Genetic Analysis of Indole-3-butyric Acid Responses in Arabidopsis thaliana Reveals Four Mutant Classes

Corresponding author: Bonnie Bartel, Department of Biochemistry and Cell Biology, Rice University, 6100 S. Main St., Houston, TX 77005., bartel{at}rice.edu (E-mail)

Communicating editor: C. S. GASSER

	ABSTRACT

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Indole-3-butyric acid (IBA) is widely used in agriculture because it induces rooting. To better understand the in vivo role of this endogenous auxin, we have identified 14 Arabidopsis mutants that are resistant to the inhibitory effects of IBA on root elongation, but that remain sensitive to the more abundant auxin indole-3-acetic acid (IAA). These mutants have defects in various IBA-mediated responses, which allowed us to group them into four phenotypic classes. Developmental defects in the absence of exogenous sucrose suggest that some of these mutants are impaired in peroxisomal fatty acid chain shortening, implying that the conversion of IBA to IAA is also disrupted. Other mutants appear to have normal peroxisomal function; some of these may be defective in IBA transport, signaling, or response. Recombination mapping indicates that these mutants represent at least nine novel loci in Arabidopsis. The gene defective in one of the mutants was identified using a positional approach and encodes PEX5, which acts in the import of most peroxisomal matrix proteins. These results indicate that in Arabidopsis thaliana, IBA acts, at least in part, via its conversion to IAA.

AUXIN is an essential plant hormone that influences numerous aspects of growth and development, including vascular development, lateral root initiation, apical dominance, phototropism, and gravitropism (DAVIES 1995 ). Indole-3-acetic acid (IAA) is the most abundant endogenous auxin and its in vivo role has been examined extensively. Indole-3-butyric acid (IBA) was long regarded as a synthetic auxin, but recently has been shown to occur naturally in several plant species (SCHNEIDER et al. 1985 ; EPSTEIN et al. 1991 ; LUDWIG-MULLER and EPSTEIN 1991 ; NORDSTROM et al. 1991 ; SUTTER and COHEN 1992 ), including Arabidopsis (LUDWIG-MULLER et al. 1993 ). Although plants have slightly less IBA than IAA in vivo (LUDWIG-MULLER and EPSTEIN 1993 ; LUDWIG-MULLER et al. 1993 ), IBA is often more effective than IAA in root initiation, making it important in commercial and agricultural settings (HARTMANN et al. 1990 ; DE KLERK et al. 1999 ). In Arabidopsis, IBA induces adventitious roots (KING and STIMART 1998 ) and was widely used to induce roots on shoot explants following Agrobacterium-mediated transformations (SCHMIDT and WILLMITZER 1988 ; CHAUDHURY and SIGNER 1989 ; MARTON and BROWSE 1991 ).

Several hypotheses have been advanced to explain the rooting efficacy of IBA. IBA is more stable than IAA under various light and temperature conditions, both in solution and in vivo (NISSEN and SUTTER 1990 ; NORDSTROM et al. 1991 ). Differences in transport, uptake, or metabolism might also contribute to the superior activity (reviewed in EPSTEIN and LUDWIG-MULLER 1993 ). Alternatively, a specific IBA to IAA ratio may be important for development, and the application of exogenous IBA might shift the balance to promote root development (reviewed in EPSTEIN and LUDWIG-MULLER 1993 ).

How IBA acts at a molecular level is also unknown. IBA may be a bona fide auxin, with its own receptor and signal transduction pathway. Alternatively, IBA may function solely through its conversion to IAA, acting as a "slow release" form of IAA (VAN DER KRIEKEN et al. 1997 ) in a manner similar to certain IAA conjugates (HANGARTER and GOOD 1981 ; BARTEL 1997 ). Previous work in several plant species has supported each hypothesis, suggesting that both mechanisms are important in vivo. For example, the conversion of exogenous IBA to IAA has been observed in pea (NORDSTROM et al. 1991 ), apple (VAN DER KRIEKEN et al. 1992 ), pear (BARALDI et al. 1993 ), grape, and olive (EPSTEIN and LAVEE 1984 ). Although application of radiolabeled IBA to apple cuttings elevates both IBA and IAA levels, adding IBA increases internal free IAA levels more than a similar IAA application (VAN DER KRIEKEN et al. 1992 ). Interestingly, when concentrations of exogenous IBA and IAA are used that produce equivalent levels of free internal IAA, IBA induces more lateral roots (VAN DER KRIEKEN et al. 1992 ). These results suggest that even though IBA is converted to IAA in vivo, it also can have independent or synergistic effects with IAA.

Previous work has demonstrated that IBA and other even chain-length derivatives of IAA have auxin effects, and wheat and pea extracts shorten these derivatives in two carbon steps (FAWCETT et al. 1960 ). IBA was consequently proposed to be converted to IAA in a process resembling fatty acid ß-oxidation. Plants catalyze these reactions (and probably those that convert IBA to IAA) in peroxisomes, which are small organelles bounded by a single lipid bilayer. Peroxisomes contain oxidases that produce hydrogen peroxide, catalases that inactivate reactive molecules, and all of the enzymes necessary for fatty acid ß-oxidation (reviewed in GERHARDT 1992 ; KINDL 1993 ; OLSEN 1998 ). In seedlings and senescent tissues, specialized peroxisomes called glyoxysomes also contain the enzymes of the glyoxylate cycle, which converts the acetyl-CoA generated during fatty acid degradation to succinate. Leaf peroxisomes lack the glyoxylate cycle, but contain some enzymes involved in photorespiration. Because peroxisomes do not contain DNA, matrix proteins enter peroxisomes post-translationally using one of two peroxisomal targeting signals (PTS). Proteins with a PTS1 consensus sequence (the tripeptide SKL or a conserved variant; GOULD et al. 1989 ) at the extreme C terminus are bound by the PEX5 receptor, which facilitates peroxisomal protein translocation (reviewed in OLSEN 1998 ). Proteins with a PTS2 signal have a nine-amino-acid consensus sequence near the N terminus, which is removed following import. PEX7 encodes the PTS2 receptor (SCHUMANN et al. 1999 ).

Several Arabidopsis mutants have been identified with defects in fatty acid ß-oxidation. Peroxisome deficient (ped) mutants were isolated in a screen for plants that elongated roots on inhibitory concentrations of 2,4-dichlorophenoxybutyric acid (2,4-DB), but remained sensitive to the synthetic auxin 2,4-dichlorophenoxyacetic acid (2,4-D; HAYASHI et al. 1998B ). This screen was based on the observation that 2,4-DB is ß-oxidized to 2,4-D, which inhibits root elongation (WAIN and WIGHTMAN 1954 ). The 2,4-DB-resistant mutants then were assayed for the ability to develop without exogenous sucrose. Because oilseed plants, like Arabidopsis, ß-oxidize storage fatty acids during germination to provide energy, plants with ß-oxidation defects require supplemental sugar. Three such 2,4-DB-resistant mutants were further examined (HAYASHI et al. 1998B ). ped1 has a missense mutation in a gene encoding thiolase, which acts in the final step of ß-oxidation (HAYASHI et al. 1998B ). The defects in ped2 and ped3 have not been reported. A fourth 2,4-DB resistant mutant, aim1 (abnormal inflorescence meristem), has a T-DNA insertion in a gene encoding a multifunctional protein acting in fatty acid ß-oxidation (RICHMOND and BLEECKER 1999 ).

Despite the importance of IBA in commercial applications and its presence in a wide range of plant species, little genetic analysis of IBA function has been conducted. To understand auxin action, the functional significance of the various auxins found in plants must be determined. We are using a genetic approach to elucidate the in vivo role of IBA in the model organism Arabidopsis thaliana. We have identified IBA-response mutants that retain IAA sensitivity and have phenotypically characterized these mutants in several auxin-related and peroxisomal assays. We have mapped 11 of these mutants, which represent nine loci, and used positional information to clone one of the defective genes, which encodes the PTS1 peroxisomal import protein PEX5. Our results indicate an important role for IBA in vivo and begin to define the mechanism of IBA action in Arabidopsis.

	MATERIALS AND METHODS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Plant materials and growth conditions:
A. thaliana ecotypes Columbia (Col-0), Landsberg erecta tt4 (Ler), and Wassilewskija (Ws) were used. Plants were grown in soil (Metromix 200; Scotts, Marysville, OH) at 22–25° under continuous illumination by Sylvania Cool White fluorescent bulbs, except for aim1 plants, which were grown in short days (8 hr light) to allow seed set (RICHMOND and BLEECKER 1999 ). Plants grown aseptically were plated on PNS (plant nutrient media with 0.5% sucrose; HAUGHN and SOMERVILLE 1986 ) solidified with 0.6% agar, either alone or supplemented with hormones (from 1 or 100 mM stocks in ethanol). Plates were wrapped with gas-permeable Leukopor surgical tape (Beiersdorf Inc., Norwalk, CT) and grown at 22° under continuous yellow-filtered light to prevent breakdown of indolic compounds (STASINOPOULOS and HANGARTER 1990 ). Genetic crosses were performed as described (KOORNNEEF et al. 1998 ).

Mutant isolation and nomenclature:
Col-0 seeds were mutagenized with ethyl methanesulfonate (EMS; NORMANLY et al. 1997 ). M₂ seeds were surface sterilized (LAST and FINK 1988 ) and plated on PNS containing 20 µM IBA at 1000 seeds per 150-mm plate. After 8 days, putative mutants with elongated roots were selected, transferred to soil, and allowed to self-fertilize. Resulting M₃ seeds were screened separately for resistance to 5 and 20 µM IBA and wild-type sensitivity to 50 and 500 nM IAA and backcrossed to Col-0 to remove any unlinked mutations. T-DNA lines (FELDMANN 1991 ; CAMPISI et al. 1999 ) from the Arabidopsis Biological Resource Center (Ohio State University, Columbus, OH) were similarly screened. Mutant lines used in phenotypic assays were homozygous plants from the first (ibr1-1, ibr2, ibr3, B17, B29, ibr6) or second (ibr1-2, pex5-1) backcross to the parental (Col-0) line (ibr, IBA response). A few mutants were analyzed as selfed progeny of the original isolates (ibr4, ibr5, B7, B11, B40, and B52), except in Fig 1 and Table 2, where the B7 and B11 lines were from the first backcross to Col-0. B52 and ibr4 are mutants from T-DNA lines in the Ws background (FELDMANN 1991 ) and ibr6 is from a Col-0 T-DNA line (CAMPISI et al. 1999 ).

View larger version (19K): In this window In a new window Download PPT slide   Figure 1. Auxin effects of IBA. (A) Root elongation on IBA and IAA. Eight-day-old Col-0 seedlings grown on the indicated concentrations of IBA and IAA under yellow-filtered light were removed from the agar and the length of the longest root was measured (solid symbols). The percentage elongation of plants grown on hormone vs. hormone-free media is shown. Error bars indicate the standard deviations of the means (n 12). Also shown is the B17 mutant, which is resistant to IBA and sensitive to IAA (open symbols). (B) Lateral root initiation on IBA and IAA. Four-day-old Col-0 seedlings were transferred from hormone-free media to media containing the indicated concentration of IBA or IAA. After 4 additional days, plants were removed from the agar and the number of lateral roots were counted. Error bars indicate the standard deviations of the means (n 12). (C) Root elongation of previously characterized mutants on IBA. Roots of 8-day-old seedlings grown on 5 or 10 µM IBA were measured as described above (n 12). axr1-12, axr2-1, axr3-1, and ein2-1 are in the Col-0 background; aim1-1 is in the Ws background; and ped1-1 is in the Ler background.

