Genetics, Vol. 156, 513-521, October 2000, Copyright © 2000

Glucose Monitoring in Fission Yeast via the gpa2 G{alpha}, the git5 Gß and the git3 Putative Glucose Receptor

Robert M. Weltona and Charles S. Hoffmana
a Department of Biology, Boston College, Chestnut Hill, Massachusetts 02467

Corresponding author: Charles S. Hoffman, Department of Biology, Boston College, Higgins Hall 401B, Chestnut Hill, MA 02467., hoffmacs{at}bc.edu (E-mail)

Communicating editor: M. JOHNSTON


*  ABSTRACT
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

The fission yeast Schizosaccharomyces pombe responds to environmental glucose by activating adenylate cyclase. The resulting cAMP signal activates protein kinase A (PKA). PKA inhibits glucose starvation-induced processes, such as conjugation and meiosis, and the transcription of the fbp1 gene that encodes the gluconeogenic enzyme fructose-1,6-bisphosphatase. We previously identified a collection of git genes required for glucose repression of fbp1 transcription, including pka1/git6, encoding the PKA catalytic subunit, git2/cyr1, encoding adenylate cyclase, and six "upstream" genes required for adenylate cyclase activation. The git8 gene, identical to gpa2, encodes the alpha subunit of a heterotrimeric guanine-nucleotide binding protein (G{alpha}) while git5 encodes a Gß subunit. Multicopy suppression studies with gpa2+ previously indicated that S. pombe adenylate cyclase activation may resemble that of the mammalian type II enzyme with sequential activation by G{alpha} followed by Gß{gamma}. We show here that an activated allele of gpa2 (gpa2R176H, carrying a mutation in the coding region for the GTPase domain) fully suppresses mutations in git3 and git5, leading to a refinement in our model. We describe the cloning of git3 and show that it encodes a putative seven-transmembrane G protein-coupled receptor. A git3 deletion confers the same phenotypes as deletions of other components of the PKA pathway, including a germination delay, constitutive fbp1 transcription, and starvation-independent conjugation. Since the git3 deletion is fully suppressed by the gpa2R176H allele with respect to fbp1 transcription, git3 appears to encode a G protein-coupled glucose receptor responsible for adenylate cyclase activation in S. pombe.


ENVIRONMENTAL glucose is an important regulator of gene expression and other biological processes in both unicellular organisms and mammalian cells. As such, considerable research has been devoted to the study of glucose detection and the associated signal transduction pathways in a variety of model organisms. These studies have revealed surprising differences with respect to how two key model systems, the bacterium Escherichia coli and the budding yeast Saccharomyces cerevisiae, detect and respond to glucose.

E. coli employs a phosphoenolpyruvate-dependent phosphotransferase system (PTS) that is responsible for both the sensing of glucose and its translocation and phosphorylation to glucose-6-phosphate (reviewed by POSTMA et al. 1993 Down). Therefore, glucose detection in E. coli is intrinsically linked to its uptake. The glucose PTS system regulates alternative carbon source utilization by inhibiting the transport of other carbon sources (inducer exclusion) and by reducing adenylate cyclase activity, thus lowering intracellular cAMP levels. The reduced cAMP level causes a reduction in DNA binding by the cAMP receptor protein, a positive regulator of transcription of operons subject to glucose repression.

Glucose detection in S. cerevisiae occurs through multiple mechanisms that are still actively under examination. One type of glucose sensor, encoded by RGT2 and SNF3, resembles a 12-transmembrane hexose transporter (reviewed by OZCAN and JOHNSTON 1999 Down). A second glucose detection system is responsible for adenylate cyclase activation. The GPR1 and GPA2 genes, encoding a putative seven-transmembrane protein and a heterotrimeric G protein alpha subunit (G{alpha}), respectively, are key components in this glucose-detection pathway (COLOMBO et al. 1998 Down; XUE et al. 1998 Down; YUN et al. 1998 Down; KRAAKMAN et al. 1999 Down; LORENZ et al. 2000 Down). While the Gpa2 G{alpha} does not appear to interact with a classical Gß{gamma} dimer, it is unclear whether it functions as a monomer or within some other protein complex. Gpr1 and Gpa2 have also been implicated in the control of pseudohyphal growth (LORENZ and HEITMAN 1997 Down; ANSARI et al. 1999 Down; PAN and HEITMAN 1999 Down), with key roles postulated for both the Mep2 permease as an ammonium sensor and Gpr1 as a carbon source sensor (LORENZ and HEITMAN 1998 Down; LORENZ et al. 2000 Down).

The fission yeast Schizosaccharomyces pombe monitors glucose to regulate a wide range of biological processes. Our studies focus on the transcriptional regulation of the glucose-repressed fbp1 gene that encodes the gluconeogenic enzyme fructose-1,6-bisphosphatase (VASSAROTTI and FRIESEN 1985 Down). Previously, we identified mutations in genes that confer constitutive fbp1 transcription (HOFFMAN and WINSTON 1990 Down). These git (glucose insensitive transcription) genes act in a PKA pathway (HOFFMAN and WINSTON 1991 Down; BYRNE and HOFFMAN 1993 Down). The git2 gene, identical to cyr1 (YAMAWAKI-KATAOKA et al. 1989 Down; YOUNG et al. 1989 Down; MAEDA et al. 1990 Down), encodes adenylate cyclase (HOFFMAN and WINSTON 1991 Down); the git6 gene, identical to pka1 (MAEDA et al. 1994 Down), encodes the catalytic subunit of PKA (JIN et al. 1995 Down). The remaining six genes, git1, git3, git5, git7, git8, and git10, are required for glucose-triggered adenylate cyclase activation. Mutations in these "upstream" git genes are suppressed by multicopy git2+ or by exogenous cAMP (HOFFMAN and WINSTON 1991 Down), and strains carrying mutations in any of these genes fail to elevate intracellular cAMP levels in response to glucose (BYRNE and HOFFMAN 1993 Down). The git8 gene, identical to gpa2, encodes a G{alpha} subunit (ISSHIKI et al. 1992 Down; NOCERO et al. 1994 Down). Multicopy gpa2+ partially suppresses mutations in git3 and git5 but not in the other upstream git genes (NOCERO et al. 1994 Down; LANDRY et al. 2000 Down). The git5 gene encodes a Gß subunit that acts as a positive regulator of the gpa2 G{alpha} (LANDRY et al. 2000 Down).

In this article, we further characterize the genetic interactions between gpa2 and the other upstream git genes through the use of an "activated" allele of gpa2 whose product is defective in its autoinhibitory GTPase activity. Furthermore, we describe the cloning and characterization of git3 and provide genetic evidence that it encodes the G protein-coupled receptor responsible for the activation of adenylate cyclase through gpa2.


*  MATERIALS AND METHODS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Yeast strains and growth media:
S. pombe strains used in this study are listed in Table 1. The fbp1::ura4+ allele is a disruption of the fbp1 gene by the coding region of the ura4 gene, creating a translational fusion that is under the transcriptional control of the fbp1 promoter. The ura4::fbp1-lacZ allele is a disruption of the ura4 gene by an fbp1-lacZ translational fusion (HOFFMAN and WINSTON 1990 Down).


 
View this table:
In this window
In a new window

 
Table 1. Strain list

Standard rich media YEA and YEL (GUTZ et al. 1974 Down) were supplemented with 2% casamino acids. PM media (WATANABE et al. 1988 Down) were supplemented with required nutrients at 75 mg/liter, except for leucine which was at 150 mg/liter. Glucose was present at a concentration of 3%, unless otherwise specified. Sensitivity to 5-fluoro-orotic acid (5-FOA) was determined on SC solid medium containing 0.4 g/liter 5-FOA and 8% glucose as previously described (HOFFMAN and WINSTON 1990 Down). Strains were grown at 30°. Crosses were performed on SPA (GUTZ et al. 1974 Down) following pregrowth on PM medium.

