are shown on the left of Fig 1. At least four of the mutants appeared to result from an event more complex than simple insertion, involving an IS1 element.
|
The mcr-1::kan and mcr-2::kan inserts were similarly analyzed by cloning a fragment containing the kan determinant (Kmr) and adjacent chromosomal DNA in the vector pKS+. The right and left parts of the insertional element were then separately subcloned using the unique EcoRI restriction site present in the mini-Tn10 element. The joint between the insertional element and chromosomal DNA, determined using primers ISR and ISL, indicated that the mcr-1::kan and mcr-2::kan mutants also had complex genomic rearrangements (Fig 1).
Transduction of the insertions creates duplications:
In the course of strain constructions, we transduced the leu::Tn10 marker (1.8 min) from the strain MG1655 leu::Tn10 (phenotype Tcr Leu-) into the unstable mcr::cat derivatives of strain CF6301, selecting for Tcr transductants. To our surprise, all Cmr Tcr transductants were able to grow on minimal glucose plates lacking leucine (Table 3), suggesting that the recipient strains carried a duplication of the leu operon. To get an idea of the extent of the putative duplications, we transduced the mcr::cat strains to argE::Tn10 (89.4 min), thr::Tn10 (0 min), proA::Tn10 (5.7 min), and aroA::Tn10 (20.7 min; Table 3). We also analyzed the two mcr::kan mutants for diploidy at these loci. The extent of the duplications, deduced from the results reported in Table 3, is shown in the right of Fig 1; all mutants except mcr-1::kan appeared to be diploid for at least two markers, and two displayed apparent duplication of three loci, from thr to proA, which are separated on the genetic map by 5.6 min (260 kb). Such long duplications cannot be transduced by P1, which encapsidates only
2 min (95 kb) of DNA. The apparent transduction of these mcr::cat alleles is explained below.
|
When P1 was grown on MG1655 leu::Tn10 (Tcr Leu-) and used to transduce derivatives of the wild-type (relA+) strain MG1655 carrying the insertions (mcr-2::kan, mcr-4, -5, -8, -12, and -15::cat) to Tcr, diploidy for the leu operon could again be demonstrated: all Tcr Cmr transductants remained prototrophic (Leu+). This experiment was done with five transductants of MG1655 for each insertion. Our results indicate that the introduction of the five mcr::cat and the mcr-2::kan insertions by transduction was invariably correlated with the appearance of a duplication in the recipient strain. Moreover, we showed for at least one transductant of each insertion that the extent of the duplications was identical to that in the original mutant.
In reciprocal crosses, we transduced the mcr::cat and mcr::kan insertions from the CF6301 background into derivatives of the wild-type (relA+) strain MG1655 carrying either a thr::Tn10, leu::Tn10, or pro::Tn10 marker and phenotypically Thr-, Leu-, or Pro-, respectively. As mentioned above, the Cmr and Kmr transductants all remained tetracycline-resistant; we moreover observed that they also all remained auxotrophic (96 Cmr or Kmr clones were tested for each transduction), indicating that the wild-type genes that were duplicated in the donor strains were not cotransduced with chloramphenicol or kanamycin resistance.
The fact that duplicated donor genes are not cotransduced with the mcr::cat markers presumably reflects the size of the duplications, which are longer than the 2 min that P1 can transduce. Nevertheless, introduction of the insertions seemed systematically to produce Cmr transductants with duplications. We hypothesized that introduction of the insertions induced duplications of resident genes in the recipient strain. As just mentioned, when we transduced the mcr::cat insertions into strain MG1655 leu::Tn10, all Cmr transductants remained Tcr Leu-. Our hypothesis would predict that they are in fact diploid for leu::Tn10. To test this, five such transductants, carrying the five mcr::cat insertions, were transduced to Leu+ with P1 grown on a wild-type donor. Leu+ Cmr transductants were readily obtained with all five recipients, and indeed they remained Tcr, confirming that these strains were diploid for the leu operon (cf. Fig 2).
|
The mcr::cat mutants are diploid for ftsZ:
Since the mcr::cat strains are all diploid for the leu operon, which is closely linked to the ftsQ-ftsA-ftsZ operon, we wished to see whether they were also diploid for these cell division genes, potentially providing a mechanism for their mecillinam resistance (see Introduction). To test this, we took advantage of strain VIP205 (![]()
These results show that the introduction of the mcr::cat insertions, in addition to duplicating the leu::Tn10 allele, also duplicated the ftsZ+ allele of the recipient strain. Since the ftsQ and ftsA genes lie between leu and ftsZ, they are presumably duplicated as well.