The ß-oxidation defective mutants (Class 1) are usually referred to by their isolation number, because we have determined by mapping in only five cases (pex5, B11, B17, B29, B52) that they are not allelic to the previously isolated ped (HAYASHI et al. 1998B ) or aim1 (RICHMOND and BLEECKER 1999 ) mutants. These mutants will be named in the future based on the nature of the defective genes, which are expected to be similar to genes of known function. Other mutants were given ibr designations because we have determined by mapping or complementation analysis that they represent unique loci.

Phenotypic assays:
Seeds were surface sterilized and plated on PNS with the indicated concentration of hormone. Seedlings were grown for the indicated number of days, removed from the agar, and the length of the hypocotyl or longest root was measured. At least 12 plants were measured for each data point. Data is expressed as percentage elongation on supplemented vs. unsupplemented media. In the lateral root assays (Fig 1 and Fig 4), seeds were germinated and grown on PNS for 4 days, then transferred to media containing IBA or IAA and grown for 4 additional days, when the number of lateral roots was counted under a dissecting microscope. In the hypocotyl elongation assay (Fig 3), seeds were plated on PN (without sucrose) or PNS and incubated for 24 hr under white light before being transferred to the dark for 5 or 8 additional days.

View larger version (34K): In this window In a new window Download PPT slide   Figure 2. Root elongation on IBA and IAA. Roots of 8-day-old seedlings grown on 5 µM IBA or 50 nM IAA were measured as described in the legend of Fig 1A. All mutants are in the Col-0 background except for ibr4 and B52, which are in the Ws background. Error bars indicate the standard deviations of the means (n 14), and asterisks indicate measurements significantly different from the corresponding wild type (Student's t-test, P < 0.0001).

View larger version (27K): In this window In a new window Download PPT slide   Figure 3. Hypocotyl elongation in the dark in the absence of sucrose. Five-day-old seedlings grown on sucrose-free media in darkness were removed from the agar and the length of the hypocotyl was measured and compared to plants grown on 0.5% sucrose. Mutants with short hypocotyls without sucrose also were measured after 8 days. The percent elongation compared to media containing sucrose is shown. Error bars indicate the standard deviations of the means (n 12).

View larger version (36K): In this window In a new window Download PPT slide   Figure 4. Lateral root initiation on IBA and IAA. Plants were transferred to 5 µM IBA or 20 nM IAA and the number of lateral roots was counted as described in the legend of Fig 1B. Error bars indicate the standard deviations of the means (n 12).

Gas chromatography (GC) analysis of seed storage lipids:
Seeds were surface sterilized and grown on filter paper on agar-solidified PNS media under continuous white light. Fatty acids were isolated and esterified by heating 75 5-day-old-seedlings in methanolic HCl as previously described (BROWSE et al. 1986 ), except that 1.2 µg of docosanoic acid (Sigma, St. Louis) was added to each sample as an internal standard, and samples were extracted in methanolic HCl at 80° for 3 hr rather than 1 hr. Samples were chromatographed on a Hewlett Packard gas chromatograph (HP6890 equipped with a 30 m x 0.25 mm Rtx-5 column). The oven was held at 100° for 1 min and warmed 25°/min to 160° and 10°/min to 200°, where it remained for 7 min. A 10°/min increase to 220° was followed by 6 min at 220°. Specific methyl esters were identified by comparing elution times to those of reference compounds (Sigma).

Genetic analysis:
The EMS-induced IBA-resistant mutants, which are in a Col-0 background, were outcrossed to Ws or Ler for mapping. The resulting F₂ seeds were plated on 15 µM IBA, and DNA from resistant individuals was isolated (CELENZA et al. 1995 ). Mutants were mapped using published simple sequence length polymorphisms (BELL and ECKER 1994 ) and cleaved amplified polymorphic sequences (CAPS; KONIECZNY and AUSUBEL 1993 ) markers and by developing additional PCR-based markers (Table 1). New markers were identified by PCR amplifying and sequencing 1.3-kbp genomic DNA fragments from different ecotypes and identifying polymorphisms that altered fragment sizes or restriction enzyme recognition sites.

Identification of the pex5-1 mutation:
A candidate gene (PEX5, GenBank no. AF074843) within the mapping interval was examined for defects in the B44 mutant. Genomic DNA extracted from B44 mutant plants was amplified using 5 pairs of oligonucleotides (PEX5-1: GTCGTTGGCTGAATATTTTG TTCGGC and PEX5-2: GTGGCAAGTAAGACCCTAAAGTGA AC; PEX5-3: GACGCATCACCCTGCATCTAAC and PEX5-4: GACCACAAGTATCCATATATGTGAAC; PEX5-5: CGGTCA GTGCATGTTATCTAGC and PEX5-6: GACGTAACGTCTTT GTAAGATTTTC; PEX5-7: CTACATCTAACCGTTTTGTATC CGGG and PEX5-8: CCATACTGATAGATTCAACGACGGTG; PEX5-9: CCTATTTCTCCTGAATGACACGTTG and PEX5-10: GTTGCAGCTACAGAACACTATCAG) using 40 cycles of 95° for 30 sec, 56° for 30 sec, and 72° for 3 min. The resultant overlapping fragments covered the gene from 60 bp upstream of the putative translation start site to 75 bp downstream of the stop codon. Amplification products were purified by sequential ethanol, polyethylene glycol, and ethanol precipitations (AUSUBEL et al. 1999 ) and sequenced directly using an automated DNA sequencer (Lone Star Labs, Houston, TX) with the primers used for amplification.

The pex5-1 mutation was confirmed by amplifying genomic DNA with primers PEX5-1 and PEX5-2, which amplify a 1.2-kbp PCR product containing three and two EcoRI sites in Col-0 and pex5-1, respectively.

A full-length PEX5 cDNA was isolated from a plasmid-based cDNA library (MINET et al. 1992 ) by colony hybridization with a 920-bp probe (made by amplifying genomic DNA with primers PEX5-7 and PEX5-8), subcloned into the NotI site of pBluescript II KS+ (Stratagene, La Jolla, CA), and sequenced with vector-derived primers. The cDNA was then subcloned in the sense orientation into the NotI site of the 35SpBARN plant transformation vector, a derivative of p1'barbi (MENGISTE et al. 1997 ) modified to contain the Cauliflower Mosaic Virus 35S promoter and nos terminator flanking a multiple cloning site (S. LECLERE and B. BARTEL, unpublished data). This plasmid was electroporated (AUSUBEL et al. 1999 ) into Agrobacterium tumefaciens strain GV3101 (KONCZ and SCHELL 1986 ), which was used to transform pex5-1 (B44) mutant plants by the floral dip method (CLOUGH and BENT 1998 ). Transformants were identified by spraying soil-grown plants with Finale herbicide (AgrEvo Environmental Health, Montvale, NJ) diluted in water to a concentration of 0.26 mg/ml glufosinate-ammonium at 1 and 2 wk after germination.

	RESULTS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Auxin effects of IBA in A. thaliana:
IBA has auxin activity in several bioassays. We compared the responses of Arabidopsis seedlings to IAA and IBA in two tests, inhibition of root elongation and promotion of lateral root initiation. Wild-type seeds were germinated on a range of IBA and IAA concentrations, and root elongation was measured after 8 days (Fig 1A). IBA inhibited primary root elongation similarly to IAA, but required a >100-fold higher concentration. To quantify lateral root promotion by IBA, we transferred 4-day-old seedlings to IAA- or IBA-containing media and counted lateral roots 4 days after transfer (Fig 1B). As expected, IBA induced lateral roots similarly to IAA. In this case, however, the optimum concentration of IBA was only 10-fold more than that of IAA. Therefore, IBA maximally promotes lateral roots at concentrations that only moderately affect elongation, whereas IAA promotes lateral roots at concentrations that severely inhibit elongation. These results confirm that IBA acts as an auxin in Arabidopsis and provide the basis for the mutant screen described below.

We also examined IBA responses of known auxin-resistant mutants. Several IAA-resistant mutants, including axr1 (ESTELLE and SOMERVILLE 1987 ; LEYSER et al. 1993 ), axr2 (TIMPTE et al. 1994 ), axr3 (LEYSER et al. 1996 ; ROUSE et al. 1998 ), shy2 (TIAN and REED 1999 ), and iaa28 (L. E. ROGG, J. LASSWELL and B. BARTEL, unpublished results), elongate roots more than wild type on inhibitory concentrations of IBA (Fig 1C and data not shown). The IBA resistance of these auxin response mutants is consistent with IBA acting as an auxin or auxin precursor in Arabidopsis.

Several components that mediate polar IAA transport have been identified in Arabidopsis (reviewed in ESTELLE 1998 ). The aux1 mutant (PICKETT et al. 1990 ), which is defective in an auxin influx carrier (BENNETT et al. 1996 ; MARCHANT et al. 1999 ), is resistant to the inhibitory effects of IBA on root elongation (Fig 2). This suggests that IBA and IAA enter root cells through the same carrier, as previously indicated by the competition of labeled IBA uptake by excess IAA in Arabidopsis seedlings (LUDWIG-MULLER and HILGENBERG 1995 ). A defect in auxin efflux causes the roots of the eir1-1 (= agr1 = pin2) mutant (CHEN et al. 1998 ; LUSCHNIG et al. 1998 ; MULLER et al. 1998 ; UTSUNO et al. 1998 ) to bend into media containing IAA or 1-naphthaleneacetic acid (NAA) when grown vertically (UTSUNO et al. 1998 ). Interestingly, we found that eir1-1 mutant roots fail to bend and enter agar containing IBA under similar conditions (data not shown), suggesting that IBA is not an EIR1 substrate.

In contrast to eir1, we found that other ethylene mutants have altered IBA responses. ein2 alleles have been identified in ethylene (GUZMAN and ECKER 1990 ; ALONSO et al. 1999 ), cytokinin (CARY et al. 1995 ), abscisic acid (ALONSO et al. 1999 ), and auxin transport inhibitor screens (FUJITA and SYONO 1996 ). We found that ein2-1 is resistant to the inhibitory effects of IBA (Fig 1C) and 2,4-D on root elongation, but has responses similar to wild type when grown on IAA or NAA (data not shown). Similarly, the ethylene-resistant mutant etr1 mutant (BLEECKER et al. 1988 ; HUA and MEYEROWITZ 1998 ) also has an IBA-resistant root, but ctr1 (KIEBER et al. 1993 ), which has a constitutive ethylene response, has a wild-type reaction to IBA (data not shown).

New mutants with altered IBA responses:
We screened for IBA-resistant mutants as a first step in elucidating the molecular mechanisms of IBA function. On the basis of the observation that IBA inhibits primary root elongation in Arabidopsis (Fig 1A), we searched for plants that elongated roots when grown on inhibitory concentrations of IBA. A total of 36,000 EMS-mutagenized M₂ seeds and 15,000 T-DNA lines were examined on 20 µM IBA (see MATERIALS AND METHODS). Seeds from putative mutants were rescreened separately on IBA and IAA, and 14 IBA-resistant, IAA-sensitive mutants were retained for further analysis. Because the 3 mutants from the T-DNA lines are from independent pools and the 11 EMS-induced mutants come from 10 different M₂ pools, the mutants isolated represent at least 13 independent mutagenic events.

The root elongation phenotypes of these mutants on IBA and IAA are shown in Fig 2. The mutants show varying degrees of resistance to IBA, but all are sensitive to IAA. Whereas all of the mutants are significantly resistant to 5 µM IBA (Fig 2), assays at higher IBA concentrations indicate that none of the mutants are completely IBA insensitive (data not shown).