Epistasis testing:
Epistasis tests were conducted by examining progeny from tetrad dissections of crosses of RWP4 (gpa2R176H) with strains carrying mutations in git1, git2, git3, git5, pka1/git6, git7, and git10. Following germination and colony formation, progeny were transferred to a fresh YEA plate, grown 1 day, and then replica plated to 5-FOA-containing medium. 5-FOA resistance was determined 2–3 days after replica plating.

ß-Galactosidase assays:
ß-Galactosidase activity, expressed from the fbp1-lacZ reporter, was determined as previously described (NOCERO et al. 1994 Down). Strains were pregrown in PM medium under repressing conditions (8% glucose) to exponential phase, washed twice with sterile water, and then subcultured in PM medium containing 8% glucose (repressing conditions) or 0.1% glucose plus 3% glycerol (derepressing conditions) for 24 hr. Soluble protein extracts were prepared by glass bead lysis. Two volumes of each extract were assayed to determine ß-galactosidase activity. Total soluble protein was measured by BCA assay (Pierce Chemical Co., Rockford, IL) to calculate ß-galactosidase-specific activity in extracts.

Recombinant DNA methodology:
Standard recombinant DNA techniques, including DNA restriction digests, ligations, and E. coli transformations, were performed according to AUSUBEL et al. 1998 Down. Restriction enzymes and T4 DNA ligase were purchased from New England Biolabs (Beverly, MA). Plasmid transformations of yeast were carried out as previously described (DAL SANTO et al. 1996 Down). DNA sequencing was performed using ABI's (Foster City, CA) big dye terminators on an ABI 377XL automated sequencer by Bioserve Biotechnologies, Ltd. (Laurel, MD) with custom oligonucleotides to sequence both strands of the git3 gene at least once. The GenBank accession no. of this sequence is AF085162.

Cosmid and P1 filter hybridization:
Plasmid pRW1 carries a 4.2-kb fragment of S. pombe chromosome 3 genomic DNA from the 5' end of the git3 gene through to the 3' end of the rec7 (Fig 1A). Cosmid and P1 library clones carrying the intact git3 gene were identified by probing high-density filters from the Resource Center/Primary Database of the German Human Genome Project (RZPD, Berlin, Germany; ZEHETNER and LEHRACH 1994 Down) containing cosmid and P1-cloned S. pombe genomic libraries. Filters (cosmid library no. 60 and P1 library no. 705) were probed with a 2.9-kb SacI fragment from plasmid pRW1 (Fig 1A, "filter probe") that had been gel purified and labeled by random priming. Prehybridization and hybridization of filters were done according to the protocol provided by the RZPD. Grid coordinates of positive clones were determined by probing filters with nick-translated pBluescript II SK+. Positive cosmid and P1 clones were obtained from the RZPD.



View larger version (18K):
In this window
In a new window
Download PPT slide
 
Figure 1. Schematic of git3 disruption by plasmid pAF1 (OHI et al. 1996 Down) and subcloning analyses. (A) Structure of the pAF1 insertion into the git3 gene in strain CHP616. Sites for restriction enzymes SacI (SI), SacII (SII), and EcoRI (E) are indicated. The git3 (open box), rec7 (solid box), and his3 (hatched box, the selectable marker on pAF1) are also shown. Plasmid pRW1, rescued by SacII digestion and ligation of CHP616 genomic DNA (HOFFMAN and WELTON 2000 Down), carries 4.2 kb of flanking genomic DNA from the 5' end of git3 (git3') to the 3' end of rec7 ('rec7). The "filter probe" is a 2.9-kb SacI restriction fragment from pRW1. (B) Restriction maps of inserts in plasmids pRW2, pRW3, and pRW4. Plasmids pRW2 and pRW3 carry functional git3 clones, while pRW4 is nonfunctional. Restriction sites for SacI (SI), HindIII (H), and SpeI (Sp) are shown.

Cloning of the git3 gene:
DNA from the candidate cosmid (ICRFc60A231Q) and from six P1 clones (ICRFP705: L127Q, F024Q, E051Q, E161Q, I221Q, and O132Q) was digested with SacI and examined by Southern hybridization analysis using nick-translated plasmid pRW1. A 0.4-kb fragment identified clones carrying the git3 gene. On the basis of the restriction map surrounding the git3 locus, a 4.5-kb SacI fragment from cosmid ICRFc60A231Q was gel purified and inserted into SacI-digested pSP1 (COTTAREL et al. 1993 Down) to create plasmid pRW2. Complementation of the git3-14 mutation in strain CHP14 by plasmid pRW2 indicated that this plasmid carried a functional copy of the git3 gene. Plasmids pRW3 and pRW4 were constructed by digesting plasmid pRW2 with HindIII or SpeI, respectively, and religating with T4 DNA ligase to drop out portions of the pRW2 insert DNA as diagrammed in Fig 1B.

Construction of a git3 deletion:
Deletion of the git3 gene was accomplished by a PCR-based strategy according to the protocol of BAHLER et al. 1998 Down. Oligonucleotides git3-fordelta, 5'-CTCACCTCCTCTCCTCTCTTTTTTTTTCCTGTCTT CTTGAAGAGAAGTTTAAACTTTGTAATAAGGAACAAGGTT GCTCCGGATCCCCGGGTTAATTAA-3' and git3-reverse, 5'-CCATCTTCCAATCCGAGCCTTTTGCCAAGTTAAGTAGTGCCAAAATTTAATACTTCGAAATAAATTCTGGGAAGCGAGAATTCGAGCTCGTTTAAA C-3' (Integrated DNA Technologies, Coralville, IA) were used to PCR amplify the kan-selectable marker from plasmid pFA6a-GFP(S65T)-kanMX6 (WACH et al. 1997 Down) such that the amplified marker was flanked with sequences from either side of the git3 open reading frame. The 2.6-kb PCR product was used to transform strain FWP72 to G418-resistance using the DMSO transformation protocol to ensure a high efficiency of homologous recombination (BAHLER et al. 1998 Down). Stable G418-resistant transformants were analyzed by Southern hybridization for the presence of a 5.1-kb SacI fragment when probed with the 4.5-kb SacI fragment from plasmid pRW2, indicating homologous insertion of the PCR product and the deletion of the git3 gene.


*  RESULTS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Epistatic relationship between gpa2R176H and "upstream" git mutant alleles:
The gpa2, git1, git3, git5, git7, and git10 genes are all required for both glucose repression of fbp1 transcription and for the production of a glucose-triggered cAMP response in S. pombe (HOFFMAN and WINSTON 1990 Down, HOFFMAN and WINSTON 1991 Down; ISSHIKI et al. 1992 Down; BYRNE and HOFFMAN 1993 Down; NOCERO et al. 1994 Down). It was previously shown that multicopy gpa2+ suppresses mutations in git3 and git5 but has no effect on mutations in git1, git7, and git10 (NOCERO et al. 1994 Down). However, a quantitative analysis of the multicopy gpa2+ suppression of a git5{Delta} deletion allele has shown that suppression is only partial (LANDRY et al. 2000 Down). Since G{alpha} subunits are post-translationally modified and their activity depends upon the exchange of the bound guanine nucleotide from GDP to GTP (CASEY 1994 Down), overexpression of a G{alpha} subunit would not necessarily bypass the need for its proper modification and regulation. Therefore, the failure of multicopy gpa2+ to suppress mutations in git1, git7, or git10 does not eliminate the possibility that these genes function to regulate gpa2 activity. Similarly, the fact that multicopy gpa2+ only partially suppresses mutations in git3 or git5 does not prove additional roles for these genes beyond the activation of gpa2. We reexamined these genetic interactions using an activated allele of gpa2 that carries a mutation predicted to inactivate the GTPase domain responsible for converting the gpa2 G{alpha} from its GTP-bound active state to its GDP-bound inactive state (ISSHIKI et al. 1992 Down). Strains carrying this mutant allele display a partial mating defect and increased cAMP levels (when combined with a mutation in the pde1/cgs2 cAMP phosphodiesterase gene; ISSHIKI et al. 1992 Down) along with a partial defect in derepressing fbp1 transcription (see below). These phenotypes are consistent with an increase in adenylate cyclase activation.