Physical evidence for amplification of the fts QAZ region in the mutants:
Cultures of all seven unstable mutants were grown in LB containing mecillinam; the control strain MG1655 was grown in LB. DNA was extracted from overnight cultures and analyzed by quantitative Southern blots (see MATERIALS AND METHODS), using four probes. From the genetic evidence, two of these, from genes ftsZ and ddlB, were expected to be amplified in all mutants. The third probe, from gene yjjM at 99.0 min, was expected to be amplified in mutants mcr-5, mcr-15, and possibly mcr-4. The fourth probe was from the fes gene at 13 min, which is not included in any of the duplications; it was used to normalize the data for each culture. The results (Fig 3 and Table 4) show that the ddlB and ftsZ genes are duplicated in all mutants and that the yjjM gene is duplicated only in mcr-5, mcr-15, and mcr-4. These data are in full agreement with the genetic data.
|
|
Is a duplication sufficient to confer mecillinam resistance?
We have shown that overexpression of the FtsZ, FtsA, and FtsQ proteins confers mecillinam resistance (![]()
![]()
We tested whether duplication of the ftsQAZ operon conferred mecillinam resistance by introducing into MG1655 leu::Tn10 the F'104 episome, which carries the chromosomal region between 97 min and 6 min and is present at about one copy per chromosome. Leu+ Tcr exconjugants were purified and tested for mecillinam resistance. They were sensitive, indicating that doubling the copy number of the ftsQAZ operon is not sufficient to confer mecillinam resistance.
Since the mcr::cat mutants all have duplications of the ftsQAZ operon, they might further amplify it by unequal crossing over (![]()
|
Model:
These duplications are all unstable, they are stabilized in recA strains, they are diploid for markers in the ftsQAZ region near 2 min on the genetic map and covering as much as 250 kb, transduction of the mini-Tn10 inserts by P1 creates duplications of resident genes in the recipient strain, and the chromosomal sequences flanking the mini-Tn10 inserts are from different genes on the left and right. To explain these results, we propose a model (Fig 5) in which the initial event was a double transposition event or a transposition associated with a homologous recombination event, creating a tandem duplication with the mini-Tn10 located at the joint. When the mini-Tn10 is transduced by P1, the surrounding DNA carries the end points of the duplication, with the right end to the left and the left end to the right (Fig 5). This DNA fragment can then recombine with two sister chromosomes in the recipient cell to recreate the same duplication as in the donor chromosome, except that it is the recipient genes that are duplicated. Further amplification of the duplicated region can then occur by unequal crossing over.
|
This model makes several predictions. First of all, the duplications created by transducing the mini-Tn10 inserts should have exactly the same end points as those in the donor strains. We have shown above that for the thr, leu, and proA operons, the duplications in transductants have the same extent as in those in the donors. Second, on the basis of the sequences assumed to define the duplication end points, one predicts that the mcr-5::cat mutant should have a duplication of the purA gene while mcr-15::cat should not (Fig 1). When we transduced these mutants with a P1 stock grown on a purA45 zjd::Tn10 donor strain, Tcr Pur- cotransductants were never found when the recipient was mcr-5::cat (<1%) but readily recovered with mcr-15::cat (
30%).
Third, it should be possible to cotransduce donor markers that are very close to the mini-Tn10, and indeed we found this with our smallest duplication, mcr-1::kan. In one experiment, with a leu::Tn10 recipient, we found one Tcs clone among 125 Kmr transductants. With an ftsI23(Ts) recipient, we found 90% cotransduction of temperature resistance (ftsI+) and Kmr. Note that the leu operon is not duplicated in mcr-1::kan and is
1.6 min from the mini-Tn10, whereas the ftsI gene, between leuO and ftsQ, is covered by the duplication with the two copies located 0.2 and 1.3 min from the mini-Tn10 (cf. Fig 1). We therefore expected the ftsI+ cotransductants to be diploid and, for most of them, heterozygous. Indeed, when the donor strain was ftsI23(Ts) mcr-1::kan and the recipient wild type, only three temperature-sensitive clones were found among 144 Kmr transductants. These had presumably received both donor genes and were thus homozygous for the ftsI23(Ts) allele. Their temperature sensitivity suggests that further amplification of this allele by unequal crossing over does not restore temperature-resistant division, unlike the ftsZ84(Ts) allele.
