- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Olesnicky, N. S.
- Articles by Casselton, L. A.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Olesnicky, N. S.
- Articles by Casselton, L. A.
Self-Compatible B Mutants in Coprinus With Altered Pheromone-Receptor Specificities
Natalie S. Olesnickya, Andrew J. Brownb, Yoichi Hondaa, Susan L. Dyosb, Simon J. Dowellb, and Lorna A. Casseltonaa Department of Plant Sciences, University of Oxford, Oxford OX1 3RB, United Kingdom
b 7TM Receptor Unit, Molecular Pharmacology Department, Glaxo Wellcome Medicines Research Centre, Stevenage, Hertfordshire SG1 2NY, United Kingdom
Corresponding author: Lorna A. Casselton, Department of Plant Sciences, University of Oxford, Oxford OX1 3RB, United Kingdom., lorna.casselton{at}plants.ox.ac.uk (E-mail)
Communicating editor: R. H. DAVIS
| ABSTRACT |
|---|
A successful mating in the mushroom Coprinus cinereus brings together a compatible complement of pheromones and G-protein-coupled receptors encoded by multiallelic genes at the B mating-type locus. Rare B gene mutations lead to constitutive activation of B-regulated development without the need for mating. Here we characterize a mutation that arose in the B6 locus and show that it generates a mutant receptor with a single amino acid substitution (R96H) at the intracellular end of transmembrane domain III. Using a heterologous yeast assay and synthetic pheromones we show that the mutation does not make the receptor constitutively active but permits it to respond inappropriately to a normally incompatible pheromone encoded within the same B6 locus. Parallel experiments carried out in Coprinus showed that a F67W substitution in this same pheromone enabled it to activate the normally incompatible wild-type receptor. Together, our experiments show that a single amino acid replacement in either pheromone or receptor can deregulate the specificity of ligand-receptor recognition and confer a self-compatible B phenotype. In addition, we use the yeast assay to demonstrate that different receptors and pheromones found at a single B locus belong to discrete subfamilies within which receptor activation cannot normally occur.
MATING compatibility in the homobasidiomycete fungus Coprinus cinereus is determined by several multiallelic genes that reside at the A and B mating-type loci. Provided mates have different alleles of both sets of genes, somatic cell fusion is sufficient to initiate a morphogenetic program that converts an asexual monokaryotic mycelium into a fertile dikaryotic mycelium on which mushroom fruit bodies develop (see ![]()
![]()
The dikaryon represents an extended mycelial stage between cell fusion and nuclear fusion. Each cell of the dikaryon contains two nuclei, one from each mate, and a compatible complement of mating-type genes ensures that this equal nuclear distribution is maintained until a late stage in fruit body differentiation when the nuclei fuse. Following cell fusion, there is exchange and migration of nuclei through the established cells of each monokaryon. Once the tip cells contain genetically different nuclei, a complex cell division follows in which the two nuclei divide in synchrony and a structure known as a clamp connection is formed through which one of the daughter nuclei must pass into a newly formed subterminal cell. Compatible A genes are required for synchronized division of the nuclei and for the formation of the clamp cell. Compatible B genes promote the initial nuclear migration that establishes binucleate cells and, later, control fusion of the clamp cell to the subterminal cell to complete the clamp connection (![]()
The B mating-type genes, the subject of this report, encode lipopeptide mating pheromones and their G-protein-coupled receptors (GPCRs; ![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
The complexity in the B gene families makes C. cinereus and S. commune attractive models to study receptor-ligand interactions. A single receptor may be activated by many different ligands and a single ligand can activate several different receptors. Of particular interest, since GPCRs are ubiquitous in eukaryotic cells, are mutations that alter receptor-ligand specificity since they may help us to better understand regions of the molecules that determine this. B gene mutations are known in both mushroom species and were obtained long before the functions of the genes were elucidated by selecting for B-regulated development in the absence of a compatible mate (![]()