Peroxisomal function in IBA-response mutants:
IBA is thought to be converted to IAA in a process similar to fatty acid ß-oxidation (FAWCETT et al. 1960 ), which is peroxisomal in plants (reviewed in OLSEN 1998 ). We therefore expected that mutations disrupting peroxisome biogenesis or ß-oxidation could cause an IBA-resistant, IAA-sensitive phenotype. Because germinating Arabidopsis plants derive sugar from stored long-chain fatty acids until photosynthesis begins, the ability to germinate and develop on media lacking sugar reflects fatty acid ß-oxidation efficiency (HAYASHI et al. 1998B ). To determine if our IBA-resistant mutants could ß-oxidize fatty acids, we examined growth without exogenous sucrose. To eliminate complications from photosynthesis, we compared hypocotyl elongation of plants grown with and without sucrose after 5 or 8 days in the dark (Fig 3). Whereas all of the mutants developed normally with sucrose, some of the IBA-resistant mutants (B7, B11, B17, B29, B40, B44, and B52) failed to germinate or grew more slowly in the dark without exogenous sucrose. This suggests that these plants were unable to break down stored fatty acids and may have mutations in proteins acting in peroxisomal biogenesis or ß-oxidation. The remaining mutants did not require sucrose for growth in the dark, suggesting functional peroxisomes. These mutants may be specifically blocked in the conversion of IBA to IAA (and not fatty acid ß-oxidation) or may affect other aspects of IBA function.

To directly measure the rate of fatty acid ß-oxidation in the mutant plants, we examined the relative levels of a specific fatty acid during germination. Eicosenoic acid (20:1) is an abundant Arabidopsis seed storage lipid that is present only at low levels in other tissues (LEMIEUX et al. 1990 ), so its rate of decline during germination should reflect ß-oxidation of seed storage fatty acids. We extracted lipids from dry seeds and from 5-, 7-, and 10-day-old seedlings and measured 20:1 levels using GC (BROWSE et al. 1986 ). In dry seeds, all of the mutants had fatty acid profiles similar to wild-type plants (data not shown), with 15% of fatty acid present as eicosenoic acid. However, 5 and 7 days after germination, wild-type plants retained little eicosenoic acid (Table 2 and data not shown), indicating that they metabolized it efficiently. After 10 days, eicosenoic acid was virtually undetectable in the wild type (data not shown). In each putative ß-oxidation mutant, 20:1 levels decreased more slowly than in wild type (Table 2), indicating that these mutants did not utilize fatty acids as efficiently as wild-type plants. These mutants also grow more slowly than wild type even when the media is supplemented with 0.6% sucrose, as evidenced by the reduced fresh weight of some of the mutant seedlings used in the GC experiment (Table 2). We cannot conclude from this experiment whether the reduced rate of fatty acid ß-oxidation in these mutants reflects or causes the reduced growth rate. However, it is clear that a reduced ability to elongate hypocotyls in the dark in the absence of sucrose (Fig 3) correlates with reduced rates of fatty acid ß-oxidation (Table 2).

This pleiotropic group represents the first class of IBA-response mutants, which are likely to have a reduced conversion of IBA to IAA. These mutants may have defects in ß-oxidation enzymes or in proteins acting in peroxisomal biogenesis or maintenance. We have not yet named most of these mutants because the responsible genes have probably already been identified in Arabidopsis or other organisms. We have designated the mutants with apparently normal fatty acid ß-oxidation that we have shown by mapping or complementation to be unique ibr mutants.

Auxin phenotypes of IBA-response mutants:
IBA promotes lateral root initiation in Arabidopsis (Fig 1B). To assay this response in the mutants, we transferred 4-day-old seedlings to media containing 5 µM IBA or 20 nM IAA and grew them for 4 additional days (Fig 4). In wild-type plants, these concentrations give similar root elongation inhibition (Fig 1A), but IBA induces more lateral roots than IAA (Fig 1B). Many of the mutants, including all of the class 1 putative peroxisomal mutants, induce wild-type numbers of lateral roots on IAA, but not on IBA. Several of the nonperoxisomal IBA-response mutants also are resistant to the effects of IBA on lateral root initiation (ibr1, ibr2, and ibr3), and we designated these as class 2 mutants. In contrast, three of the mutants (ibr4, ibr5, and ibr6) induce lateral roots in response to both IBA and IAA similarly to wild-type plants, indicating that they are resistant to the effects of IBA on root elongation inhibition, but not on lateral root formation.

As shown in Fig 5, all of the IBA-response mutants also are resistant to the IBA analog 2,4-DB, which is ß-oxidized to the synthetic auxin 2,4-D in a mechanism similar to the IBA to IAA conversion (WAIN and WIGHTMAN 1954 ; HAYASHI et al. 1998B ). Whereas all of these mutants remain sensitive to IAA (Fig 2), two of the mutants, ibr5 and ibr6, are resistant to the inhibitory effects of the synthetic auxin 2,4-D on root elongation (Fig 5). Interestingly, ibr5 and ibr6 are two of the three mutants that remain sensitive to the promotion of lateral roots by IBA (Fig 4). We therefore divided the mutants that respond to IBA in the lateral root assay into two categories, class 3 mutants (ibr4), which are 2,4-D sensitive, and class 4 mutants (ibr5 and ibr6), which are 2,4-D resistant.

View larger version (39K): In this window In a new window Download PPT slide   Figure 5. Root elongation on 2,4-DB, 2,4-D, and NPA. Root elongation of plants grown on 2 µM 2,4-DB, 50 nM 2,4-D, or 3 µM NPA was measured as described in the legend to Fig 1A. Error bars indicate the standard deviations of the means (n 12).

Because two of the IBA response mutants are 2,4-D resistant and neither IBA (data not shown) nor 2,4-D (UTSUNO et al. 1998 ) appear to be substrates of the EIR1 efflux carrier, we tested the response of the IBA-resistant mutants to polar auxin transport inhibitors. Whereas most of the mutants have wild-type responses to these inhibitors, the class 4 (2,4-D resistant) mutants are resistant to the auxin transport inhibitors 1-napthylphthalamic acid (NPA; Fig 5), 9-hydroxyfluorene-9-carboxylic acid (HFCA; data not shown), and 2,3,5-triiodobenzoic acid (TIBA; data not shown). Therefore, these mutants may be defective in IBA transport. In contrast to the aux1 and eir1 mutants, which are defective in IAA transport (reviewed in ESTELLE 1998 ), the class 4 mutants respond similarly to wild type when grown on the ethylene precursor 1-aminocyclopropane-1-carboxylic acid either in the light or in the dark (data not shown).

Mapping IBA-response mutant loci:
We used recombination mapping with PCR-based markers to localize 11 of the IBA-response mutants to nine chromosomal positions, which are shown in Fig 6. The ibr1-1 and ibr1-2 mutants are allelic; they map to the same interval on the top of chromosome 4 and do not complement each other. B17 and B52 also are allelic and map to the same interval on the bottom of chromosome 5. Although we have not mapped ibr2, it complements all of the other class 2 mutants (data not shown) and therefore is likely to represent a novel locus.

View larger version (17K): In this window In a new window Download PPT slide   Figure 6. Map positions of IBA-resistant mutants. Approximate map positions (in centimorgans) of molecular markers, aim1 (RICHMOND and BLEECKER 1999 ) and ped (HAYASHI et al. 1998B ) peroxisomal defective mutants, and the rib1 IBA-resistant mutant (POUPART and WADDELL 2000 ) are shown to the right of each chromosome. The interval to which each IBA mutant maps is shown to the left of the chromosomes. B11 maps to chromosome 1 north of nF19P19 (http://genome.bio.upenn.edu/SSLP_info/SSLP.html) and ibr4 maps between nF19P19 and nga63 (BELL and ECKER 1994 ), with 4/202 and 6/202 recombinants, respectively. ibr5 maps between AIR3 (SILVERSTONE et al. 1998 ) and F5G3 (LIN et al. 1999 ) with 15/742 and 11/744 recombinants, respectively. ibr3 is located between GAPC (KONIECZNY and AUSUBEL 1993 ) and MFP2 (RICHMOND and BLEECKER 1999 ) with 18/300 and 1/304 recombinants. ibr6 maps south of BGL1 (KONIECZNY and AUSUBEL 1993 ) with 2/62 north recombinants. ibr1 maps near the middle of chromosome 4. ibr1-1 has 2/184 north recombinants at GA1 (KONIECZNY and AUSUBEL 1993 ) and 31/176 south recombinants at mi167 (THOMPSON et al. 1996 ), whereas ibr1-2 has 12/232 recombinants at GA1 and 19/198 recombinants at mi167. B29 has 6/250 recombinants at NIT4 (BARTEL and FINK 1994 ) and 0/250 recombinants at nga139 (BELL and ECKER 1994 ). B17 and B52, which are allelic, map to chromosome 5 south of ped2 (HAYASHI et al. 1998B ), and B44 (pex5) maps just north of LFY (Fig 7).

None of the mapped mutants occupy positions of the previously isolated peroxisome-defective ped or aim1 mutants (HAYASHI et al. 1998B ; RICHMOND and BLEECKER 1999 ). In addition, the auxin-transport inhibitor resistant ibr5 mutant maps to an interval on chromosome 2 that does not contain any of the previously characterized tir (transport inhibitor response) mutants (RUEGGER et al. 1997 ). Although ibr6 maps to the same region on chromosome 3 as tir1, it is unlikely to be allelic because tir1, unlike ibr6, is resistant to the inhibitory effects of IAA (RUEGGER et al. 1998 ).

A mutant gene encoding the PEX5 peroxisome receptor protein:
We mapped the class 1 B44 mutant to an 200-kbp region on the bottom of chromosome 5 (Fig 7) between MDA7 (KANEKO et al. 1998 ) and ILL2 (DAVIES et al. 1999 ). The Kazusa DNA Research Institute (www.kazusa.or.jp/arabi/) sequenced this region as a part of the Arabidopsis Genome Initiative. Because the B44 mutant appears to have peroxisomal defects (Fig 3; Table 2), we scanned the sequence in this interval for candidate genes that might be involved in peroxisomal biogenesis or function and found that the PEX5 gene (BRICKNER et al. 1998 ), which encodes the PTS1 peroxisomal receptor, was located on the P1 clone MCD7 (SATO et al. 1998 ). To determine whether the B44 mutant had a mutation in PEX5, we amplified and sequenced this gene from B44 mutant DNA (see MATERIALS AND METHODS). Sequencing identified a C-to-T base change at position 2910 (where the A of the ATG is at position 1), which causes a Ser-to-Leu missense mutation. Fig 8 shows an alignment of Arabidopsis PEX5 and homologs from several other organisms and indicates the position of the mutation. Because this base-pair change destroys an EcoRI site in the mutant, we confirmed the mutation by amplifying and digesting the relevant region from wild-type and mutant genomic DNA. On the basis of this data, we named B44 pex5-1.