The instability of these tandem duplications arises from RecA-dependent recombination between the duplicated sequences. As a fourth prediction of our model, one would expect heterozygous leu+ leu::Tn10 diploids to segregate two types of haploid, Tcr Leu- and Tcs Leu+, according to where the crossover takes place. Heterozygous diploids of this sort, carrying the mcr-2::kan allele or any one of the five mcr::cat alleles, were grown and plated without antibiotics, and Kms or Cms segregants were looked for. All six mutants gave rise to both types of segregants; the ratio of Tcs Leu+ to Tcr Leu- colonies ranged from 0.08 to 27, according to the mcr allele.
Fifth, the mechanism proposed for recreation of the duplications by P1 transduction requires at least three crossover events, compared to a double crossover in the normal transduction process, so transduction of our mini-Tn10 inserts would be expected to be less efficient than normal transduction. Indeed, we consistently found some 10-fold fewer transductants when selecting one of these mini-Tn10 inserts as compared to the number of transductants obtained in straightforward selections for markers such as leu::Tn10.
A sixth prediction of our model concerns the presumed further amplification by unequal crossing over. As shown above, cultures of the mcr-1::kan mutant can be at least triploid for the leu operon. However, this amplification, which is absolutely necessary for mecillinam resistance, should require RecA-dependent recombination. We found that the recA1 mutation, in addition to stabilizing the mini-Tn10 element, also suppressed the mecillinam resistance of all seven unstable mcr mutants.
| DISCUSSION |
|---|
In this article, using insertional mutagenesis, we carried out a selection for mutants that overproduce the division proteins FtsQ, FtsA, and FtsZ, in the hope of identifying regulators of this complex operon. Of 12 new and 3 previously selected mecillinam-resistant mutants, 7 were of this type. However, in all cases the amplification was produced by increasing the gene copy number rather than by increasing the rate of transcription initiation. Since these duplications seemed to result from multiple events, it seems unlikely that a single insertional mutation can increase ftsQAZ transcription sufficiently to confer mecillinam resistance.
Gene amplification was brought about by creating a tandem duplication with the mini-Tn10 at the joint between the repeated sequences (Fig 5). The duplications are too long to be encapsidated by the transducing phage P1, but they can be recreated by transduction. The mechanism proposed requires encapsidating the deletion end points and the adjacent mini-Tn10, which carries the selective marker (cf. Fig 5).
It is striking that four of the seven duplications described here have one end point in an IS1 element. On examining the sequence of the mini-Tn10, we noted that it has a 58-bp stretch that is homologous to one end of IS1 (one difference compared with IS1B and IS1C). Thus the initial formation of the duplications in these cases seems to have involved a transposition event, determining one duplication end point, and a homologous recombination event between the mini-Tn10 and an IS1, determining the other end point. In Salmonella typhimurium, duplications have been shown to form between separate IS200 elements, presumably by unequal crossing over (![]()
Our model for duplication formation suggests a general method for constructing strains with a precise tandem duplication of virtually any sequence on the chromosome. To do this, the deletion end points should first be cloned in a plasmid vector, in the proper orientation, next to a selective marker (Tn, for example). If one wants to duplicate, say, the sequence DEFGHIJK, the right end point JK should be cloned to the left of the Tn marker and the left end point DE should be cloned to the right, taking care to maintain the normal chromosomal orientation of each sequence. The cloned fragment JK-Tn-DE can then be separated from plasmid replication functions and used in linear transformation, where, by the mechanism shown in Fig 5, it will create a tandem duplication having the structure AB CDEFGHIJK-Tn-DEFGHIJKLM.