![]()
![]()
![]()
![]()
![]()
![]()
In this study we use the yeast assay and appropriate synthetic peptides to show that the third mutation identified by ![]()
| MATERIALS AND METHODS |
|---|
C. cinereus strains and growth methods:
C. cinereus strains used were LT2 (A6B6 trp-1.1;1.6); FA2222 (A5B6 trp-1.1;1.6); B6M3 (A2B6m2 ade-8 met-5, ade5); PG78 (A6B42 pab-1 trp-1.1;1.6); J65,5, A43B42. Media and methods for culturing C. cinereus were described previously (![]()
![]()
![]()
Construction of vectors for epitope tagging:
A BglII/BamHI linker encoding the hemagglutinin (HA) epitope flanked by an ATG start codon was generated by annealing the oligonucleotides GATCTTGAAAATGTACCCATACGACGTCCCAGA CTACGCTCG and GATCCGAGCGTAGTCTGGGACGTCGT ATGGGTACATTTTCAA. This linker was phosphorylated, treated with T4 DNA ligase, and digested with BglII and BamHI. A 126-bp fragment comprising three copies of the HA epitope fused in frame was cloned into pBB (![]()
![]()
B gene plasmid generation:
The three receptor genes from the B6M3 strain were amplified by PCR using the following primers: rcb16, CCCCGAACGGCCTTGTACTGTAGC and CTCGCTCTGCTCCCGGACC; rcb26, AAGCTTGGGGCGGACGAT GCG and AAGCTTAGTAAGAGGACATGAGTCCC; and rcb36, GGATCCTTGGACGGGGAAGAGGACGG and CCCGCGTTTCTTTCTTGGAGCCG. PCR products were cloned and sequenced as described previously (![]()
![]()
![]()
![]()
![]()
Yeast strains and methods:
Yeast strains MMY8, MMY11, and MMY16 and the chimeric G-protein
-subunit Gpa1/G
i1 have been described previously (![]()
![]()
i1 into the yeast genome, a cassette comprising the GPA1 promoter, Gpa1/G
i1, and the ADH1 terminator was cloned into pRS304 (![]()
i1 at the trp1 locus. Assay of ß-galactosidase activity using the chromogenic substrate chlorophenolred-ß-D-galactopyranoside (CPRG; Boehringer Mannheim, Indianapolis) was performed as described previously (![]()
![]()
| RESULTS |
|---|
Mutation in Rcb36 confers a self-compatible B mating phenotype:
The organization of the B6 and B42 loci as determined by ![]()
![]()
![]()
![]()
![]()
|
|
In our previous analysis of B6 self-compatible mutants we identified the mutation in the group 2 receptor Rcb26. The mutant Rcb26 Q229P was able to activate the pheromone response pathway of a heterologous S. cerevisiae host independent of pheromone (![]()
![]()
-subunit, Gpa1, as well as a series of chimeric G
subunits, to optimize the efficiency of G-protein coupling to the C. cinereus receptor.
Neither wild-type Rcb36 nor Rcb36 R96H receptor stimulated histidine-independent growth of MMY8 yeast cells (data not shown). To confirm that this apparent lack of constitutive activation of Rcb36 R96H was not due to lack of expression or coupling to the G
subunits tested, we demonstrated that Rcb36 could be activated by a synthetic pheromone. Genetic studies in C. cinereus (![]()
No induction of FUS-lacZ occurred in the absence of synthetic Phb3.242, either with Rcb36 or Rcb36 R96H, confirming that, when expressed in yeast, the R96H mutation does not cause detectable constitutive activation of the receptor. However, when the synthetic pheromone was applied to cells expressing wild-type Rcb36, a concentration-dependent response was observed, demonstrating that Rcb36 was expressed and could couple to the yeast pheromone response pathway (Fig 3). We performed this experiment using a panel of different yeast strains expressing various wild-type and chimeric G
subunits to determine which yielded the most efficient coupling of Rcb36 to the pheromone response pathway (![]()
i1 transplant chimera, in which the five C-terminal amino acids of Gpa1p are replaced with the C-terminal residues of mammalian G
i1. The results presented in Fig 3 were obtained using coupling to this Gpa1/G
i1 chimera. Remarkably, cells expressing the mutant Rcb36 R96H receptor also responded to the synthetic pheromone but with a greater sensitivity than the wild-type receptor, detecting lower concentrations of Phb3.242 and giving increased FUS1-lacZ activation at high ligand concentrations.