View larger version (26K): In this window In a new window Download PPT slide   Figure 7. Positional cloning of PEX5. (A) Recombination mapping with PCR-based markers nga129 (BELL and ECKER 1994 ), ILL2 and ILL3 (DAVIES et al. 1999 ), PDC2 (Table 2), MDA7 (Table 2), and LFY (KONIECZNY and AUSUBEL 1993 ) localized B44 between MDA7 and ILL2 with one north and six south recombinants. Examination of the sequenced P1 clones in this region (thin lines) revealed the PEX5 gene on MCD7. This gene has a C-to-T mutation at position 2910 in the pex5-1 mutant that destroys an EcoRI site. The first G of the sequence shown is the final residue of intron 6. (B and C) 35S-PEX5 rescues pex5 mutant phenotypes. Seeds from wild-type (Col-0), pex5-1, and pex5-1 plants transformed with a 35S-PEX5 construct were analyzed for root elongation on 5 µM IBA (B), as described in the legend to Fig 2, or for lateral root induction by 5 µM IBA (C), as described in the legend to Fig 4. Error bars indicate the standard deviations of the means (n 12). The pex5-1 (35S-PEX5) line shown is the progeny of a line hemizygous for the transgene and therefore includes 25% untransformed plants.

View larger version (118K): In this window In a new window Download PPT slide   Figure 8. Alignment of PEX5 from Arabidopsis with several homologs. Sequences were aligned with the MegAlign program (DNAStar, Madison, WI) using the Clustal method. Proteins shown are from Arabidopsis (BRICKNER et al. 1998 ), tobacco (KRAGLER et al. 1998 ), mouse (BAES et al. 1997 ), and yeast (VAN DER LEIJ et al. 1993 ). Amino acid residues identical in at least two of the sequences are in black boxes and hyphens indicate gaps introduced to maximize alignment. The site of the pex5-1 mutation is indicated above the alignment. Pentapeptide repeat regions with the consensus sequence WXXX[F/Y] are indicated by open rectangles above the sequence. Solid lines indicate the seven TPR motifs, thought to act in binding the "SKL" targeting signal of PTS1 proteins (BROCARD et al. 1994 ; BRICKNER et al. 1998 ).

To confirm that the base change found in the pex5-1 mutant causes the IBA-resistant phenotype, we tested a PEX5 cDNA driven by the CaMV 35S promoter for complementation of the mutant phenotype (see MATERIALS AND METHODS). This clone restored wild-type IBA sensitivity to the pex5-1 mutant in root elongation inhibition (Fig 7B) and lateral root initiation (Fig 7C) and also restored the ability of pex5-1 hypocotyls to elongate in the dark without sucrose (data not shown), confirming that we have identified the gene responsible for the mutant phenotype. Because PEX5 acts to import most ß-oxidation enzymes (DE HOOP and AB 1992 ), our finding that a mutation in this gene leads to IBA resistance implies that IBA acts via its conversion to IAA in Arabidopsis.

	DISCUSSION

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Auxin activity of IBA:
IBA is an endogenous auxin in Arabidopsis (LUDWIG-MULLER et al. 1993 ) and numerous other plants, including maize (LUDWIG-MULLER and EPSTEIN 1991 ), tobacco (SUTTER and COHEN 1992 ), and apple (VAN DER KRIEKEN et al. 1992 ). IBA is used widely to induce rooting of vegetative cuttings (HARTMANN et al. 1990 ; DE KLERK et al. 1999 ). However, little is known regarding how IBA functions in vivo. Radiolabeling experiments have been conducted in several plant species to examine whether IBA functions via its conversion to IAA or if it acts on its own. However, the results are conflicting and do not exclude the possibility that both mechanisms are important in vivo.

We have confirmed that IBA acts as an auxin in A. thaliana, inhibiting root elongation (Fig 1A) and promoting lateral root formation (Fig 1B) in wild-type plants. At the high concentrations of IAA necessary for lateral root initiation, root elongation is severely inhibited (Fig 1). In contrast, IBA initiates lateral roots at a concentration where elongation is less inhibited (Fig 1). The aux1 mutant (PICKETT et al. 1990 ) is resistant to the inhibitory effects of IBA on root elongation (Fig 2), suggesting that IBA enters cells through the AUX1 influx carrier, which also imports IAA and 2,4-D, but not NAA (YAMAMOTO and YAMAMOTO 1998 ; MARCHANT et al. 1999 ).

Four classes of IBA-response mutants:
We have begun isolating and characterizing IBA-resistant mutants, anticipating that analysis of the defective genes will clarify whether IBA acts solely via its conversion to IAA or if it also functions directly as an auxin. Whereas all of the mutants are significantly resistant to the inhibitory effects of IBA on root elongation, they all remain sensitive to the more abundant auxin, IAA. Three of the mutants, B40, ibr3, and ibr4, appear in Fig 2 to be more sensitive than wild type to IAA. It will be interesting to determine whether this difference persists as these lines are backcrossed to remove unlinked mutations.

These IBA-response mutants fall into four classes. The class 1 mutants (pex5-1, B7, B11, B17/B52, B29, and B40) appear to be defective in fatty acid ß-oxidation. These mutants are resistant to both the inhibitory effects of IBA on root elongation (Fig 2) and the stimulatory effects of IBA on lateral root induction (Fig 4). Two assays reveal defects in utilization of seed storage lipids: an indirect assay monitoring hypocotyl elongation of dark-grown plants without exogenous sugar (Fig 3) and a direct GC-based assay monitoring eicosenoic acid decline during germination (Table 2). We suggest that these mutants are defective in the conversion of IBA to IAA, which is, therefore, an important component of the auxin activity of IBA in Arabidopsis.

The other IBA-response mutants utilize stored fatty acids during germination normally (Fig 3, Table 2). Because these mutants are generally as resistant to IBA as the putative peroxisomal mutants (Fig 2), we do not believe that they are simply extremely leaky peroxisomal mutants. These nonperoxisomal mutants can be further subdivided into three classes. The class 2 mutants (ibr1-1, ibr1-2, ibr2, and ibr3) are resistant to the auxin effects of IBA on both root elongation and lateral root proliferation, but have wild-type responses to other auxins (IAA and 2,4-D) and auxin transport inhibitors (NPA, TIBA, and HFCA). The class 2 mutants could be defective in enzymes that convert IBA to IAA but are not necessary for the ß-oxidation of seed storage lipids. Alternatively, these mutants may be defective in an IBA receptor, signaling pathway, or response factor. If these mutants have normal IBA to IAA conversion, it will suggest that IBA plays at least two roles in the promotion of lateral roots, one dependent on (disrupted in the class 1 mutants) and one independent of (disrupted in the class 2 mutants) its role as an IAA precursor. Identification and analysis of the genes defective in the IBA-resistant mutants with apparently normal peroxisomal function will enable us to determine whether IBA has a role independent of its conversion to IAA.

In contrast to the class 1 and 2 mutants, several nonperoxisomal mutants (ibr4, ibr5, and ibr6) still initiate lateral roots in response to IBA. Interestingly, several mutants isolated on the basis of resistance to the inhibitory effects of other auxins (IAA and 2,4-D) on root elongation have a similar phenotype. For example, the aux1 mutant (PICKETT et al. 1990 ) remains sensitive to the promotion of lateral roots by IAA and IBA (Fig 4). Currently, the single representative of class 3 is the ibr4 mutant, which has wild-type sensitivity to auxin transport inhibitors and synthetic auxins. This is an interesting class, as it separates two of the effects (inhibition of root elongation and initiation of lateral roots) of IBA on roots.

We also isolated two IBA-resistant mutants (class 4, ibr5 and ibr6) that are resistant to the synthetic auxin 2,4-D and the auxin transport inhibitors NPA, TIBA, and HFCA (Fig 5 and data not shown). Auxin transport inhibitors block the action of the auxin efflux carrier (LOMAX et al. 1995 ; BENNETT et al. 1998 ). Root bending experiments (not shown) suggest that IBA is not a substrate of the EIR1 efflux carrier, which exports IAA and NAA but not 2,4-D (UTSUNO et al. 1998 ). The observation that class 4 mutants are resistant to both 2,4-DB and 2,4-D indicates that the mechanism of IBA resistance in this class does not involve IBA to IAA conversion. The resistance to auxin transport inhibitors suggests that these two mutants may define components specific to IBA transport. Several Arabidopsis tir mutants have been described that are thought to be defective in auxin transport (RUEGGER et al. 1997 ). Although the response of the tir mutants to IBA has not been reported, none map to the position of the ibr5 mutant and only tir1, which is resistant to IAA, maps in the region of ibr6 (RUEGGER et al. 1998 ).

The rib1 mutant (POUPART and WADDELL 2000 ) has a similar phenotype to the class 4 ibr mutants (resistant to IBA, 2,4-D, and auxin transport inhibitors; sensitive to IAA) and also may function in IBA transport. Because the map positions of rib1, ibr5, and ibr6 are distinct (Fig 6), several specific components and regulatory proteins may be required to export IBA from plant cells, analogous to IAA and NAA efflux (LOMAX et al. 1995 ; BENNETT et al. 1998 ). One component involved in IBA efflux may be an uncharacterized member of the EIR1/AGR1/PIN gene family (CHEN et al. 1998 ; LUSCHNIG et al. 1998 ; MULLER et al. 1998 ; UTSUNO et al. 1998 ). It is also possible that the auxin transport inhibitor resistance observed in the class 4 mutants is an indirect effect not related to IBA transport.

IBA and ethylene:
Although we have not yet isolated new alleles of known ethylene-resistant mutants (JOHNSON and ECKER 1998 ), these mutants share several phenotypes with class 4 IBA-response mutants, suggesting that IBA may interact with ethylene in the inhibition of root elongation. Whereas our class 4 mutants are not ethylene resistant in either roots or hypocotyls, the ein2-1 and etr1-1 mutants, like ibr5 and ibr6, are resistant to the inhibitory effects of IBA (Fig 1C and data not shown), 2,4-D (data not shown), and auxin transport inhibitors (FUJITA and SYONO 1996 ; data not shown) on root elongation. Like the class 4 mutants, ein2-1 remains sensitive to IAA and to the stimulatory effects of IBA on lateral root formation (data not shown). In contrast, the ethylene-insensitive Never-ripe tomato mutant is resistant to both the stimulatory effects of IBA on adventitious root formation and the inhibitory effects of IBA on root elongation (CLARK et al. 1999 ), indicating that the precise relationship between ethylene and IBA may vary among species.

Numerous examples of interactions between auxin and ethylene signaling have been reported. Many Arabidopsis auxin-resistant mutants also have ethylene-resistant roots, including aux1 (PICKETT et al. 1990 ), axr1 (ESTELLE and SOMERVILLE 1987 ; LEYSER et al. 1993 ), axr2 (TIMPTE et al. 1994 ), and axr3 (LEYSER et al. 1996 ; ROUSE et al. 1998 ). Expression of the ACC synthase 4 (ACS4) gene involved in ethylene biosynthesis is rapidly induced by IAA (NAKAGAWA et al. 1991 ; ABEL et al. 1995 ) and IAA treatment increases ethylene levels in cotton (MORGAN and HALL 1962 ). Certain auxin responses are thought to be mediated through these increases in ethylene, such as hypocotyl elongation in the light under nutrient limitation (SMALLE et al. 1997 ). Our results suggest that ethylene responses previously ascribed to auxin may be differentially affected by the endogenous auxins IBA and IAA. Further analysis of IBA response mutants may allow a dissection of the contributions of IAA and IBA to ethylene responses.