In our system, a mere doubling of the number of ftsQAZ operons is not enough to confer mecillinam resistance. Nevertheless, essentially all cells carrying a tandem duplication of the operon succeed in forming a colony on mecillinam plates, apparently through further amplification by unequal crossing over. A selection of this sort can be included in the construction of a designed duplication. For this, one need only include, together with the selectable Tn element, genes whose further amplification can be selected for. The ftsQAZ genes would be one possibility; growth in the presence of mecillinam would then produce a population with more than two copies of the designed duplication. Other drug resistance markers could also be used, as well as metabolic functions with insufficient expression.
Our selection produced the phenotype we expected: 7 of our 15 mecillinam-resistant mutants overproduce FtsQ, FtsA, and FtsZ (Table 2, class 3), and at least 4 of the others seem to have a higher than normal ppGpp pool (Table 2, class 1). The fact that our class 3 overproducers did not define regulators of the ftsQAZ operon illustrates once again that there are many ways to skin a cat, and E. coli is more clever than we are by eluding our attempt to define regulators by insertion mutagenesis. We are currently completing the characterization of the mutants of classes 1 and 2 and selecting new mutants that become mecillinam resistant via overproduction of specific gene products.
| ACKNOWLEDGMENTS |
|---|
We thank Bénédicte Gagny for her participation in the analysis of the mcr-1::kan and mcr-2::kan mutants, Peter Kuempel for stimulating discussions, and Evelyne Maillet for her precious help in the Southern blot experiments. D. Vinella was supported in part by a Fogarty grant International Fellowship. This work was supported in part by grant 9981 from the Association pour la Recherche sur le Cancer.
Manuscript received March 14, 2000; Accepted for publication August 14, 2000.
| LITERATURE CITED |
|---|
BACHMANN, B. J., 1996 Derivations and genotypes of some mutant derivatives of Escherichia coli K-12, pp. 24602488 in Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology, edited by F. C. NEIDHARDT, J. L. INGRAHAM, K. B. LOW, B. MAGASANIK, M. SCHAECHTER and H. E. UMBARGER. American Society for Microbiology, Washington, DC.
BULLOCK, W. O., J. M. FERNANDEZ, and J. M. SHORT, 1987 XL1-Blue: a high efficiency plasmid transforming recA Escherichia coli strain with beta-galactosidase selection. BioTechniques 5:376-378.
CASHEL, M., 1969 The control of ribonucleic acid synthesis in Escherichia coli. IV. Relevance of unusual phosphorylated compounds from amino acid-starved stringent strains. J. Biol. Chem. 244:3133-3141
CASHEL, M. and J. GALLANT, 1969 Two compounds implicated in the function of the RC gene of Escherichia coli.. Nature 221:838-841[Medline].
CASHEL, M., D. R. GENTRY, V. J. HERNANDEZ and D. VINELLA, 1996 The stringent response, pp. 14591496 in Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology, edited by F. C. NEIDHARDT, J. L. INGRAHAM, K. B. LOW, B. MAGASANIK, M. SCHAECHTER and H. E. UMBARGER. American Society for Microbiology, Washington, DC.
CHATTERJI, D., N. FUJITA, and A. ISHIHAMA, 1998 The mediator for stringent control, ppGpp, binds to the ß-subunit of Escherichia coli RNA polymerase. Genes Cells 3:279-287[Abstract].
HAACK, K. R. and J. R. ROTH, 1995 Recombination between chromosomal IS200 elements supports frequent duplication formation in Salmonella typhimurium.. Genetics 141:1245-1252[Abstract].
HERNANDEZ, V. J. and H. BREMER, 1990 Guanosine tetraphosphate (ppGpp) dependence of the growth rate control of rrnB P1 promoter activity in Escherichia coli.. J. Biol. Chem. 265:11605-11614
HERNANDEZ, V. J. and H. BREMER, 1991 Escherichia coli ppGpp synthetase II activity requires spoT.. J. Biol. Chem. 266:5991-5999
JAMES, R., J. Y. HAGA, and A. B. PARDEE, 1975 Inhibition of an early event in the cell division cycle of Escherichia coli by FL 1060, an amidinopenicillanic acid. J. Bacteriol. 122:1283-1292
JOSELEAU-PETIT, D., D. THÉVENET, and R. D'ARI, 1994 ppGpp concentration, growth without PBP2 activity and growth rate control in Escherichia coli.. Mol. Microbiol. 13:911-917[Medline].