|
Rcb36 R96H is activated by Phb3.26, a B6 (self) pheromone:
We considered several explanations for the increased ligand sensitivity of yeast expressing Rcb36 R96H. Given the location of the mutation in the second intracellular loop of the receptor, it seemed unlikely that the residue at this position would contact the pheromone directly. However, it may influence G-protein coupling, it may have an indirect effect on ligand binding, or it may cause greater levels of receptor protein to accumulate by stabilizing the receptor or by disrupting a mechanism of desensitization. To investigate this, we generated epitope-tagged versions of Rcb36 and Rcb36 R96H in which the receptor N terminus was fused to a peptide sequence containing three copies of the HA epitope. The epitope tag marginally reduced the efficiency of coupling of both HA-Rcb36 and HA-Rcb36 R96H. However, HA-Rcb36 and HA-Rcb36 R96H both retained the ability to respond to synthetic Phb3.242 pheromone, and the phenotype of enhanced coupling of Rcb36 R96H was also observed with the tagged receptors (Fig 3A). Levels of HA-Rcb36 and HA-Rcb36 R96H protein in yeast whole-cell extracts were quantified by immunoblotting with anti-HA monoclonal antibodies and were indistinguishable (Fig 3B and Fig C). These data suggest that the R96H mutation does not affect total cellular levels of receptor protein.
The R96H mutation is unlikely to affect G-protein specificity, as the profile of G-protein coupling specificities of Rcb36 and Rcb36 R96H among the various chimeric G
subunits tested was identical (data not shown). This does not preclude the possibility that the mutation might cause increased efficiency of G-protein activation or that the specificity for the particular G
subunits present in C. cinereus (which are not yet identified) might be affected. However, the only clear phenotype observed in experiments with the compatible pheromone was an enhanced ligand response. Since this does not explain the basis of self-compatibility in C. cinereus, which occurs in the absence of such a compatible pheromone, we tested whether Rcb36 R96H receptor could be activated by one of the normally incompatible pheromones present in the endogenous B6 cellular environment in C. cinereus.
The pheromones encoded by the six genes at the B6 locus are highly diverged. However, within groups and between alleles there is generally a much greater degree of conservation, both of receptors and pheromones. The sequence of Phb3.26 differs at only four amino acid positions from that of Phb3.242, the pheromone that activates Rcb36 (see Fig 1). Moreover, the allelic Rcb36 and Rcb342 receptors that discriminate between these two pheromones are also highly conserved with 78% identity in amino acid sequence (![]()
|
Since the mutation in Rcb36 results in altered specificity, we next probed to what extent this relaxation in specificity could lead to activation by other synthetic pheromones. We tested the effect of two pheromones from the group 2 family, one encoded by the B6 locus and the other by the B42 locus (Phb2.26 and Phb2.242, respectively; see Fig 1). Neither of these pheromones activated either wild-type or mutant Rcb36 receptor (Fig 5A). The Rcb36 R96H mutation, therefore, does not cause promiscuous activation of this receptor by pheromones; the response to Phb3.26 is ligand specific.
|
The B locus encodes structurally distinct subfamilies of signaling molecules:
The intracellular end of TMD III and beginning of intracellular loop 2, where the Rcb36 R96H mutation is located, is reasonably well conserved in the group 2 receptor encoded at the B6 locus, Rcb26 (Fig 5A). Since Rcb26 also couples in yeast, we tested whether the analogous mutation in Rcb26 conferred a similar self-compatible phenotype. The Rcb26 R95H mutant was created by site-directed mutagenesis and tested for function by transformation into both B6 and B42 host strains of C. cinereus. In the B42 background, the Rcb26 R95H activated B-regulated development in the mating assay, in common with wild-type Rcb26. In the B6 host, Rcb26 R95H failed to confer a self-compatible phenotype and was thus indistinguishable from wild type (data not shown).
To confirm these results, we tested the activity of synthetic pheromones in activating Rcb26 R95H expressed in yeast. The mutation had no significant effect on activation of Rcb26 by the compatible B42 pheromone Phb2.242 either at a maximal concentration of pheromone (Fig 5C) or at submaximal concentrations (data not shown). Also, the mutation did not confer any ability to respond to the self B6 pheromone, Phb2.26 (Fig 5C). The effect of the amino acid substitution at this position in the receptor protein is thus specific to Rcb36, indicating that the structural similarity of this region is not sufficient in itself to cause predictable changes in receptor function.