A mutant PEX5:
The pex5-1 mutant is a member of the class 1 IBA-response mutants that are also defective in seed storage lipid utilization (Fig 3, Table 2). To our knowledge, this is the first plant peroxisomal import receptor mutant isolated, and it will be a valuable tool in the molecular dissection of peroxisome biogenesis in plants. The PEX5 protein has several domains, including C-terminal tetratricopeptide repeats (TPR) motifs (Fig 8), which act in binding the C-terminal "SKL" targeting signal of the PTS1 proteins (BROCARD et al. 1994 ; BRICKNER et al. 1998 ). In addition, PEX5 contains 10 pentapeptide repeats (Fig 8), which also have been identified in the tobacco (KRAGLER et al. 1998 ) and watermelon proteins (WIMMER et al. 1998 ) and to a lesser extent in the human (seven copies; SCHLIEBS et al. 1999 ) and yeast (one to three copies) proteins. The function of these repeats has not been determined, although it has been suggested that they may be a part of amphipathic -helices that bind to peroxisomal membrane proteins necessary for protein import (SCHLIEBS et al. 1999 ). PEX13 is a peroxisomal integral membrane protein that binds PEX5 via an SH3 domain and is required for PTS1 protein import (URQUHART et al. 2000 ). Deletion analysis of the Pichia pastoris PEX5 protein indicates that a 114-amino-acid region (Trp100 to Glu213), which includes the pentapeptide repeats, is necessary for PEX13 binding (URQUHART et al. 2000 ). This N-terminal region of PEX5 also has been suggested to bind PEX14, a second integral membrane protein required in peroxisomal import (SCHLIEBS et al. 1999 ). The pex5-1 mutation alters a conserved Ser residue in the midst of the pentapeptide repeat region but upstream of the TPR domains, suggesting that it may disrupt some aspect of PEX5 function other than substrate binding, such as interaction with these or other peroxisomal membrane proteins (SCHLIEBS et al. 1999 ).

The pex5 mutant has a long root on inhibitory concentrations of IBA, implicating the PEX5 protein in IBA to IAA conversion. Because the majority of peroxisomal matrix proteins contain PTS1 signals and require PEX5 for import, it is likely that the role of PEX5 in the conversion of IBA to IAA is to ensure that the enzymes necessary for the conversion are efficiently imported into the peroxisomes. In the pex5 mutant, IBA is probably converted to IAA at a much slower rate, due to the decreased import of required enzymes.

The pex5 mutant defect suggests that the conversion of IBA to IAA is important for IBA function. In further support of this hypothesis, we found that two previously isolated and molecularly characterized fatty acid ß-oxidation defective mutants, aim1 (RICHMOND and BLEECKER 1999 ) and ped1 (HAYASHI et al. 1998B ), also are IBA-resistant class 1 mutants (Fig 1C and data not shown). Interestingly, AIM1 has a C-terminal PTS1 signal for peroxisomal import, indicating that it is among the proteins imported by PEX5 that act in IBA to IAA conversion (in addition to fatty acid ß-oxidation).

Many genes can mutate to give IBA resistance:
Our screen to identify IBA-resistant, IAA-sensitive mutants has been fruitful. Fourteen confirmed mutants have been identified, which comprise at least nine unique loci. The fact that we have not yet obtained more than two alleles of any gene indicates that defects in a large number of genes can lead to IBA resistance. In theory, this could include any proteins acting in IBA recognition, signal transduction, response, or transport. Because IBA acts, at least in part, via its conversion to IAA, other genes that may cause this phenotype if defective would include enzymes acting in ß-oxidation and peroxisome biogenesis or maintenance. Multiple isozymes have been identified for each step of plant fatty acid ß-oxidation, which may reflect chain-length specificity (KIRSCH et al. 1986 ; HOOKS et al. 1996 ; HAYASHI et al. 1998A , HAYASHI et al. 1999 ) or differences in expression. A potential pathway for the ß-oxidation of IBA to IAA is proposed in Fig 9, which indicates the proteins likely to be involved in this conversion. Mutant genes in any of these steps could cause an IBA-resistant, IAA-sensitive phenotype. For example, the aim1 (RICHMOND and BLEECKER 1999 ) and ped1 (HAYASHI et al. 1998B ) mutants would act in the conversion of IBA to IAA at steps 3/4 and 5, respectively (Fig 9).

View larger version (14K): In this window In a new window Download PPT slide   Figure 9. A possible mechanism for the conversion of IBA to IAA in the peroxisome. Mutants in various steps of the pathway are indicated in parentheses. The ped1 (HAYASHI et al. 1998B ) and aim1 (RICHMOND and BLEECKER 1999 ) mutants are defective at the corresponding steps in fatty acid ß-oxidation, and their resistance to IBA suggests that they act in this pathway as well.

Defects in proteins acting in peroxisome biogenesis (reviewed in OLSEN 1998 ) should also result in an IBA-resistant and IAA-sensitive phenotype. Whereas at least 19 peroxins (encoded by PEX genes) are involved in yeast peroxisomal biogenesis (reviewed in ELGERSMA and TABAK 1996 ; ERDMANN and KUNAU 1992 ; KUNAU 1998 ), few plant PEX genes have been characterized to date. The genome sequencing project and other directed efforts will undoubtedly reveal Arabidopsis homologs of many of these genes. IBA-resistance screens may represent an effective and nonbiased method to isolate plant pex mutants, which will be important in elucidating peroxisome function in plants.

In summary, analysis of IBA-resistant, IAA-sensitive mutants has revealed four phenotypic classes. Class 1 mutants are defective in peroxisomal ß-oxidation, suggesting that at least part of IBA function is as an IAA precursor in Arabidopsis. Class 2 and 3 mutants may have defects in IBA-specific signaling or response factors, whereas the class 4 mutants may have compromised IBA transport. Continued molecular dissection of these IBA-response mutants, as well as the responses of other plant hormone mutants to IBA, may allow a better understanding of the mechanisms of IBA function in Arabidopsis and of how these two endogenous auxins interact.

	FOOTNOTES

¹ Present Address: The Land Institute, 2440 E. Water Well Rd., Salina, KS 67401.

	ACKNOWLEDGMENTS

We are grateful to Mark Estelle for axr and aux1 seeds, Todd Richmond for aim1 and ped1 seeds, Melanie Monroe-Augustus for assistance in mapping ibr5, Luise Rogg for analysis of axr mutants on IBA, Sue Gibson for suggesting GC analysis of eicosenoic acid, Seiichi Matsuda for use of the GC, Sherry LeClere for the 35SpBARN vector, and the Arabidopsis Biological Resource Center at Ohio State University for eir1, ein2, and etr1 mutants and T-DNA lines. We thank Tony Bleeker, Todd Richmond, and Candace Waddell for sharing data before publication, and Jamie Lasswell, Sherry LeClere, Mónica Magidin, Seiichi Matsuda, and Luise Rogg for critical comments on the manuscript. This research was supported by the National Science Foundation (IBN-9982611), the Robert A. Welch Foundation (C-1309), and Rice University start-up funds.

Manuscript received May 4, 2000; Accepted for publication June 27, 2000.

	LITERATURE CITED

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

ABEL, S., M. D. NGUYEN, W. CHOW, and A. THEOLOGIS, 1995  ACS4, a primary indoleacetic acid-responsive gene encoding 1-aminocyclopropane-1-carboxylate synthase in Arabidopsis thaliana.. J. Biol. Chem. 270:19093-19099[Abstract/Free Full Text].

ALONSO, J. M., T. HIRAYAMA, G. ROMAN, S. NOURIZADEH, and J. R. ECKER, 1999  EIN2, a bifunctional transducer of ethylene and stress responses in Arabidopsis.. Science 284:2148-2152[Abstract/Free Full Text].

AUSUBEL, F. M., R. BRENT, R. E. KINGSTON, D. D. MOORE, J. G. SEIDMAN et al., 1999 Current Protocols in Molecular Biology. Greene Publishing Associates and Wiley-Interscience, New York.

BAES, M., P. GRESSENS, E. BAUMGART, P. CARMELIET, and M. CASTEELS et al., 1997  A mouse model for Zellweger syndrome. Nat. Genet. 17:49-57[Medline].

BARALDI, R., G. BERTAZZA, S. PREDIERI, A. M. BREGOLI, and J. D. COHEN, 1993  Uptake and metabolism of indole-3-butyric acid during the in vitro rooting phase in pear cultivars (Pyrus communis). Acta Hort. 329:289-291.

BARTEL, B., 1997  Auxin biosynthesis. Annu. Rev. Plant Physiol. Plant Mol. Biol. 48:51-66.

BARTEL, B. and G. R. FINK, 1994  Differential regulation of an auxin-producing nitrilase gene family in Arabidopsis thaliana.. Proc. Natl. Acad. Sci. USA 91:6649-6653[Abstract/Free Full Text].

BELL, C. J. and J. R. ECKER, 1994  Assignment of 30 microsatellite loci to the linkage map of Arabidopsis.. Genomics 19:137-144[Medline].

BENNETT, M. J., A. MARCHANT, H. G. GREEN, S. T. MAY, and S. P. WARD et al., 1996  Arabidopsis AUX1 gene: a permease-like regulator of root gravitropism. Science 273:948-950[Abstract].

BENNETT, M. J., A. MARCHANT, S. T. MAY, and R. SWARUP, 1998  Going the distance with auxin: unravelling the molecular basis of auxin transport. Phil. Trans. R. Soc. London B 353:1511-1515[Abstract/Free Full Text].

BLEECKER, A. B., M. A. ESTELLE, C. SOMERVILLE, and H. KENDE, 1988  Insensitivity to ethylene conferred by a dominant mutation in Arabidopsis thaliana.. Science 241:1086-1089[Abstract/Free Full Text].

BRICKNER, D. G., J. H. BRICKNER, and L. J. OLSEN, 1998  Sequence analysis of a cDNA encoding Pex5p, a peroxisomal targeting signal type 1 receptor from Arabidopsis thaliana.. Plant Physiol. 118:330.

BROCARD, C., F. KRAGLER, M. M. SIMON, T. SCHUSTER, and A. HARTIG, 1994  The tetratricopeptide repeat-domain of the PAS10 protein of Saccharomyces cerevisiae is essential for binding the peroxisomal targeting signal -SKL. Biochem. Biophys. Res. Comm. 204:1016-1022[Medline].

BROWSE, J., P. J. MCCOURT, and C. R. SOMERVILLE, 1986  Fatty acid composition of leaf lipids determined after combined digestion and fatty acid methyl ester formation from fresh tissue. Anal. Biochem. 152:141-145[Medline].

CAMPISI, L., Y. YANG, Y. YI, E. HEILIG, and B. HERMAN et al., 1999  Generation of enhancer trap lines in Arabidopsis and characterization of expression patterns in the inflorescence. Plant J. 17:699-707[Medline].

CARY, A. J., W. LIU, and S. H. HOWELL, 1995  Cytokinin action is coupled to ethylene in its effects on the inhibition of root and hypocotyl elongation in Arabidopsis thaliana seedlings. Plant Physiol. 107:1075-1082[Abstract].

CELENZA, J. L., P. L. GRISAFI, and G. R. FINK, 1995  A pathway for lateral root formation in Arabidopsis thaliana.. Genes Dev. 9:2131-2142[Abstract/Free Full Text].

CHAUDHURY, A. M. and E. R. SIGNER, 1989  Non-destructive transformation of Arabidopsis.. Plant Mol. Biol. Rep. 7:258-265.

CHEN, R., P. HILSON, J. SEDBROOK, E. ROSEN, and T. CASPAR et al., 1998  The Arabidopsis thaliana AGRAVITROPIC 1 gene encodes a component of the polar-auxin-transport efflux carrier. Proc. Natl. Acad. Sci. USA 95:15112-15117[Abstract/Free Full Text].

CLARK, D. G., E. K. GUBRIUM, J. E. BARRETT, T. A. NELL, and H. J. KLEE, 1999  Root formation in ethylene-insensitive plants. Plant Physiol. 121:53-60[Abstract/Free Full Text].