JOSELEAU-PETIT, D., D. VINELLA, and R. D'ARI, 1999 Metabolic alarms and cell division in Escherichia coli.. J. Bacteriol. 181:9-14
KLECKNER, N., J. BENDER, and S. GOTTESMAN, 1991 Uses of transposons with emphasis on Tn10.. Methods Enzymol. 204:139-180[Medline].
LAZZARINI, R. A., M. CASHEL, and J. GALLANT, 1971 On the regulation of guanosine tetraphosphate levels in stringent and relaxed strains of Escherichia coli.. J. Biol. Chem. 246:4381-4385
LERNER, C. G. and M. INOUYE, 1990 Low copy number plasmids for regulated low-level expression of cloned genes in Escherichia coli with blue/white insert screening capability. Nucleic Acids Res. 18:4631
LUND, F. and L. TYBRING, 1972 6ß-amidinopenicillanic acida new group of antibiotics. Nat. New Biol. 236:135-137[Medline].
MATSUHASHI, S., T. KAMIRYO, P. M. BLUMBERG, P. LINNETT, and E. WILLOUGHBY et al., 1974 Mechanism of action and development of resistance to a new amidino penicillin. J. Bacteriol. 117:578-587
METZGER, S., G. SCHREIBER, E. AIZENNMAN, M. CASHEL, and G. GLASER, 1989 Characterization of the relA1 mutation and comparison of relA1 with new relA null alleles in Escherichia coli.. J. Biol. Chem. 264:21146-21152
MILLER, J. H., 1992 A Short Course in Bacterial Genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
NAVARRO, F., A. ROBIN, R. D'ARI, and D. JOSELEAU-PETIT, 1998 Analysis of the effect of ppGpp on the ftsQAZ operon in Escherichia coli.. Mol. Microbiol. 29:815-823[Medline].
PALACIOS, P., M. VICENTE, and M. SÁNCHEZ, 1996 Dependency of Escherichia coli cell-division size, and independency of nucleoid segregation on the mode and level of ftsZ expression. Mol. Microbiol. 20:1093-1098[Medline].
ROBINSON, A. C., D. J. KENAN, G. F. HATFULL, N. F. SULLIVAN, and R. SPIEGELBERG et al., 1984 DNA sequence and transcriptional organization of essential cell division genes ftsQ and ftsA of Escherichia coli: evidence for overlapping transcriptional units. J. Bacteriol. 160:546-555
ROBINSON, A. C., D. J. KENAN, J. SWEENEY, and W. D. DONACHIE, 1986 Further evidence for overlapping transcriptional units in an Escherichia coli cell envelope-cell division gene cluster: DNA sequence and transcriptional organization of the ddl ftsQ region. J. Bacteriol. 167:809-817
RUDD, K. E., B. R. BOCHNER, M. CASHEL, and J. R. ROTH, 1985 Mutations in the spoT gene of Salmonella typhimurium: effects on his operon expression. J. Bacteriol. 163:534-542
RYALS, J., R. LITTLE, and H. BREMER, 1982 Control of rRNA and tRNA syntheses in Escherichia coli by guanosine tetraphosphate. J. Bacteriol. 151:1261-1268
SAMBROOK, J., E. F. FRITSCH and T. MANIATIS, 1989 Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
SARUBBI, E., K. E. RUDD, and M. CASHEL, 1988 Basal ppGpp level adjustment shown by new spoT mutants affects steady state growth rates and rrnA ribosomal promoter regulation in Escherichia coli.. Mol. Gen. Genet. 213:214-222[Medline].
SINGER, M., T. A. BAKER, G. SCHNITZLER, S. M. DEISCHEL, and M. GOEL et al., 1989 A collection of strains containing genetically linked alternating antibiotic resistance elements for genetic mapping of Escherichia coli.. Microbiol. Rev. 53:1-24
SPRATT, B. G., 1975 Distinct penicillin binding proteins involved in the division, elongation, and shape of Escherichia coli K-12. Proc. Natl. Acad. Sci. USA 72:2999-3003
SPRATT, B. G., 1977 The mechanism of action of mecillinam. J. Antimicrob. Chemother. 3(Suppl. B):13-19.