To test the ability of the gpa2R176H mutant allele to suppress mutations in git1, git3, git5, git7, or git10, we performed pairwise crosses between strain RWP4 (gpa2R176H) and strains carrying mutations in these genes. The git mutant strains are 5-FOA-sensitive (5-FOAS) due to a defect in glucose repression of an integrated fbp1-ura4 reporter (HOFFMAN and WINSTON 1990 Down), while strains that glucose repress fbp1-ura4 transcription are 5-FOA resistant (5-FOAR). If gpa2R176H fails to suppress the git mutation in the mating partner, all tetrads should display a 2:2 5-FOAR:5-FOAS pattern based on segregation of the git mutant allele. If suppression occurs, only git- gpa2+ progeny will be 5-FOAS. Thus tetratype and nonparental ditype tetrads will contain more than two 5-FOAR progeny. While a 2:2 pattern would also result if only parental ditypes were examined, our sample size of 9–15 tetrads makes this highly unlikely given the frequency of tetratype tetrads present in similar crosses involving gpa2 loss-of-function alleles (HOFFMAN and WINSTON 1990 Down). By this analysis, the gpa2R176H allele suppresses mutations in git3 and git5, but not in git1, git7, or git10. As expected, gpa2R176H fails to suppress either a git2{Delta} deletion allele or a pka1-107 mutation. Similarly, gpa2R176H fails to suppress git2-7 or git2-61. These git2 alleles display intragenic complementation, suggesting that they affect two distinct functions of adenylate cyclase (HOFFMAN and WINSTON 1991 Down).

Effect of gpa2R176H on fbp1-lacZ expression:
While the gpa2R176H suppression of a git3 or git5 mutation is qualitatively similar to the multicopy gpa2+ suppression data (NOCERO et al. 1994 Down), we observe distinct quantitative differences in the suppression. Multicopy gpa2+ suppression of a git5{Delta} allele is only fivefold (LANDRY et al. 2000 Down). This partial suppression supports a model in which S. pombe adenylate cyclase is activated by a mechanism similar to that of the type II mammalian enzyme (TANG and GILMAN 1991 Down) with the gpa2 G{alpha} carrying out an initial activation step and the git5 Gß carrying out a subsequent activation step. Alternatively, partial suppression may simply indicate that much of the overexpressed wild-type gpa2 is in the inactive, GDP-bound form. Unlike multicopy gpa2+, the gpa2R176H allele completely suppresses a git3 mutation or a git5 deletion in cells grown under repressing conditions (Table 2). In addition, the gpa2R176H allele on its own inhibits fbp1-lacZ expression in derepressed cells by approximately fourfold. Since suppression by gpa2R176H is complete, git3 and git5 may function solely to activate gpa2. Thus, the activation of S. pombe adenylate cyclase is not like that of the type II mammalian enzyme.


 
View this table:
In this window
In a new window

 
Table 2. Suppression of git3 and git5 mutations by gpa2R176H

Cloning of the git3 gene:
In the course of a study to create novel git mutant strains by nonhomologous plasmid insertion, we identified strain CHP616 carrying an insertion of plasmid pAF1 (OHI et al. 1996 Down) in the previously uncloned git3 gene as judged by linkage and complementation tests (HOFFMAN and WELTON 2000 Down). Plasmid p616E was obtained by EcoRI restriction digestion and ligation of CHP616 genomic DNA, followed by transformation of E. coli to ampicillin resistance (HOFFMAN and WELTON 2000 Down). This plasmid carries 0.9 kb of genomic DNA adjacent to the site of pAF1 insertion in strain CHP616. DNA sequence analysis of this insert indicated that this region of the genome had not been previously cloned or sequenced.

To clone an intact copy of the git3 gene, we first rescued a larger region of the flanking genomic DNA using SacII to digest the genomic DNA prior to ligation. This provided us with both additional sequence information and a larger hybridization probe with which to detect cosmid and P1 library clones carrying the git3 gene. Plasmid pRW1 carries 4.2 kb of genomic DNA (Fig 1A). Restriction mapping of pRW1 identified the positions of SacI sites within this region, while DNA sequencing across the SacII cloning junction indicated that git3 is adjacent to rec7 (LIN et al. 1992 Down). Using a 2.9-kb SacI fragment from pRW1 as a hybridization probe (one SacI site comes from the cloning polylinker of plasmid pAF1 while the other lies between rec7 and git3; Fig 1A, filter probe), we identified candidate P1 and cosmid clones of git3 from high density library filters (data not shown). Six P1 and one cosmid candidate indicated by filter hybridization were obtained from the Resource Center/Primary Database of the RZPD and analyzed by Southern hybridization. Three of six P1 clones and the one cosmid clone contained three SacI insert fragments that hybridized with a pRW1 probe. The SacI fragments included the 0.4-kb fragment predicted from the restriction map of pRW1 (Fig 1A), along with a 4.5- and a 6.1-kb fragment. On the basis of restriction mapping of the original rec7 clone, we inferred that the 6.1-kb fragment represents the region extending beyond rec7, while the 4.5-kb fragment is likely to encompass git3 (diagrammed in Fig 1A). The 4.5-kb SacI fragment from cosmid ICRFc60A231Q was cloned into pSP1 (COTTAREL et al. 1993 Down) to create pRW2. Plasmid pRW2 carries git3 as it confers 5-FOA resistance upon strain CHP14 (git3-14). The git3 gene was further localized within the 4.5-kb SacI fragment in pRW2 to a 2.15-kb HindIII-SacI fragment by subcloning and testing for git3 function (Fig 1B) as determined by suppression of the 5-FOAS phenotype of strain CHP14 (git3-14).

Subcloning and sequence analysis of git3:
DNA sequencing of the insert in plasmid pRW3 (GenBank accession no. AF085162) reveals a single open reading frame encoding a 466-amino-acid protein. BLASTP analysis reveals that git3 is distantly related to the S. cerevisiae Gpr1 putative G protein-coupled receptor (Fig 2A). The git3 protein is predicted to possess seven transmembrane domains and displays additional features of a seven-transmembrane G protein-coupled receptor. These include a series of charged residues at either end of the third cytoplasmic loop (BALDWIN 1994 Down) and cysteine residues in both the first and second extracellular domains that are likely to form a disulfide bond (NODA et al. 1994 Down).



View larger version (56K):
In this window
In a new window
Download PPT slide
 
Figure 2. The amino-acid sequence alignment between the predicted git3 protein and a portion of the S. cerevisiae Gpr1 putative G protein-coupled receptor. The putative git3 protein (accession no. AAC-69337) was aligned with residues 25–280 of the 961-amino-acid Gpr1 sequence (accession no. NP010249) using the Clustal W (version 1.8) sequence alignment program (THOMPSON et al. 1994 Down) and displayed using BOXSHADE. This region includes the first five of the seven predicted transmembrane domains (Tm1–Tm7) in git3. Additional features of G protein-coupled receptors present in git3, a cysteine residue in both the first and second extracellular loops (indicated by arrows between Tm2 and Tm3, and between Tm4 and Tm5), and two clusters of charged residues (+ and -) at the N-terminal and C-terminal ends of the third intracellular loop (between Tm5 and Tm6), are shown.