CLOUGH, S. J. and A. F. BENT, 1998  Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana.. Plant J. 16:735-743[Medline].

DAVIES, P. J., 1995 The plant hormones: their nature, occurrence, and functions, pp. 1–5 in Plant Hormones: Physiology, Biochemistry, and Molecular Biology, edited by P. J. DAVIES. Kluwer Academic Publishers, Dordrecht, The Netherlands.

DAVIES, R. T., D. H. GOETZ, J. LASSWELL, M. N. ANDERSON, and B. BARTEL, 1999  IAR3 encodes an auxin conjugate hydrolase from Arabidopsis. Plant Cell 11:365-376[Abstract/Free Full Text].

DE HOOP, M. J. and G. AB, 1992  Import of proteins into peroxisomes and other microbodies. Biochem. J. 286:657-669.

DE KLERK, G.-J., W. V. D. KRIEKEN, and J. C. D. JONG, 1999  The formation of adventitious roots: new concepts, new possibilities. In Vitro Cell. Dev. Biol.-Plant 35:189-199.

ELGERSMA, Y. and H. F. TABAK, 1996  Proteins involved in peroxisome biogenesis and functioning. Biochim. Biophys. Acta 1286:269-283[Medline].

EPSTEIN, E. and S. LAVEE, 1984  Conversion of indole-3-butyric acid to indole-3-acetic acid by cuttings of grapevine (Vitus vinifera) and olive (Olea europa). Plant Cell Physiol. 25:697-703[Abstract/Free Full Text].

EPSTEIN, E. and J. LUDWIG-MÜLLER, 1993  Indole-3-butyric acid in plants: occurrence, synthesis, metabolism, and transport. Physiol. Plant 88:382-389.

EPSTEIN, E., S. J. NISSEN, and E. G. SUTTER, 1991  Indole-3-acetic acid and indole-3-butyric acid in tissues in carrot inoculated with Agrobacterium rhizogenes.. J. Plant Growth Reg. 10:97-100.

ERDMANN, R. and W.-H. KUNAU, 1992  A genetic approach to the biogenesis of peroxisomes in the yeast Saccharomyces cerevisiae.. Cell Biochem. Funct. 10:167-174[Medline].

ESTELLE, M., 1998  Polar auxin transport: new support for an old model. Plant Cell 10:1775-1778[Abstract/Free Full Text].

ESTELLE, M. A. and C. SOMERVILLE, 1987  Auxin-resistant mutants of Arabidopsis thaliana with an altered morphology. Mol. Gen. Genet. 206:200-206.

FAWCETT, C. H., R. L. WAIN, and F. WIGHTMAN, 1960  The metabolism of 3-indolylalkanecarboxylic acids, and their amides, nitriles and methyl esters in plant tissues. Proc. R. Soc. Lond. Ser. B 152:231-254[Medline].

FELDMANN, K. A., 1991  T-DNA insertion mutagenesis in Arabidopsis: mutational spectrum. Plant J. 1:71-82.

FUJITA, H., and K. SYONO, 1996 Genetic analysis of the effects of polar auxin transport inhibitors on root growth in Arabidopsis thaliana. Plant Cell Physiol. 1996: 1094–1101.

GERHARDT, B., 1992  Fatty acid degradation in plants. Prog. Lipid Res. 31:417-446[Medline].

GOULD, S. J., G.-A. KELLER, N. HOSKEN, J. WILKINSON, and S. SUBRAMANI, 1989  A conserved tripeptide sorts proteins to peroxisomes. J. Cell Biol. 108:1657-1664[Abstract/Free Full Text].

GUZMÁN, P. and J. R. ECKER, 1990  Exploiting the triple response of Arabidopsis to identify ethylene-related mutants. Plant Cell 2:513-523[Abstract/Free Full Text].

HANGARTER, R. P. and N. E. GOOD, 1981  Evidence that IAA conjugates are slow-release sources of IAA in plant tissues. Plant Physiol. 68:1424-1427[Abstract/Free Full Text].

HARTMANN, H. T., D. E. KESTER and F. T. DAVIES, 1990 Plant Propagation: Principles and Practices, pp. 199–245. Prentice-Hall, Englewood Cliffs, NJ.

HAUGHN, G. W. and C. SOMERVILLE, 1986  Sulfonylurea-resistant mutants of Arabidopsis thaliana.. Mol. Gen. Genet. 204:430-434.

HAYASHI, H., L. DE BELLIS, K. YAMAGUCHI, A. KATO, and M. HAYASHI et al., 1998a  Molecular characterization of a glyoxysomal long chain acyl-CoA oxidase that is synthesized as a precursor of higher molecular mass in pumpkin. J. Biol. Chem. 273:8301-8307[Abstract/Free Full Text].

HAYASHI, M., K. TORIYAMA, M. KONDO, and M. NISHIMURA, 1998b  2,4-Dichlorophenoxybutyric acid-resistant mutants of Arabidopsis have defects in glyoxysomal fatty acid ß-oxidation. Plant Cell 10:183-195[Abstract/Free Full Text].

HAYASHI, H., L. DE BELLIS, A. CIURLI, M. KONDO, and M. HAYASHI et al., 1999  A novel acyl-CoA oxidase that can oxidize short-chain acyl-CoA in plant peroxisomes. J. Biol. Chem. 274:12715-12721[Abstract/Free Full Text].

HOOKS, M. A., K. BODE, and I. COUÉE, 1996  Higher-plant medium- and short-chain acyl-CoA oxidases: identification, purification and characterization of two novel enzymes of eukaryotic peroxisomal beta-oxidation. Biochem J. 320:607-614.

HUA, J. and E. M. MEYEROWITZ, 1998  Ethylene responses are negatively regulated by a receptor gene family in Arabidopsis thaliana.. Cell 94:261-271[Medline].

JOHNSON, P. R. and J. R. ECKER, 1998  The ethylene gas signal transduction pathway: a molecular perspective. Annu. Rev. Genet. 32:227-254[Medline].

KANEKO, T., H. KOTANI, Y. NAKAMURA, S. SATO, and E. ASAMIZU et al., 1998  Structural analysis of Arabidopsis thaliana chromosome 5. V. Sequence features of the regions of 1,381,565 bp covered by 21 physically assigned P1 and TAC clones. DNA Res. 5:131-145[Abstract].

KIEBER, J. J., M. ROTHENBERG, G. ROMAN, K. A. FELDMANN, and J. R. ECKER, 1993  CTR1, a negative regulator of the ethylene response pathway in Arabidopsis, encodes a member of the Raf family of protein kinases. Cell 72:427-441[Medline].

KINDL, H., 1993  Fatty acid degradation in plant peroxisomes: function and biosynthesis of the enzymes involved. Biochemie 75:225-230[Medline].

KING, J. J. and D. P. STIMART, 1998  Genetic analysis of variation for auxin-induced adventitious root formation among eighteen ecotypes of Arabidopsis thaliana L. Heynh. J. Heredity 89:481-487.

KIRSCH, T., H. G. LOFFLER, and H. KINDL, 1986  Plant acyl-CoA oxidase: purification, characterization, and monomeric apoprotein. J. Biol. Chem. 261:8570-8575[Abstract/Free Full Text].

KONCZ, C. and J. SCHELL, 1986  The promoter of the T_L-DNA gene 5 controls the tissue-specific expression of chimaeric genes carried by a novel type of Agrobacterium binary vector. Mol. Gen. Genet. 204:383-396.

KONIECZNY, A. and F. M. AUSUBEL, 1993  A procedure for mapping Arabidopsis mutations using co-dominant ecotype-specific PCR-based markers. Plant J. 4:403-410[Medline].

KOORNNEEF, M., C. ALONSO-BLANCO and P. STAM, 1998 Genetic analysis, pp. 105–117 in Methods in Molecular Biology: Arabidopsis protocols, edited by J. M. MARTINEZ-ZAPATER and J. SALINAS. Humana Press, Totowa, NJ.

KRAGLER, F., G. LAMETSCHWANDTNER, J. CHRISTMANN, A. HARTIG, and J. J. HARADA, 1998  Identification and analysis of the plant peroxisomal targeting signal 1 receptor NtPEX5. Proc. Natl. Acad. Sci. USA 95:13336-13341[Abstract/Free Full Text].

KUNAU, W.-H., 1998  Peroxisome biogenesis: from yeast to man. Curr. Opin. Microbiol. 1:232-237[Medline].

LAST, R. L. and G. R. FINK, 1988  Tryptophan-requiring mutants of the plant Arabidopsis thaliana.. Science 240:305-310[Abstract/Free Full Text].

LEMIEUX, B., M. MIQUEL, C. SOMERVILLE, and J. BROWSE, 1990  Mutants of Arabidopsis with alterations in seed lipid fatty acid composition. Theor. Appl. Genet. 80:234-240.

LEYSER, H. M. O., C. LINCOLN, C. TIMPTE, D. LAMMER, and J. TURNER et al., 1993  Arabidopsis auxin-resistance gene AXR1 encodes a protein related to ubiquitin-activating enzyme E1. Nature 364:161-164[Medline].

LEYSER, H. M. O., F. B. PICKETT, S. DHARMASIRI, and M. ESTELLE, 1996  Mutations in the AXR3 gene of Arabidopsis result in altered auxin response including ectopic expression from the SAUR-AC1 promoter. Plant J. 10:403-413[Medline].

LIN, X., S. KAUL, S. D. ROUNSLEY, T. P. SHEA, and M.-I. BENITO et al., 1999  Sequence and analysis of chromosome 2 of the plant Arabidopsis thaliana. Nature 402:761-768[Medline].

LOMAX, T. L., G. K. MUDAY and P. H. RUBERY, 1995 Auxin transport, pp. 509–530 in Plant Hormones, edited by P. J. DAVIES. Kluwer, Dordrecht, The Netherlands.

LUDWIG-MÜLLER, J. and E. EPSTEIN, 1991  Occurrence and in vivo biosynthesis of indole-3-butyric acid in corn (Zea mays L.). Plant Physiol. 97:765-770[Abstract/Free Full Text].

LUDWIG-MÜLLER, J. and E. EPSTEIN, 1993  Indole-3-butyric acid in Arabidopsis thaliana. II. In vivo metabolism. Plant Growth Regul. 13:189-195.

LUDWIG-MÜLLER, J. and W. HILGENBERG, 1995  Characterization and partial purification of indole-3-butyric acid synthetase from maize (Zea mays). Physiol. Plant 94:651-660.

LUDWIG-MÜLLER, J., S. SASS, E. G. SUTTER, M. WODNER, and E. EPSTEIN, 1993  Indole-3-butyric acid in Arabidopsis thaliana. I. Identification and quantification. Plant Growth Regul. 13:179-187.

LUSCHNIG, C., R. A. GAXIOLA, P. GRISAFI, and G. R. FINK, 1998  EIR1, a root-specific protein involved in auxin transport, is required for gravitropism in Arabidopsis thaliana.. Genes Dev. 12:2175-2187[Abstract/Free Full Text].

MARCHANT, A., J. KARGUL, S. T. MAY, P. MULLER, and A. DELBARRE et al., 1999  AUX1 regulates root gravitropism in Arabidopsis by facilitating auxin uptake within root apical tissues. EMBO J. 18:2066-2073[Medline].

MÁRTON, L. and J. BROWSE, 1991  Facile transformation of Arabidopsis.. Plant Cell Rep. 10:235-239.

MENGISTE, T., P. AMEDEO, and J. PASZKOWSKI, 1997  High-efficiency transformation of Arabidopsis thaliana with a selectable marker gene regulated by the T-DNA 1' promoter. Plant J. 12:945-948[Medline].