The genetic studies of ![]()
![]()
F67W substitution in the pheromone Phb3.26 causes self-compatibility:
The self-compatible B mutations selected in C. cinereus both arose in receptor genes. From comparison of the pheromone sequences it seemed likely that pheromone mutations might result in the same phenotype. As described above, the predicted amino acid sequences of mature Phb3.26 and Phb3.242 pheromones differ at only four positions (Fig 6A). To identify which of these amino acids determines specificity, we introduced mutations into the Phb3.26 pheromone precursor gene at each of the four positions in turn, changing the amino acid to that in Phb3.242 (Fig 6B). The mutant genes were introduced into B6 and B42 host strains of C. cinereus to determine their ability to activate B-regulated development. Three of the mutant Phb3.26 pheromones (H60Q, N63G, and W68F) behaved like the wild type and were active only in the B42 background. In contrast, F67W was active in the B42 background but could also confer self-compatibility on the B6 strain. This altered specificity suggests that the Phb3.26 F67W mutant is able to activate both Rcb36 and Rcb342 receptors and illustrates how single amino acid changes in either pheromone or receptor can result in self-compatibility due to a relaxation of the normal specificity of pheromone/receptor recognition. It is unlikely that the previous screen (![]()
|
To examine the significance of the Phe Trp/Trp Phe (FW/WF) motif at the C termini of Phb3.26 and Phb3.242, we created the double-mutant Phb3.26 F67W/W68F in which both amino acids in the B6 pheromone were exchanged to those of Phb3.242. The Phb3.26 F67W/W68F double mutant conferred self-compatibility in that it activated B-regulated development in the B6 C. cinereus host. However, it had barely detectable activity in the B42 host, suggesting it had greatly reduced ability to activate the normally compatible Rcb342 receptor (Fig 6B). It is remarkable that while a single amino acid change can generate a self-compatible pheromone, the double replacement reverses the specificity almost entirely. These two amino acids together are thus critical in determining the specificity of the naturally occurring pheromones with respect to the B6 and B42 receptors.
| DISCUSSION |
|---|
Mutations that confer B mating self-compatibility are difficult to generate in C. cinereus. They cause activation of the pheromone response pathway without the need for mating and lead to constitutive expression of B-regulated sexual development. We now demonstrate that there are at least three mechanisms whereby this can occur. The three mutations described by ![]()
![]()
![]()
Genetic data led us to propose that the genes within the B locus of C. cinereus encode three functionally discrete families of signaling molecules. B6 and B42 were found to share alleles of the group 1 genes but have different alleles of the group 2 and group 3 genes (![]()
![]()
The receptor mutant that we describe in this article, Rcb36 R96H, has three key features that make it interesting: it does not appear to be constitutively active, it has an enhanced response to a compatible ligand, and it responds erroneously to a normally incompatible ligand. This latter phenotype has been described in mutants of yeast pheromone receptor Ste2p. These mutants could be activated by certain pheromone analogues that bound but did not activate the wild-type receptor (![]()
![]()
Movements of TMDs III and VI play a key role in the activation of GPCRs (![]()
![]()
![]()
![]()
1B adrenergic receptor has shown that mutation of D142 of the DRY motif to any other amino acid constitutively activates the receptor (![]()
![]()
![]()
![]()
![]()
C. cinereus and S. commune are useful models in which receptor and pheromone functions can be measured using a genuine biological phenotype. For both species, a yeast assay has been developed for studying isolated receptor-ligand interactions (![]()
![]()
| ACKNOWLEDGMENTS |
|---|
We thank Steve Foord and Fiona Marshall for critical reading of the manuscript. N.S.O. was supported by a Rhodes Scholarship. L.A.C. is a Biotechnology and Biological Sciences Research Council Senior Research Fellow. Y.H. was supported by a fellowship from the Japan Society for the Promotion of Science and Royal Society under the Anglo-Japanese Scientific Exchange Progam.
Manuscript received May 19, 2000; Accepted for publication July 17, 2000.
| LITERATURE CITED |
|---|
ABEL, M. G., B. K. LEE, F. NAIDER, and J. M. BECKER, 1998 Mutations affecting ligand specificity of the G-protein-coupled receptor for the Saccharomyces cerevisiae tridecapeptide pheromone. Biochim. Biophys. Acta 1448:12-26[Medline].