A git3 deletion confers phenotypes associated with defects in glucose detection:
Deletion of git3 (git3{Delta}; see MATERIALS AND METHODS) confers phenotypes associated with other mutations in the PKA glucose monitoring pathway. Spores lacking git3 (Fig 3; progeny 2C and 3D) display a germination delay similar to those lacking pka1 (Fig 3; progeny 2A). Loss of both git3 and pka1 (Fig 3; progeny 1B, 1C, 2D, 3A, 4B, and 4D) does not create any additional delay in germination, indicating that the two proteins act in the same pathway.



View larger version (46K):
In this window
In a new window
Download PPT slide
 
Figure 3. Both git3{Delta} and pka1{Delta} spores display a germination delay. Tetrads from a cross of FWP94 (git3+ pka1+) by RWP35 (git3{Delta}::kan pka1{Delta}::ura4+) were dissected on YEA at 30° and photographed after 5 days. The colonies were grown 1 additional day before replica plating to YEA + G418 (to identify git3{Delta} strains) and to PM-ura (to identify pka1{Delta} strains). These plates were incubated 2 days at 30° and photographed.

Phenotypic characterization of git3{Delta} strains shows that they resemble adenylate cyclase deletion (git2{Delta}) strains. These strains are derepressed for fbp1-ura4 expression, thereby allowing significant growth on glucose-rich medium lacking uracil and conferring sensitivity to 5-FOA (Fig 4). In addition, these strains fail to glucose repress gluconate uptake that is negatively regulated by PKA (CASPARI 1997 Down), thus abolishing the growth lag observed in wild-type cells upon transfer from a glucose-rich medium to a gluconate-based medium (Fig 4).



View larger version (56K):
In this window
In a new window
Download PPT slide
 
Figure 4. Growth characteristics of a git3{Delta} strain reflect a defect in glucose monitoring. Strains FWP72 (wild type), RWP9 (git3{Delta}), and CHP495 (git2{Delta}) were grown to exponential phase in PM liquid medium (8% glucose), washed and adjusted to 107 cells/ml in water, and spotted to YEA, SC-ura, PM (3% gluconate), and 5-FOA media. The growth was recorded after 2 days for the YEA and SC-ura plates and after 5 days for the PM (3% gluconate) and 5-FOA plates.

When crossed into a homothallic (h90) strain background, the git3 deletion confers the same starvation-independent mating and sporulation phenotype seen in a gpa2{Delta} strain (Fig 5; ISSHIKI et al. 1992 Down) and in git5, git2, or pka1 mutant strains (LANDRY et al. 2000 Down; MAEDA et al. 1990 Down, MAEDA et al. 1994 Down). The addition of cAMP to the growth medium suppresses this defect, suggesting that the unregulated mating of the git3{Delta} cells is due to a defect in glucose-triggered adenylate cyclase activation (Fig 5).



View larger version (103K):
In this window
In a new window
Download PPT slide
 
Figure 5. Starvation-independent sexual development in a git3{Delta} homothallic strain. Cells of homothallic strains CHP483 (wild type), RWP28 (git3{Delta}), and CHP482 (gpa2{Delta}) were grown to log phase in PM liquid medium (at 37° to inhibit conjugation) and then diluted to 106 cells/ml in PM liquid medium with or without 5 mM cAMP. These cells were incubated 24 hr at 30° without shaking and photographed.

git3{Delta} strains display a more pronounced defect in fbp1-lacZ regulation than do git3 spontaneous mutants:
Our initial studies indicated that the derepression of fbp1 transcription caused by mutations in git3 is half that conferred by a mutation or deletion of the gpa2 (git8) gene (HOFFMAN and WINSTON 1990 Down, HOFFMAN and WINSTON 1991 Down; NOCERO et al. 1994 Down). Since the git3{Delta} mutation confers the same high-level fbp1-lacZ expression as does a gpa2{Delta} allele (Table 3) and twice that conferred by the git3-14 mutation (Table 2), we presume that the spontaneous git3 mutant alleles retain some function.


 
View this table:
In this window
In a new window

 
Table 3. Effect of mutations in git3 and gpa2 on fbp1-lacZ expression

We previously observed that a git3 mutation causes a further increase in fbp1 expression in strains carrying a gpa2 point mutation or deletion (HOFFMAN and WINSTON 1990 Down; NOCERO et al. 1994 Down). Consistent with these results, a git3{Delta} gpa2{Delta} double deletion strain (RWP22) expresses the fbp1-lacZ reporter to higher levels than either git3{Delta} or gpa2{Delta} strains (Table 3). This may suggest that git3 has a gpa2-independent function. However, since gpa2R176H fully suppresses git3{Delta} (RWP32, Table 3), it appears that the primary function of git3 is to activate the gpa2 G{alpha}.

Multicopy git3+ fails to suppress mutations in other genes required for adenylate cyclase activation:
Multicopy suppression analyses have been used to identify functional relationships among genes of the glucose/cAMP pathway. The git2 (adenylate cyclase) gene was originally cloned as a multicopy suppressor of a git1 mutation and was also shown to suppress mutations in git3, git5, git7, gpa2 (git8), and git10 (HOFFMAN and WINSTON 1991 Down). This suppression led us to identify these genes as encoding components of an adenylate cyclase pathway in that they are required for the production of a glucose-triggered cAMP signal (BYRNE and HOFFMAN 1993 Down). Multicopy gpa2, encoding the G{alpha} subunit, suppresses mutations in git5 (Gß) and git3, indicating that these two genes act to regulate the activation of the gpa2 G{alpha} (NOCERO et al. 1994 Down). We tested whether multicopy git3 could suppress mutations in git1, git3, git5, git7, gpa2, or git10. While transformation by plasmid pRW2 (see Fig 1B) restores git3 mutant strains to 5-FOA resistance due to glucose repression of the fbp1-ura4 reporter, it has no effect on git1, git5, git7, gpa2, or git10 mutant strains (data not shown).


*  DISCUSSION
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Both the gpa2 G{alpha} and git5 Gß are required for S. pombe adenylate cyclase activation; however, the precise role of the Gß subunit has been unclear (ISSHIKI et al. 1992 Down; NOCERO et al. 1994 Down; LANDRY et al. 2000 Down). Mammalian adenylate cyclases are also regulated by G proteins, with the various adenylate cyclase isoforms displaying different sensitivities to the individual G protein subunits (reviewed by CHOI et al. 1993 Down; TAUSSIG and GILMAN 1995 Down). While all are stimulated by Gs{alpha} subunits, the type I enzyme is inhibited by Gß{gamma} dimers, the type II enzyme is further activated by Gß{gamma}, and the type III enzyme is insensitive to Gß{gamma} (TANG and GILMAN 1991 Down; TANG et al. 1992 Down). Thus, there is no single model for the mode of action of G protein subunits in adenylate cyclase activation. The git5 Gß may simply be important for the activation of the gpa2 G{alpha} by facilitating efficient coupling of the G{alpha} to a receptor that promotes GDP release to allow G{alpha} to bind GTP and attain the active conformation. Alternatively, or in addition, the Gß may directly activate adenylate cyclase as in the case of the type II mammalian enzyme. This possibility was supported by the fact that multicopy gpa2+ only partially suppressed the loss of the git5 Gß gene (NOCERO et al. 1994 Down; LANDRY et al. 2000 Down). However, we have shown here that the gpa2R176H activated allele restores full repression of fbp1 transcription in the absence of the git5 Gß subunit. This complete suppression suggests that the Gß subunit may have no role beyond delivery of the G{alpha} to the receptor.