MINET, M., M.-E. DUFOUR, and F. LACROUTE, 1992  Complementation of Saccharomyces cerevisiae auxotrophic mutants by Arabidopsis thaliana cDNAs. Plant J. 2:417-422[Medline].

MORGAN, P. W. and W. C. HALL, 1962  Effect of 2,4-dichlorophenoxyacetic acid on the production of ethylene by cotton and grain sorghum. Physiol. Plant 15:420-427.

MÜLLER, A., C. GUAN, L. GALWEILER, P. TANZLER, and P. HUIJSER et al., 1998  AtPIN2 defines a locus of Arabidopsis for root gravitropism control. EMBO J. 17:6903-6911[Medline].

NAKAGAWA, N., H. MORI, K. YAMAZAKI, and H. IMASEKI, 1991  Cloning of a complementary DNA for auxin-induced 1-aminocyclopropane-1-carboxylate synthase and differential expression of the gene by auxin and wounding. Plant Cell Physiol. 32:1153-1163[Abstract/Free Full Text].

NISSEN, S. J. and E. G. SUTTER, 1990  Stability of IAA and IBA in nutrient medium to several tissue culture procedures. Hort. Sci. 25:800-802[Abstract/Free Full Text].

NORDSTROM, A.-C., F. A. JACOBS, and L. ELIASSON, 1991  Effect of exogenous indole-3-acetic acid and indole-3-butyric acid on internal levels of the respective auxins and their conjugation with aspartic acid during adventitious root formation in pea cuttings. Plant Physiol. 96:856-861[Abstract/Free Full Text].

NORMANLY, J., P. GRISAFI, G. R. FINK, and B. BARTEL, 1997  Arabidopsis mutants resistant to the auxin effects of indole-3-acetonitrile are defective in the nitrilase encoded by the NIT1 gene. Plant Cell 9:1781-1790[Abstract].

OLSEN, L. J., 1998  The surprising complexity of peroxisome biogenesis. Plant Mol. Biol. 38:163-189[Medline].

PICKETT, F. B., A. K. WILSON, and M. ESTELLE, 1990  The aux1 mutation of Arabidopsis confers both auxin and ethylene resistance. Plant Physiol. 94:1462-1466[Abstract/Free Full Text].

POUPART, J. and C. S. WADDELL, 2000  The rib1 mutant is resistant to indole-3-butyric acid, an endogenous auxin in Arabidopsis thaliana. Plant Physiol. in press.

RICHMOND, T. A. and A. B. BLEECKER, 1999  A defect in ß-oxidation causes abnormal inflorescence development in Arabidopsis. Plant Cell 11:1911-1923[Abstract/Free Full Text].

ROUSE, D., P. MACKAY, P. STIRNBERG, M. ESTELLE, and O. LEYSER, 1998  Changes in auxin response from mutations in an AUX/IAA gene. Science 279:1371-1373[Abstract/Free Full Text].

RUEGGER, M., E. DEWEY, L. HOBBIE, D. BROWN, and P. BERNASCONI et al., 1997  Reduced naphthylphthalamic acid binding in the tir3 mutant of Arabidopsis is associated with a reduction in polar auxin transport and diverse morphological defects. Plant Cell 9:745-757[Abstract].

RUEGGER, M., E. DEWEY, W. M. GRAY, L. HOBBIE, and J. TURNER et al., 1998  The TIR1 protein of Arabidopsis functions in auxin response and is related. Genes Dev. 12:198-207[Abstract/Free Full Text].

SATO, S., T. KANEKO, H. KOTANI, Y. NAKAMURA, and E. ASAMIZU et al., 1998  Structural analysis of Arabidopsis thaliana chromosome 5. IV. Sequence features of the regions of 1,456,315 bp covered by nineteen physically assigned P1 and TAC clones. DNA Res. 5:41-54[Abstract].

SCHLIEBS, W., J. SAIDOWSKY, B. AGIANIAN, G. DODT, and F. W. HERBERG et al., 1999  Recombinant human peroxisomal targeting signal receptor PEX5. J. Biol. Chem. 274:5666-5673[Abstract/Free Full Text].

SCHMIDT, R. and L. WILLMITZER, 1988  High efficiency Agrobacterium tumefaciens-mediated transformation of Arabidopsis thaliana leaf and cotyledon explants. Plant Cell Rep. 7:583-586.

SCHNEIDER, E. A., C. W. KAZAKOFF, and F. WIGHTMAN, 1985  Gas chromatography-mass spectrometry evidence for several endogenous auxins in pea seedling organs. Planta 165:232-241.

SCHUMANN, U., C. GIETL, and M. SCHMID, 1999  Sequence analysis of a cDNA encoding Pex7p, a peroxisomal targeting signal 2 receptor from Arabidopsis thaliana.. Plant Physiol. 120:339[Free Full Text].

SILVERSTONE, A. L., C. N. CIAMPAGLIO, and T. SUN, 1998  The Arabidopsis RGA gene encodes a transcriptional regulator repressing the gibberellin signal transduction pathway. Plant Cell 10:155-169[Abstract/Free Full Text].

SMALLE, J., M. HAEGMAN, J. KUREPA, M. V. MONTAGU, and D. V. D. STRAETEN, 1997  Ethylene can stimulate Arabidopsis hypocotyl elongation in the light. Proc. Natl. Acad. Sci. USA 94:2756-2761[Abstract/Free Full Text].

STASINOPOULOS, T. C. and R. P. HANGARTER, 1990  Preventing photochemistry in culture media by long-pass light filters alters growth of cultured tissues. Plant Physiol. 93:1365-1369[Abstract/Free Full Text].

SUTTER, E. G. and J. D. COHEN, 1992  Measurement of indolebutyric acid in plant tissues by isotope dilution gas chromatography-mass spectrometry analysis. Plant Physiol. 99:1719-1722[Abstract/Free Full Text].

THOMPSON, H., R. SCHMIDT, A. BRANDES, J. HESLOP-HARRISON, and C. DEAN, 1996  A novel repetitive sequence associated with the centromeric regions of Arabidopsis thaliana chromosomes. Mol. Gen. Genet. 253:247-252[Medline].

TIAN, Q. and J. W. REED, 1999  Control of auxin-related root development by the Arabidopsis thaliana SHY2/IAA3 gene. Development 126:711-721[Abstract].

TIMPTE, C., A. K. WILSON, and M. ESTELLE, 1994  The axr2-1 mutation of Arabidopsis thaliana is a gain-of-function mutation that disrupts an early step in auxin response. Genetics 138:1239-1249[Abstract].

URQUHART, A. J., D. KENNEDY, S. J. GOULD, and D. I. CRANE, 2000  Interaction of Pex5p, the type 1 peroxisome targeting signal receptor, with the peroxisomal membrane proteins Pex14p and Pex13p. J. Biol. Chem. 275:4127-4136[Abstract/Free Full Text].

UTSUNO, K., T. SHIKANAI, Y. YAMADA, and T. HASHIMOTO, 1998  AGR, an Agravitropic locus of Arabidopsis thaliana, encodes a novel membrane-protein family member. Plant Cell Physiol. 39:1111-1118[Abstract/Free Full Text].

VAN DER KRIEKEN, W. M., H. BRETELER, and M. H. M. VISSER, 1992  The effect of the conversion of indolebutyric acid into indoleactic acid on root formation on microcuttings of Malus.. Plant Cell Physiol. 33:709-713[Abstract/Free Full Text].

VAN DER KRIEKEN, W. M., J. KODDE, M. H. M. VISSER, D. TSARDAKAS, A. BLAAKMEER et al., 1997 Increased induction of adventitious rooting by slow release auxins and elicitors, pp. 95–104 in Biology of Root Formation and Development, edited by A. ALTMAN and Y. WAISEL. Plenum Press, New York.

VAN DER LEIJ, I., M. M. FRANSE, Y. ELGERSMA, B. DISTEL, and H. F. TABAK, 1993  PAS10 is a tetratricopeptide-repeat protein that is essential for the import of most matrix proteins into peroxisomes of Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 90:11782-11786[Abstract/Free Full Text].

WAIN, R. L. and F. WIGHTMAN, 1954  The growth-regulating activity of certain -substituted alkyl carboxylic acids in relation to their ß-oxidation within the plant. Proc. R. Soc. Lond. Ser. B 142:525-536[Medline].

WIMMER, C., M. SCHMID, M. VEENHUIS, and C. GIETL, 1998  The plant PTS1 receptor: similarities and differences to its human and yeast counterparts. Plant J. 16:453-464[Medline].

YAMAMOTO, M. and K. T. YAMAMOTO, 1998  Differential effects of 1-naphthaleneacetic acid, indole-3-acetic acid and 2,4-dichlorophenoxyacetic acid on the gravitropic response of roots in an auxin-resistant mutant of Arabidopsis, aux1.. Plant Cell Physiol. 39:660-664[Abstract/Free Full Text].

This article has been cited by other articles:

				S. Reumann, S. Quan, K. Aung, P. Yang, K. Manandhar-Shrestha, D. Holbrook, N. Linka, R. Switzenberg, C. G. Wilkerson, A. P.M. Weber, et al. In-Depth Proteome Analysis of Arabidopsis Leaf Peroxisomes Combined with in Vivo Subcellular Targeting Verification Indicates Novel Metabolic and Regulatory Functions of Peroxisomes Plant Physiology, May 1, 2009; 150(1): 125 - 143. [Abstract] [Full Text] [PDF]

				M. J. Lingard, M. Monroe-Augustus, and B. Bartel Peroxisome-associated matrix protein degradation in Arabidopsis PNAS, March 17, 2009; 106(11): 4561 - 4566. [Abstract] [Full Text] [PDF]

				C.-H. Dong, B. K. Zolman, B. Bartel, B.-h. Lee, B. Stevenson, M. Agarwal, and J.-K. Zhu Disruption of Arabidopsis CHY1 Reveals an Important Role of Metabolic Status in Plant Cold Stress Signaling Mol Plant, January 1, 2009; 2(1): 59 - 72. [Abstract] [Full Text] [PDF]

				D. Dietrich, H. Schmuths, C. D. M. Lousa, J. M. Baldwin, S. A. Baldwin, A. Baker, F. L. Theodoulou, and M. J. Holdsworth Mutations in the Arabidopsis Peroxisomal ABC Transporter COMATOSE Allow Differentiation between Multiple Functions In Planta: Insights from an Allelic Series Mol. Biol. Cell, January 1, 2009; 20(1): 530 - 543. [Abstract] [Full Text] [PDF]

				L. C. Strader, M. Monroe-Augustus, K. C. Rogers, G. L. Lin, and B. Bartel Arabidopsis iba response5 Suppressors Separate Responses to Various Hormones Genetics, December 1, 2008; 180(4): 2019 - 2031. [Abstract] [Full Text] [PDF]

				N. Linka, F. L. Theodoulou, R. P. Haslam, M. Linka, J. A. Napier, H. E. Neuhaus, and A. P.M. Weber Peroxisomal ATP Import Is Essential for Seedling Development in Arabidopsis thaliana PLANT CELL, December 1, 2008; 20(12): 3241 - 3257. [Abstract] [Full Text] [PDF]

				X.-C. Zhang and J.-P. Hu FISSION1A and FISSION1B Proteins Mediate the Fission of Peroxisomes and Mitochondria in Arabidopsis Mol Plant, November 1, 2008; 1(6): 1036 - 1047. [Abstract] [Full Text] [PDF]