ARORA, K. K., A. SAKAI, and K. J. CATT, 1995 Effects of second intracellular loop mutations on signal transduction and internalization of the gonadotropin-releasing hormone receptor. J. Biol. Chem. 270:22820-22826
ARORA, K. K., Z. Y. CHENG, and K. J. CATT, 1997 Mutations of the conserved DRS motif in the second intracellular loop of the gonadotropin-releasing hormone receptor affect expression, activation, and internalization. Mol. Endocrinol. 11:1203-1212
BROWN, A. J., S. L. DYOS, M. S. WHITEWAY, J. H. M. WHITE, and M.-A. E. A. WATSON et al., 2000 Functional coupling of mammalian receptors to the yeast mating pathway using novel yeast/mammalian G protein
-subunit chimeras. Yeast 16:11-22[Medline].
CALDWELL, G. A., S-H. WANG, C-B. XUE, Y. JIANG, and H-F. LU et al., 1995 Fungal lipopeptide mating pheromones: a model system for the study of protein prenylation. Microbiol. Rev. 59:406-422
CASSELTON, L. A. and A. DE LA FUENTE HERCE, 1989 Heterologous gene expression in the basidiomycete fungus Coprinus cinereus.. Curr. Genet. 16:35-40.
CASSELTON, L. A. and N. S. OLESNICKY, 1998 Molecular genetics of mating recognition in basidiomycete fungi. Microbiol. Mol. Biol. Rev. 62:55-70
DOWELL, S. J., A. L. BISHOP, S. L. DYOS, A. J. BROWN, and M. S. WHITEWAY, 1998 Mapping of a yeast G protein betagamma signaling interaction. Genetics 150:1407-1417
FARRENS, D. L., C. ALTENBACH, K. YANG, W. L. HUBBELL, and H. G. KHORANA, 1996 Requirement of rigid-body motion of transmembrane helices for light activation of rhodopsin. Science 274:768-770
FOWLER, T. J., M. F. MITTON and C. A. RAPER, 1998 Gene mutations affecting specificity of pheromone/receptor mating interactions in Schizophyllum Commune, pp. 130134 in Proceedings of the Fourth Conference on the Genetics and Cellular Biology of Basidiomycetes, edited by L. J. L. D. VAN GRIENSVEN and J. VISSER, Mushroom Experimental Station, Horst, The Netherlands.
FOWLER, T. J., S. M. DESIMONE, M. F. MITTON, J. KURJAN, and C. A. RAPER, 1999 Multiple sex pheromones and receptors of a mushroom-producing fungus elicit masting in yeast. Mol. Biol. Cell 10:2559-2572
GETHER, U., S. LIN, P. GHANOUNI, J. A. BALLESTEROS, and H. WEINSTEIN et al., 1997 Agonists induce conformational changes in transmembrane domains III and VI of the ß2 adrenoceptor. EMBO J. 16:6737-6747[Medline].
HALSALL, J. R., M. J. MILNER, and L. A. CASSELTON, 2000 Three subfamilies of pheromone and receptor genes generate multiple B mating specificities in the mushroom Coprinus cinereus.. Genetics 154:1115-1123
HAYLOCK, R. W., A. ECONOMOU, and L. A. CASSELTON, 1980 Dikaryon formation in Coprinus cinereus: selection and identification of B factor mutants. J. Gen. Microbiol. 121:17-26.
IMAI, Y., Y. MATSUSHIMA, and T. SUGIMURA, 1991 A simple and rapid method for generating a deletion by PCR. Nucleic Acids Res. 19:2785
KOLTIN, Y., 1968 The genetic structure of the incompatibility factors of Schizophyllum commune: comparative studies of primary mutations in the B factor. Mol. Gen. Genet. 102:196-203[Medline].
MARSH, L., 1992 Substitutions in the hydrophobic core of the alpha-factor receptor of Saccharomyces cerevisiae permit response to Saccharomyces kluyveri alpha-factor and to antagonist. Mol. Cell. Biol. 12:3959-3966
MHAOUTY-KODJA, S., L. S. BARAK, A. SCHEER, L. ABUIN, and D. DIVIANI et al., 1999 Constitutively active alpha-1b adrenergic receptor mutants display different phosphorylation and internalization features. Mol. Pharmacol. 55:339-347
MUMBERG, D., R. MULLER, and M. FUNK, 1995 Yeast vectors for the controlled expression of heterologous proteins in different genetic backgrounds. Gene 156:119-122[Medline].
OLESNICKY, N. S., A. J. BROWN, S. J. DOWELL, and L. A. CASSELTON, 1999 A constitutively active G-protein-coupled receptor causes mating self-compatibility in the mushroom Coprinus.. EMBO J. 18:2756-2763[Medline].