The genetic interactions between gpa2 and git5 are very different from those observed in the G protein-mediated S. cerevisiae pheromone response pathway, in which the Gß{gamma} dimer activates a mitogen-activated protein kinase (MAPK) pathway (HIRSCH and CROSS 1992 Down). In this system, the G{alpha} subunit negatively regulates signaling by sequestering the Gß{gamma} dimer in the inactive heterotrimer. The pathway is activated when the pheromone receptor binds the appropriate pheromone and causes the activation of the G protein. The G{alpha} subunit presumably undergoes a conformational change as it releases GDP and binds GTP, causing it to dissociate from the Gß{gamma} dimer that is then free to activate the MAPK pathway. As such, a mutation in the GPA1/SCG1 G{alpha} gene activates the pathway by alleviating the regulation of Gß{gamma}, while mutations in either the STE4 Gß gene or the STE18 G{gamma} gene prevent pathway activation (WHITEWAY et al. 1989 Down). The opposing phenotypes associated with a defect in G{alpha} vs.{gamma} are due to the fact that the activation of Gß{gamma} simply requires its release from G{alpha} with no additional conformational change occurring in Gß{gamma} as indicated by crystal structure studies (SONDEK et al. 1996 Down). On the other hand, the conformation of G{alpha} is not dependent upon the presence or absence of Gß{gamma}, but on the binding of GDP (inactive conformation) vs. GTP (active conformation). Therefore, the loss of Gß{gamma} in a system in which G{alpha} activates the downstream effector would not only fail to activate the pathway, but would likely reduce signaling by reducing the interaction between the G{alpha} subunit and the receptor. This model is consistent with our data regarding gpa2, git5, and adenylate cyclase activation in S. pombe.

Of the six upstream git genes required for glucose-triggered adenylate cyclase activation, gpa2R176H only suppressed mutations in git5 (Gß) and git3 (Table 2). This genetic interaction, along with the sequence analysis of the git3 gene (Fig 2), suggests that git3 encodes a G protein-coupled glucose receptor responsible for adenylate cyclase activation. Cells lacking git3 display a profound defect in glucose detection (Table 3; Fig 3 Fig 4 Fig 5), consistent with our previous observation that a git3 mutant fails to produce a cAMP response to glucose (BYRNE and HOFFMAN 1993 Down). The git3{Delta} phenotypes include a germination delay, derepression of fbp1 transcription, a defect in glucose repression of gluconate uptake, and starvation-independent conjugation and sporulation. These are very distinct processes, but are all subject to inhibition by PKA. In addition, multicopy git3 fails to suppress mutations in the other upstream git genes, as expected for a gene acting at the top of a signaling pathway. Also consistent with a role as a glucose receptor, the germination delay due to the loss of git3 is not additive with the delay due to the loss of PKA (Fig 3). This result also argues against the possibility that git3 activates other nutrient sensing pathways. We previously showed that loss of both PKA and the sck1 kinase results in a dramatic enhancement of both the germination delay and the exit from stationary phase seen in cells lacking PKA alone (JIN et al. 1995 Down). We would have expected a similar enhancement if git3 stimulated other signaling pathways.

It remains possible that git3 carries out some additional function besides the activation of gpa2 in response to glucose detection. Expression from the fbp1-lacZ reporter is higher in a git3{Delta} gpa2{Delta} double deletion strain (RWP22) than in a gpa2{Delta} single deletion strain (CHP459; Table 3). If git3 only acted to regulate gpa2, the deletion of git3 in a gpa2{Delta} background would have had no effect. However, the complete suppression of a git3 deletion by the gpa2R176H allele indicates that any G protein-independent activity of git3 only plays a minor role in glucose monitoring.

Since gpa2R176H git3{Delta} cells are still able to respond to glucose starvation by derepressing fbp1-lacZ expression 70-fold (Table 3), the glucose starvation response is git3 independent. Glucose starvation is one of several environmental stresses that activate the spc1/sty1 MAPK pathway in S. pombe (DEGOLS et al. 1996 Down; SHIOZAKI and RUSSELL 1996 Down; STETTLER et al. 1996 Down; SAMEJIMA et al. 1997 Down). This MAPK activates the atf1-pcr1 transcriptional activator that is partially responsible for derepression of fbp1 transcription (TAKEDA et al. 1995 Down; KANOH et al. 1996 Down; SHIOZAKI and RUSSELL 1996 Down; WILKINSON et al. 1996 Down). Glucose repression of fbp1 transcription in wild-type cells is due to a combination of an inhibitory signal from the PKA pathway and the lack of an activating signal from the MAPK pathway. Glucose starvation triggers derepression of fbp1 transcription by reducing PKA repression and stimulating MAPK-dependent transcriptional activation. Therefore, it is likely that the starvation response observed in gpa2R176H git3{Delta} cells is due to activation of the MAPK pathway.

While the glucose detection system described here most resembles the S. cerevisiae Gpr1-Gpa2 pathway that is also responsible for adenylate cyclase activation, there are some interesting differences. The git3 and Gpr1 proteins are only somewhat related, with the homology limited to transmembrane domains 1–5. Gpr1, a 961-residue protein, is predicted to have a 350-residue third cytoplasmic loop and a 280-residue cytoplasmic tail, while git3, a 466-residue protein, is predicted to have a 159-residue third cytoplasmic loop and a 35-residue cytoplasmic tail (Fig 2A). In addition, Gpr1 possesses a poly-asparagine track, not present in git3. The S. cerevisiae Gpa2 G{alpha} is also significantly larger than the S. pombe gpa2 G{alpha}, with an additional 90 amino acids at the N terminus (NAKAFUKU et al. 1988 Down; ISSHIKI et al. 1992 Down). These regions of the S. cerevisiae Gpr1 and Gpa2 proteins not found in the S. pombe git3 and gpa2 proteins may allow for efficient coupling in the absence of a Gß{gamma} dimer in S. cerevisiae, whereas the git5 Gß is required for normal glucose detection in S. pombe (LANDRY et al. 2000 Down). Further characterization of the structure, function, and regulation of the git3 protein, as well as the gpa2-containing G protein, will provide us with a valuable model system for the study of G protein signaling that is fundamentally different from the {gamma}-driven S. cerevisiae pheromone signaling pathway.


*  ACKNOWLEDGMENTS

We thank Masayuki Yamamoto for the original gpa2R176H strain and Jürg Bähler for materials and advice regarding PCR-based gene disruptions. We thank Junona Moroianu for the use of her microscope. This work was funded by National Institutes of Health grant GM-46226 to C.S.H.

Manuscript received January 31, 2000; Accepted for publication June 9, 2000.


*  LITERATURE CITED
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

ANSARI, K., S. MARTIN, M. FARKASOVSKY, I. M. EHBRECHT, and H. KUNTZEL, 1999  Phospholipase C binds to the receptor-like GPR1 protein and controls pseudohyphal differentiation in Saccharomyces cerevisiae.. J. Biol. Chem. 274:30052-30058[Abstract/Free Full Text].

AUSUBEL, F. M., R. BRENT, R. E. KINGSTON, D. D. MOORE, J. G. SEIDMAN et al., 1998 Current Protocols in Molecular Biology. Wiley Interscience, New York.

BAHLER, J., J. Q. WU, M. S. LONGTINE, N. G. SHAH, and A. MCKENZIE, III et al., 1998  Heterologous modules for efficient and versatile PCR-based gene targeting in Schizosaccharomyces pombe. Yeast 14:943-951[Medline].