SPRATT, B. G. and A. B. PARDEE, 1975 Penicillin-binding protein and cell shape in E. coli.. Nature 254:515-517[Medline].
UZAN, M. and A. DANCHIN, 1976 A rapid test for the relA mutation in E. coli.. Biochem. Biophys. Res. Commun. 69:751-758[Medline].
VINELLA, D., R. D'ARI, A. JAFFÉ, and P. BOULOC, 1992 Penicillin-binding protein 2 is dispensable in Escherichia coli when ppGpp synthesis is induced. EMBO J. 11:1493-1501[Medline].
VINELLA, D., D. JOSELEAU-PETIT, D. THÉVENET, P. BOULOC, and R. D'ARI, 1993 Penicillin-binding protein 2 inactivation in Escherichia coli results in cell division inhibition, which is relieved by FtsZ overexpression. J. Bacteriol. 175:6704-6710
VINELLA, D., B. GAGNY, D. JOSELEAU-PETIT, R. D'ARI, and M. CASHEL, 1996 Mecillinam resistance in Escherichia coli is conferred by loss of a second activity of the AroK protein. J. Bacteriol. 178:3818-3828
WANG, X., P. A. J. DE BOER, and L. I. ROTHFIELD, 1991 A factor that positively regulates cell division by activating transcription of the major cluster of essential cell division genes of Escherichia coli.. EMBO J. 10:3363-3372[Medline].
WANNER, B. L., 1986 Novel regulatory mutants of the phosphate regulon in Escherichia coli K-12. J. Mol. Biol. 191:39-58[Medline].
XIAO, H., M. KALMAN, K. IKEHARA, S. ZEMEL, and G. GLASER et al., 1991 Residual guanosine 3',5'-bispyrophosphate synthetic activity of relA null mutants can be eliminated by spoT null mutations. J. Biol. Chem. 266:5980-5990
YI, Q.-M., S. ROCKENBACH, J. E. J. WARD, and J. LUTKENHAUS, 1985 Structure and expression of the cell division genes ftsQ, ftsA, and ftsZ.. J. Mol. Biol. 184:399-412[Medline].
This article has been cited by other articles:
![]() |
B. A. Legaree, C. B. Adams, and A. J. Clarke Overproduction of Penicillin-Binding Protein 2 and Its Inactive Variants Causes Morphological Changes and Lysis in Escherichia coli J. Bacteriol., July 15, 2007; 189(14): 4975 - 4983. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. A. Legaree, K. Daniels, J. T. Weadge, D. Cockburn, and A. J. Clarke Function of penicillin-binding protein 2 in viability and morphology of Pseudomonas aeruginosa J. Antimicrob. Chemother., March 1, 2007; 59(3): 411 - 424. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Costanzo and S. E. Ades Growth Phase-Dependent Regulation of the Extracytoplasmic Stress Factor, {sigma}E, by Guanosine 3',5'-Bispyrophosphate (ppGpp) J. Bacteriol., July 1, 2006; 188(13): 4627 - 4634. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Potrykus, D. Vinella, H. Murphy, A. Szalewska-Palasz, R. D'Ari, and M. Cashel Antagonistic Regulation of Escherichia coli Ribosomal RNA rrnB P1 Promoter Activity by GreA and DksA J. Biol. Chem., June 2, 2006; 281(22): 15238 - 15248. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Nicoloff, V. Perreten, L. M. McMurry, and S. B. Levy Role for Tandem Duplication and Lon Protease in AcrAB-TolC- Dependent Multiple Antibiotic Resistance (Mar) in an Escherichia coli Mutant without Mutations in marRAB or acrRAB. J. Bacteriol., June 1, 2006; 188(12): 4413 - 4423. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Ding and P. J. Christie Agrobacterium tumefaciens Twin-Arginine-Dependent Translocation Is Important for Virulence, Flagellation, and Chemotaxis but Not Type IV Secretion J. Bacteriol., February 1, 2003; 185(3): 760 - 771. [Abstract] [Full Text] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Vinella, D.
- Articles by D'Ari, R.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Vinella, D.
- Articles by D'Ari, R.