O'SHEA, S. F., P. T. CHAURE, J. R. HALSALL, N. S. OLESNICKY, and A. LEIBBRANDT et al., 1998 A large pheromone and receptor gene complex determines multiple B mating type specificities in Coprinus cinereus.. Genetics 148:1081-1090
PARAG, Y., 1962 Mutations in the B incompatibility factor of Schizophyllum commune.. Proc. Natl. Acad. Sci. USA 48:743-750
RAPER, J. R., 1966 Genetics of Sexuality in Higher Fungi. Ronald Press, New York.
SCHEER, A., F. FANELLI, T. COSTA, P. G. DEBENEDETTI, and S. COTECCHIA, 1996 Constitutively active mutants of the
1B-adrenergic receptorrole of highly conserved polar amino acids in receptor activation. EMBO J. 15:3566-3578[Medline].
SEIBOLD, A., M. DAGARAG, and M. BIRNBAUMER, 1998 Mutations of the DRY motif that preserve beta-2-adrenoceptor coupling. Receptors & Channels 5:375-385[Medline].
SHEIKH, S. P., T. A. ZVYAGA, O. LICHTARGE, T. P. SAKMAR, and H. R. BOURNE, 1996 Rhodopsin activation blocked by metal-ion-binding sites linking transmembrane helices C and F. Nature 383:347-350[Medline].
SIKORSKI, R. S. and P. HIETER, 1989 A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.. Genetics 122:19-27
SWIEZYNSKI, K. M. and P. R. DAY, 1960 Heterokaryon formation in Coprinus lagopus.. Genet. Res. 1:114-128.
VAILLANCOURT, L. J., M. RAUDASKOSKI, C. A. SPECHT, and C. A. RAPER, 1997 Multiple genes encoding pheromones and pheromone receptors define the Bb1 mating-type specificity in Schizophyllum commune. Genetics 146:541-551[Abstract].
WENDLAND, J. L., L. J. VAILLANCOURT, J. HEGNER, K. B. LENGELER, and K. J. LADDISON et al., 1995 The mating-type locus Ba1 of Schizophyllum commune contains a pheromone receptor gene and putative pheromone genes. EMBO J. 14:5271-5278[Medline].
YU, H. B., M. KONO, T. D. MCKEE, and D. D. OPRIAN, 1995 A general method for mapping tertiary contacts between amino acid residues in membrane-embedded proteins. Biochemistry 34:14963-14969[Medline].
This article has been cited by other articles:
![]() |
T. Y. James, P. Srivilai, U. Kues, and R. Vilgalys Evolution of the Bipolar Mating System of the Mushroom Coprinellus disseminatus From Its Tetrapolar Ancestors Involves Loss of Mating-Type-Specific Pheromone Receptor Function Genetics, March 1, 2006; 172(3): 1877 - 1891. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Riquelme, M. P. Challen, L. A. Casselton, and A. J. Brown The Origin of Multiple B Mating Specificities in Coprinus cinereus Genetics, July 1, 2005; 170(3): 1105 - 1119. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Brown, S. M. Goldsworthy, A. A. Barnes, M. M. Eilert, L. Tcheang, D. Daniels, A. I. Muir, M. J. Wigglesworth, I. Kinghorn, N. J. Fraser, et al. The Orphan G Protein-coupled Receptors GPR41 and GPR43 Are Activated by Propionate and Other Short Chain Carboxylic Acids J. Biol. Chem., March 21, 2003; 278(13): 11312 - 11319. [Abstract] [Full Text] [PDF] |
||||
![]() |
W.-C. Shen, R. C. Davidson, G. M. Cox, and J. Heitman Pheromones Stimulate Mating and Differentiation via Paracrine and Autocrine Signaling in Cryptococcus neoformans Eukaryot. Cell, June 1, 2002; 1(3): 366 - 377. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. J. Fowler, M. F. Mitton, L. J. Vaillancourt, and C. A. Raper Changes in Mate Recognition Through Alterations of Pheromones and Receptors in the Multisexual Mushroom Fungus Schizophyllum commune Genetics, August 1, 2001; 158(4): 1491 - 1503. [Abstract] [Full Text] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Olesnicky, N. S.
- Articles by Casselton, L. A.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Olesnicky, N. S.
- Articles by Casselton, L. A.