BALDWIN, J. M., 1994  Structure and function of receptors coupled to G proteins. Curr. Opin. Cell Biol. 6:180-190[Medline].

BYRNE, S. M. and C. S. HOFFMAN, 1993  Six git genes encode a glucose-induced adenylate cyclase activation pathway in the fission yeast Schizosaccharomyces pombe.. J. Cell Sci. 105:1095-1100[Abstract].

CASEY, P. J., 1994  Lipid modifications of G proteins. Curr. Opin. Cell Biol. 6:219-225[Medline].

CASPARI, T., 1997  Onset of gluconate-H+ symport in Schizosaccharomyces pombe is regulated by the kinases Wis1 and Pka1, and requires the gti1+ gene product. J. Cell Sci. 110:2599-2608[Abstract].

CHOI, E. J., Z. XIA, E. C. VILLACRES, and D. R. STORM, 1993  The regulatory diversity of the mammalian adenylyl cyclases. Curr. Opin. Cell Biol. 5:269-273[Medline].

COLOMBO, S., P. MA, L. CAUWENBERG, J. WINDERICKX, and M. CRAUWELS et al., 1998  Involvement of distinct G-proteins, Gpa2 and Ras, in glucose- and intracellular acidification-induced cAMP signalling in the yeast Saccharomyces cerevisiae.. EMBO J. 17:3326-3341[Medline].

COTTAREL, G., D. BEACH, and U. DEUSCHLE, 1993  Two new multi-purpose multicopy Schizosaccharomyces pombe shuttle vectors, pSP1 and pSP2. Curr. Genet. 23:547-548[Medline].

DAL SANTO, P., B. BLANCHARD, and C. S. HOFFMAN, 1996  The Schizosaccharomyces pombe pyp1 protein tyrosine phosphatase negatively regulates nutrient monitoring pathways. J. Cell Sci. 109:1919-1925[Abstract].

DEGOLS, G., K. SHIOZAKI, and P. RUSSELL, 1996  Activation and regulation of the Spc1 stress-activated protein kinase in Schizosaccharomyces pombe.. Mol. Cell. Biol. 16:2870-2877[Abstract].

GUTZ, H., H. HESLOT, U. LEUPOLD and N. LOPRIENO, 1974 Schizosaccharomyces pombe, pp. 395–446 in Handbook of Genetics, edited by R. C. KING. Plenum Press, New York.

HIRSCH, J. P. and F. R. CROSS, 1992  Pheromone response in yeast. Bioessays 14:367-373[Medline].

HOFFMAN, C. S. and R. WELTON, 2000  Mutagenesis and gene cloning in Schizosaccharomyces pombe via nonhomologous plasmid integration and rescue. Biotechniques 28:532-536. 538, 540[Medline].

HOFFMAN, C. S. and F. WINSTON, 1990  Isolation and characterization of mutants constitutive for expression of the fbp1 gene of Schizosaccharomyces pombe.. Genetics 124:807-816[Abstract].

HOFFMAN, C. S. and F. WINSTON, 1991  Glucose repression of transcription of the Schizosaccharomyces pombe fbp1 gene occurs by a cAMP signaling pathway. Genes Dev. 5:561-571[Abstract/Free Full Text].

ISSHIKI, T., N. MOCHIZUKI, T. MAEDA, and M. YAMAMOTO, 1992  Characterization of a fission yeast gene, gpa2, that encodes a G alpha subunit involved in the monitoring of nutrition. Genes Dev. 6:2455-2462[Abstract/Free Full Text].

JIN, M., M. FUJITA, B. M. CULLEY, E. APOLINARIO, and M. YAMAMOTO et al., 1995  sck1, a high copy number suppressor of defects in the cAMP-dependent protein kinase pathway in fission yeast, encodes a protein homologous to the Saccharomyces cerevisiae SCH9 kinase. Genetics 140:457-467[Abstract].

KANOH, J., Y. WATANABE, M. OHSUGI, Y. IINO, and M. YAMAMOTO, 1996  Schizosaccharomyces pombe gad7+ encodes a phosphoprotein with a bZIP domain, which is required for proper G1 arrest and gene expression under nitrogen starvation. Genes Cells 1:391-408[Abstract].

KRAAKMAN, L., K. LEMAIRE, P. MA, A. W. TEUNISSEN, and M. C. DONATON et al., 1999  A Saccharomyces cerevisiae G-protein coupled receptor, Gpr1, is specifically required for glucose activation of the cAMP pathway during the transition to growth on glucose. Mol. Microbiol. 32:1002-1012[Medline].

LANDRY, S., M. T. PETTIT, E. APOLINARIO, and C. S. HOFFMAN, 2000  The fission yeast git5 gene encodes a Gß subunit required for glucose-triggered adenylate cyclase activation. Genetics 154:1463-1471[Abstract/Free Full Text].

LIN, Y., K. L. LARSON, R. DORER, and G. R. SMITH, 1992  Meiotically induced rec7 and rec8 genes of Schizosaccharomyces pombe.. Genetics 132:75-85[Abstract].

LORENZ, M. C. and J. HEITMAN, 1997  Yeast pseudohyphal growth is regulated by GPA2, a G protein alpha homolog. EMBO J. 16:7008-7018[Medline].

LORENZ, M. C. and J. HEITMAN, 1998  The MEP2 ammonium permease regulates pseudohyphal differentiation in Saccharomyces cerevisiae.. EMBO J. 17:1236-1247[Medline].

LORENZ, M. C., X. PAN, T. HARASHIMA, M. E. CARDENAS, and Y. XUE et al., 2000  The G protein-coupled receptor Gpr1 is a nutrient sensor that regulates pseudohyphal differentiation in Saccharomyces cerevisiae.. Genetics 154:609-622[Abstract/Free Full Text].

MAEDA, T., N. MOCHIZUKI, and M. YAMAMOTO, 1990  Adenylyl cyclase is dispensable for vegetative cell growth in the fission yeast Schizosaccharomyces pombe.. Proc. Natl. Acad. Sci. USA 87:7814-7818[Abstract/Free Full Text].

MAEDA, T., Y. WATANABE, H. KUNITOMO, and M. YAMAMOTO, 1994  Cloning of the pka1 gene encoding the catalytic subunit of the cAMP-dependent protein kinase in Schizosaccharomyces pombe.. J. Biol. Chem. 269:9632-9637[Abstract/Free Full Text].

NAKAFUKU, M., T. OBARA, K. KAIBUCHI, I. MIYAJIMA, and A. MIYAJIMA et al., 1988  Isolation of a second yeast Saccharomyces cerevisiae gene (GPA2) coding for guanine nucleotide-binding regulatory protein: studies on its structure and possible functions. Proc. Natl. Acad. Sci. USA 85:1374-1378[Abstract/Free Full Text].

NOCERO, M., T. ISSHIKI, M. YAMAMOTO, and C. S. HOFFMAN, 1994  Glucose repression of fbp1 transcription of Schizosaccharomyces pombe is partially regulated by adenylate cyclase activation by a G protein alpha subunit encoded by gpa2 (git8). Genetics 138:39-45[Abstract].

NODA, K., Y. SAAD, R. M. GRAHAM, and S. S. KARNIK, 1994  The high affinity state of the beta 2-adrenergic receptor requires unique interaction between conserved and non-conserved extracellular loop cysteines. J. Biol. Chem. 269:6743-6752[Abstract/Free Full Text].

OHI, R., A. FEOKTISTOVA, and K. L. GOULD, 1996  Construction of vectors and a genomic library for use with his3-deficient strains of Schizosaccharomyces pombe.. Gene 174:315-318[Medline].