				D. R. MacGregor, K. I. Deak, P. A. Ingram, and J. E. Malamy Root System Architecture in Arabidopsis Grown in Culture Is Regulated by Sucrose Uptake in the Aerial Tissues PLANT CELL, October 1, 2008; 20(10): 2643 - 2660. [Abstract] [Full Text] [PDF]

				B. K. Zolman, N. Martinez, A. Millius, A. R. Adham, and B. Bartel Identification and Characterization of Arabidopsis Indole-3-Butyric Acid Response Mutants Defective in Novel Peroxisomal Enzymes Genetics, September 1, 2008; 180(1): 237 - 251. [Abstract] [Full Text] [PDF]

				M. J. Lingard, S. K. Gidda, S. Bingham, S. J. Rothstein, R. T. Mullen, and R. N. Trelease Arabidopsis PEROXIN11c-e, FISSION1b, and DYNAMIN-RELATED PROTEIN3A Cooperate in Cell Cycle-Associated Replication of Peroxisomes PLANT CELL, June 1, 2008; 20(6): 1567 - 1585. [Abstract] [Full Text] [PDF]

				M. C. Castillo and J. Leon Expression of the {beta}-oxidation gene 3-ketoacyl-CoA thiolase 2 (KAT2) is required for the timely onset of natural and dark-induced leaf senescence in Arabidopsis J. Exp. Bot., May 1, 2008; 59(8): 2171 - 2179. [Abstract] [Full Text] [PDF]

				M. Desai and J. Hu Light Induces Peroxisome Proliferation in Arabidopsis Seedlings through the Photoreceptor Phytochrome A, the Transcription Factor HY5 HOMOLOG, and the Peroxisomal Protein PEROXIN11b Plant Physiology, March 1, 2008; 146(3): 1117 - 1127. [Abstract] [Full Text] [PDF]

				K. Nito, A. Kamigaki, M. Kondo, M. Hayashi, and M. Nishimura Functional Classification of Arabidopsis Peroxisome Biogenesis Factors Proposed from Analyses of Knockdown Mutants Plant Cell Physiol., June 1, 2007; 48(6): 763 - 774. [Abstract] [Full Text] [PDF]

				A. W. Woodward, S. E. Ratzel, E. E. Woodward, Y. Shamoo, and B. Bartel Mutation of E1-CONJUGATING ENZYME-RELATED1 Decreases RELATED TO UBIQUITIN Conjugation and Alters Auxin Response and Development Plant Physiology, June 1, 2007; 144(2): 976 - 987. [Abstract] [Full Text] [PDF]

				U. Schumann, J. Prestele, H. O'Geen, R. Brueggeman, G. Wanner, and C. Gietl Requirement of the C3HC4 zinc RING finger of the Arabidopsis PEX10 for photorespiration and leaf peroxisome contact with chloroplasts PNAS, January 16, 2007; 104(3): 1069 - 1074. [Abstract] [Full Text] [PDF]

				T. Orth, S. Reumann, X. Zhang, J. Fan, D. Wenzel, S. Quan, and J. Hu The PEROXIN11 Protein Family Controls Peroxisome Proliferation in Arabidopsis PLANT CELL, January 1, 2007; 19(1): 333 - 350. [Abstract] [Full Text] [PDF]

				E. van der Graaff, R. Schwacke, A. Schneider, M. Desimone, U.-I. Flugge, and R. Kunze Transcription Analysis of Arabidopsis Membrane Transporters and Hormone Pathways during Developmental and Induced Leaf Senescence Plant Physiology, June 1, 2006; 141(2): 776 - 792. [Abstract] [Full Text] [PDF]

				P. J. Eastmond SUGAR-DEPENDENT1 Encodes a Patatin Domain Triacylglycerol Lipase That Initiates Storage Oil Breakdown in Germinating Arabidopsis Seeds PLANT CELL, March 1, 2006; 18(3): 665 - 675. [Abstract] [Full Text] [PDF]

				B. K. Zolman, M. Monroe-Augustus, I. D. Silva, and B. Bartel Identification and Functional Characterization of Arabidopsis PEROXIN4 and the Interacting Protein PEROXIN22 PLANT CELL, December 1, 2005; 17(12): 3422 - 3435. [Abstract] [Full Text] [PDF]

				J. Poupart, A. M. Rashotte, G. K. Muday, and C. S. Waddell The rib1 Mutant of Arabidopsis Has Alterations in Indole-3-Butyric Acid Transport, Hypocotyl Elongation, and Root Architecture Plant Physiology, November 1, 2005; 139(3): 1460 - 1471. [Abstract] [Full Text] [PDF]

				J. Fan, S. Quan, T. Orth, C. Awai, J. Chory, and J. Hu The Arabidopsis PEX12 Gene Is Required for Peroxisome Biogenesis and Is Essential for Development Plant Physiology, September 1, 2005; 139(1): 231 - 239. [Abstract] [Full Text] [PDF]

				J. Ludwig-Muller, A. Vertocnik, and C. D. Town Analysis of indole-3-butyric acid-induced adventitious root formation on Arabidopsis stem segments J. Exp. Bot., August 1, 2005; 56(418): 2095 - 2105. [Abstract] [Full Text] [PDF]

				S. K. Karnik and R. N. Trelease Arabidopsis Peroxin 16 Coexists at Steady State in Peroxisomes and Endoplasmic Reticulum Plant Physiology, August 1, 2005; 138(4): 1967 - 1981. [Abstract] [Full Text] [PDF]

				T. Chhun, S. Taketa, M. Ichii, and S. Tsurumi Involvement of ARM2 in the Uptake of Indole-3-butyric Acid in Rice (Oryza sativa L.) Roots Plant Cell Physiol., July 1, 2005; 46(7): 1161 - 1164. [Abstract] [Full Text] [PDF]

				M. Hayashi, M. Yagi, K. Nito, T. Kamada, and M. Nishimura Differential Contribution of Two Peroxisomal Protein Receptors to the Maintenance of Peroxisomal Functions in Arabidopsis J. Biol. Chem., April 15, 2005; 280(15): 14829 - 14835. [Abstract] [Full Text] [PDF]

				K. Schneider, L. Kienow, E. Schmelzer, T. Colby, M. Bartsch, O. Miersch, C. Wasternack, E. Kombrink, and H.-P. Stuible A New Type of Peroxisomal Acyl-Coenzyme A Synthetase from Arabidopsis thaliana Has the Catalytic Capacity to Activate Biosynthetic Precursors of Jasmonic Acid J. Biol. Chem., April 8, 2005; 280(14): 13962 - 13972. [Abstract] [Full Text] [PDF]

				A. W. WOODWARD and B. BARTEL Auxin: Regulation, Action, and Interaction Ann. Bot., April 1, 2005; 95(5): 707 - 735. [Abstract] [Full Text] [PDF]

				A. W. Woodward and B. Bartel The Arabidopsis Peroxisomal Targeting Signal Type 2 Receptor PEX7 Is Necessary for Peroxisome Function and Dependent on PEX5 Mol. Biol. Cell, February 1, 2005; 16(2): 573 - 583. [Abstract] [Full Text] [PDF]

				J. J. Campanella, A. F. Olajide, V. Magnus, and J. Ludwig-Muller A Novel Auxin Conjugate Hydrolase from Wheat with Substrate Specificity for Longer Side-Chain Auxin Amide Conjugates Plant Physiology, August 1, 2004; 135(4): 2230 - 2240. [Abstract] [Full Text] [PDF]

				R. A. Rampey, S. LeClere, M. Kowalczyk, K. Ljung, G. Sandberg, and B. Bartel A Family of Auxin-Conjugate Hydrolases That Contributes to Free Indole-3-Acetic Acid Levels during Arabidopsis Germination Plant Physiology, June 1, 2004; 135(2): 978 - 988. [Abstract] [Full Text] [PDF]

				B. K. Zolman and B. Bartel An Arabidopsis indole-3-butyric acid-response mutant defective in PEROXIN6, an apparent ATPase implicated in peroxisomal function PNAS, February 10, 2004; 101(6): 1786 - 1791. [Abstract] [Full Text] [PDF]

				M. Fulda, J. Schnurr, A. Abbadi, E. Heinz, and J. Browse Peroxisomal Acyl-CoA Synthetase Activity Is Essential for Seedling Development in Arabidopsis thaliana PLANT CELL, February 1, 2004; 16(2): 394 - 405. [Abstract] [Full Text] [PDF]

				M. Monroe-Augustus, B. K. Zolman, and B. Bartel IBR5, a Dual-Specificity Phosphatase-Like Protein Modulating Auxin and Abscisic Acid Responsiveness in Arabidopsis PLANT CELL, December 1, 2003; 15(12): 2979 - 2991. [Abstract] [Full Text] [PDF]

				I. A. Sparkes, F. Brandizzi, S. P. Slocombe, M. El-Shami, C. Hawes, and A. Baker An Arabidopsis pex10 Null Mutant Is Embryo Lethal, Implicating Peroxisomes in an Essential Role during Plant Embryogenesis Plant Physiology, December 1, 2003; 133(4): 1809 - 1819. [Abstract] [Full Text]

				C. Mussig, G.-H. Shin, and T. Altmann Brassinosteroids Promote Root Growth in Arabidopsis Plant Physiology, November 1, 2003; 133(3): 1261 - 1271. [Abstract] [Full Text] [PDF]

				M. A. Murphy, B. A. Phillipson, A. Baker, and R. T. Mullen Characterization of the Targeting Signal of the Arabidopsis 22-kD Integral Peroxisomal Membrane Protein Plant Physiology, October 1, 2003; 133(2): 813 - 828. [Abstract] [Full Text] [PDF]

				A. M. Rashotte, J. Poupart, C. S. Waddell, and G. K. Muday Transport of the Two Natural Auxins, Indole-3-Butyric Acid and Indole-3-Acetic Acid, in Arabidopsis Plant Physiology, October 1, 2003; 133(2): 761 - 772. [Abstract] [Full Text] [PDF]

				A. Rahman, S. Hosokawa, Y. Oono, T. Amakawa, N. Goto, and S. Tsurumi Auxin and Ethylene Response Interactions during Arabidopsis Root Hair Development Dissected by Auxin Influx Modulators Plant Physiology, December 1, 2002; 130(4): 1908 - 1917. [Abstract] [Full Text] [PDF]

				T. L. Johnson and L. J. Olsen Building New Models for Peroxisome Biogenesis Plant Physiology, November 1, 2001; 127(3): 731 - 739. [Full Text] [PDF]

				B. K. Zolman, I. D. Silva, and B. Bartel The Arabidopsis pxa1 Mutant Is Defective in an ATP-Binding Cassette Transporter-Like Protein Required for Peroxisomal Fatty Acid beta -Oxidation Plant Physiology, November 1, 2001; 127(3): 1266 - 1278. [Abstract] [Full Text] [PDF]

				L. E. Rogg, J. Lasswell, and B. Bartel A Gain-of-Function Mutation in IAA28 Suppresses Lateral Root Development PLANT CELL, March 1, 2001; 13(3): 465 - 480. [Abstract] [Full Text]

				B. K. Zolman, M. Monroe-Augustus, B. Thompson, J. W. Hawes, K. A. Krukenberg, S. P. T. Matsuda, and B. Bartel chy1, an Arabidopsis Mutant with Impaired beta -Oxidation, Is Defective in a Peroxisomal beta -Hydroxyisobutyryl-CoA Hydrolase J. Biol. Chem., August 10, 2001; 276(33): 31037 - 31046. [Abstract] [Full Text] [PDF]