OZCAN, S. and M. JOHNSTON, 1999  Function and regulation of yeast hexose transporters. Microbiol. Mol. Biol. Rev. 63:554-569[Abstract/Free Full Text].

PAN, X. and J. HEITMAN, 1999  Cyclic AMP-dependent protein kinase regulates pseudohyphal differentiation in Saccharomyces cerevisiae.. Mol. Cell. Biol. 19:4874-4887[Abstract/Free Full Text].

POSTMA, P. W., J. W. LENGELER, and G. R. JACOBSON, 1993  Phosphoenolpyruvate:carbohydrate phosphotransferase systems of bacteria. Microbiol. Rev. 57:543-594[Abstract/Free Full Text].

SAMEJIMA, I., S. MACKIE, and P. A. FANTES, 1997  Multiple modes of activation of the stress-responsive MAP kinase pathway in fission yeast. EMBO J. 16:6162-6170[Medline].

SHIOZAKI, K. and P. RUSSELL, 1996  Conjugation, meiosis, and the osmotic stress response are regulated by Spc1 kinase through Atf1 transcription factor in fission yeast. Genes Dev. 10:2276-2288[Abstract/Free Full Text].

SONDEK, J., A. BOHM, D. G. LAMBRIGHT, H. E. HAMM, and P. B. SIGLER, 1996  Crystal structure of a G-protein beta gamma dimer at 2.1A resolution. Nature 379:369-374[Medline].

STETTLER, S., E. WARBRICK, S. PROCHNIK, S. MACKIE, and P. FANTES, 1996  The wis1 signal transduction pathway is required for expression of cAMP-repressed genes in fission yeast. J. Cell Sci. 109:1927-1935[Abstract].

TAKEDA, T., T. TODA, K. KOMINAMI, A. KOHNOSU, and M. YANAGIDA et al., 1995  Schizosaccharomyces pombe atf1+ encodes a transcription factor required for sexual development and entry into stationary phase. EMBO J. 14:6193-6208[Medline].

TANG, W. J. and A. G. GILMAN, 1991  Type-specific regulation of adenylyl cyclase by G protein beta gamma subunits. Science 254:1500-1503[Abstract/Free Full Text].

TANG, W. J., J. A. INIGUEZ-LLUHI, S. MUMBY, and A. G. GILMAN, 1992  Regulation of mammalian adenylyl cyclases by G-protein alpha and beta gamma subunits. Cold Spring Harbor Symp. Quant. Biol. 57:135-144[Abstract/Free Full Text].

TAUSSIG, R. and A. G. GILMAN, 1995  Mammalian membrane-bound adenylyl cyclases. J. Biol. Chem. 270:1-4[Free Full Text].

THOMPSON, J. D., D. G. HIGGINS, and T. J. GIBSON, 1994  CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673-4680[Abstract/Free Full Text].

VASSAROTTI, A. and J. D. FRIESEN, 1985  Isolation of the fructose-1,6-bisphosphatase gene of the yeast Schizosaccharomyces pombe. Evidence for transcriptional regulation. J. Biol. Chem. 260:6348-6353[Abstract/Free Full Text].

WACH, A., A. BRACHAT, C. ALBERTI-SEGUI, C. REBISCHUNG, and P. PHILIPPSEN, 1997  Heterologous HIS3 marker and GFP reporter modules for PCR-targeting in Saccharomyces cerevisiae.. Yeast 13:1065-1075[Medline].

WATANABE, Y., Y. LINO, K. FURUHATA, C. SHIMODA, and M. YAMAMOTO, 1988  The S. pombe mei2 gene encoding a crucial molecule for commitment to meiosis is under the regulation of cAMP. EMBO J. 7:761-767[Medline].

WHITEWAY, M., L. HOUGAN, D. DIGNARD, D. Y. THOMAS, and L. BELL et al., 1989  The STE4 and STE18 genes of yeast encode potential beta and gamma subunits of the mating factor receptor-coupled G protein. Cell 56:467-477[Medline].

WILKINSON, M. G., M. SAMUELS, T. TAKEDA, W. M. TOONE, and J. C. SHIEH et al., 1996  The Atf1 transcription factor is a target for the Sty1 stress-activated MAP kinase pathway in fission yeast. Genes Dev. 10:2289-2301[Abstract/Free Full Text].

XUE, Y., M. BATLLE, and J. P. HIRSCH, 1998  GPR1 encodes a putative G protein-coupled receptor that associates with the Gpa2p Galpha subunit and functions in a Ras-independent pathway. EMBO J. 17:1996-2007[Medline].

YAMAWAKI-KATAOKA, Y., T. TAMAOKI, H. R. CHOE, H. TANAKA, and T. KATAOKA, 1989  Adenylate cyclases in yeast: a comparison of the genes from Schizosaccharomyces pombe and Saccharomyces cerevisiae.. Proc. Natl. Acad. Sci. USA 86:5693-5697[Abstract/Free Full Text].

YOUNG, D., M. RIGGS, J. FIELD, A. VOJTEK, and D. BROEK et al., 1989  The adenylyl cyclase gene from Schizosaccharomyces pombe.. Proc. Natl. Acad. Sci. USA 86:7989-7993[Abstract/Free Full Text].

YUN, C. W., H. TAMAKI, R. NAKAYAMA, K. YAMAMOTO, and H. KUMAGAI, 1998  Gpr1p, a putative G-protein coupled receptor, regulates glucose-dependent cellular cAMP level in yeast Saccharomyces cerevisiae.. Biochem. Biophys. Res. Commun. 252:29-33[Medline].

ZEHETNER, G. and H. LEHRACH, 1994  The reference library system—sharing biological material and experimental data. Nature 367:489-491[Medline].




This article has been cited by other articles:


Home page
GeneticsHome page
M. A. Alaamery and C. S. Hoffman
Schizosaccharomyces pombe Hsp90/Git10 Is Required for Glucose/cAMP Signaling
Genetics, April 1, 2008; 178(4): 1927 - 1936.
[Abstract] [Full Text] [PDF]


Home page
J Biomol ScreenHome page
F. D. Ivey, L. Wang, D. Demirbas, C. Allain, and C. S. Hoffman
Development of a Fission Yeast-Based High-Throughput Screen to Identify Chemical Regulators of cAMP Phosphodiesterases
J Biomol Screen, January 1, 2008; 13(1): 62 - 71.
[Abstract] [PDF]


Home page
J. Biol. Chem.Home page
T. Niranjan, X. Guo, J. Victor, A. Lu, and J. P. Hirsch
Kelch Repeat Protein Interacts with the Yeast G{alpha} Subunit Gpa2p at a Site That Couples Receptor Binding to Guanine Nucleotide Exchange
J. Biol. Chem., August 17, 2007; 282(33): 24231 - 24238.
[Abstract] [Full Text] [PDF]


Home page
GENES CELLSHome page
T. A. Kohda, K. Tanaka, M. Konomi, M. Sato, M. Osumi, and M. Yamamoto
Fission yeast autophagy induced by nitrogen starvation generates a nitrogen source that drives adaptation processes.
Genes Cells, February 1, 2007; 12(2): 155 - 170.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
S. Krystofova and K. A. Borkovich
The Predicted G-Protein-Coupled Receptor GPR-1 Is Required for Female Sexual Development in the Multicellular Fungus Neurospora crassa.
Eukaryot. Cell, September 1, 2006; 5(9): 1503 - 1516.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
L. Li and K. A. Borkovich
GPR-4 Is a Predicted G-Protein-Coupled Receptor Required for Carbon Source-Dependent Asexual Growth and Development in Neurospora crassa.
Eukaryot. Cell, August 1, 2006; 5(8): 1287 - 1300.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
R. S. Kao, E. Morreale, L. Wang, F. D. Ivey, and C. S. Hoffman
Schizosaccharomyces pombe Git1 Is a C2-Domain Protein Required for Glucose Activation of Adenylate Cyclase
Genetics, May 1, 2006; 173(1): 49 - 61.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
C. Xue, Y.-S. Bahn, G. M. Cox, and J. Heitman
G Protein-coupled Receptor Gpr4 Senses Amino Acids and Activates the cAMP-PKA Pathway in Cryptococcus neoformans
Mol. Biol. Cell, February 1, 2006; 17(2): 667 - 679.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
L. Wang, K. Griffiths Jr., Y. H. Zhang, F. D. Ivey, and C. S. Hoffman
Schizosaccharomyces pombe Adenylate Cyclase Suppressor Mutations Suggest a Role for cAMP Phosphodiesterase Regulation in Feedback Control of Glucose/cAMP Signaling
Genetics, December 1, 2005; 171(4): 1523 - 1533.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
A. Lafon, J.-A. Seo, K.-H. Han, J.-H. Yu, and C. d'Enfert
The Heterotrimeric G-Protein GanB({alpha})-SfaD({beta})-GpgA({gamma}) Is a Carbon Source Sensor Involved in Early cAMP-Dependent Germination in Aspergillus nidulans
Genetics, September 1, 2005; 171(1): 71 - 80.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
E. Amoah-Buahin, N. Bone, and J. Armstrong
Hyphal Growth in the Fission Yeast Schizosaccharomyces pombe
Eukaryot. Cell, July 1, 2005; 4(7): 1287 - 1297.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
F. D. Ivey and C. S. Hoffman
Direct activation of fission yeast adenylate cyclase by the Gpa2 G{alpha} of the glucose signaling pathway
PNAS, April 26, 2005; 102(17): 6108 - 6113.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
C. S. Hoffman
Except in Every Detail: Comparing and Contrasting G-Protein Signaling in Saccharomyces cerevisiae and Schizosaccharomyces pombe
Eukaryot. Cell, March 1, 2005; 4(3): 495 - 503.
[Full Text] [PDF]


Home page
Eukaryot CellHome page
S. Krystofova and K. A. Borkovich
The Heterotrimeric G-Protein Subunits GNG-1 and GNB-1 Form a G{beta}{gamma} Dimer Required for Normal Female Fertility, Asexual Development, and G{alpha} Protein Levels in Neurospora crassa
Eukaryot. Cell, February 1, 2005; 4(2): 365 - 378.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Madrid, T. Soto, A. Franco, V. Paredes, J. Vicente, E. Hidalgo, M. Gacto, and J. Cansado
A Cooperative Role for Atf1 and Pap1 in the Detoxification of the Oxidative Stress Induced by Glucose Deprivation in Schizosaccharomyces pombe
J. Biol. Chem., October 1, 2004; 279(40): 41594 - 41602.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
T. Miwa, Y. Takagi, M. Shinozaki, C.-W. Yun, W. A. Schell, J. R. Perfect, H. Kumagai, and H. Tamaki
Gpr1, a Putative G-Protein-Coupled Receptor, Regulates Morphogenesis and Hypha Formation in the Pathogenic Fungus Candida albicans
Eukaryot. Cell, August 1, 2004; 3(4): 919 - 931.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
P. Muller, A. Leibbrandt, H. Teunissen, S. Cubasch, C. Aichinger, and R. Kahmann
The G{beta}-Subunit-Encoding Gene bpp1 Controls Cyclic-AMP Signaling in Ustilago maydis
Eukaryot. Cell, June 1, 2004; 3(3): 806 - 814.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Hamasaki-Katagiri, T. Molchanova, K. Takeda, and J. B. Ames
Fission Yeast Homolog of Neuronal Calcium Sensor-1 (Ncs1p) Regulates Sporulation and Confers Calcium Tolerance
J. Biol. Chem., March 26, 2004; 279(13): 12744 - 12754.
[Abstract] [Full Text] [PDF]


Home page
Microbiol. Mol. Biol. Rev.Home page
K. A. Borkovich, L. A. Alex, O. Yarden, M. Freitag, G. E. Turner, N. D. Read, S. Seiler, D. Bell-Pedersen, J. Paietta, N. Plesofsky, et al.
Lessons from the Genome Sequence of Neurospora crassa: Tracing the Path from Genomic Blueprint to Multicellular Organism
Microbiol. Mol. Biol. Rev., March 1, 2004; 68(1): 1 - 108.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
A. M. Kays and K. A. Borkovich
Severe Impairment of Growth and Differentiation in a Neurospora crassa Mutant Lacking All Heterotrimeric G{alpha} Proteins
Genetics, March 1, 2004; 166(3): 1229 - 1240.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
S. Zuber, M. J. Hynes, and A. Andrianopoulos
The G-Protein {alpha}-Subunit GasC Plays a Major Role in Germination in the Dimorphic Fungus Penicillium marneffei
Genetics, June 1, 2003; 164(2): 487 - 499.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
X. Wang, M. Bali, I. Medintz, and C. A. Michels
Intracellular Maltose Is Sufficient To Induce MAL Gene Expression in Saccharomyces cerevisiae
Eukaryot. Cell, October 1, 2002; 1(5): 696 - 703.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
K. Schadick, H. M. Fourcade, P. Boumenot, J. J. Seitz, J. L. Morrell, L. Chang, K. L. Gould, J. F. Partridge, R. C. Allshire, K. Kitagawa, et al.
Schizosaccharomyces pombe Git7p, a Member of the Saccharomyces cerevisiae Sgt1p Family, Is Required for Glucose and Cyclic AMP Signaling, Cell Wall Integrity, and Septation
Eukaryot. Cell, August 1, 2002; 1(4): 558 - 567.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
J. A. Alspaugh, R. Pukkila-Worley, T. Harashima, L. M. Cavallo, D. Funnell, G. M. Cox, J. R. Perfect, J. W. Kronstad, and J. Heitman
Adenylyl Cyclase Functions Downstream of the G{alpha} Protein Gpa1 and Controls Mating and Pathogenicity of Cryptococcus neoformans
Eukaryot. Cell, February 1, 2002; 1(1): 75 - 84.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
C. A. D'Souza, J. A. Alspaugh, C. Yue, T. Harashima, G. M. Cox, J. R. Perfect, and J. Heitman
Cyclic AMP-Dependent Protein Kinase Controls Virulence of the Fungal Pathogen Cryptococcus neoformans
Mol. Cell. Biol., May 1, 2001; 21(9): 3179 - 3191.
[Abstract] [Full Text]


Home page
GeneticsHome page
S. Landry and C. S. Hoffman
The git5 G{beta} and git11 G{{gamma}} Form an Atypical G{beta}{{gamma}} Dimer Acting in the Fission Yeast Glucose/cAMP Pathway
Genetics, March 1, 2001; 157(3): 1159 - 1168.
[Abstract] [Full Text]


Home page
GeneticsHome page
R. T. K. Janoo, L. A. Neely, B. R. Braun, S. K. Whitehall, and C. S. Hoffman
Transcriptional Regulators of the Schizosaccharomyces pombe fbp1 Gene Include Two Redundant Tup1p-like Corepressors and the CCAAT Binding Factor Activation Complex
Genetics, March 1, 2001; 157(3): 1205 - 1215.
[Abstract] [Full Text]


Home page
Microbiol. Mol. Biol. Rev.Home page
K. B. Lengeler, R. C. Davidson, C. D'souza, T. Harashima, W.-C. Shen, P. Wang, X. Pan, M. Waugh, and J. Heitman
Signal Transduction Cascades Regulating Fungal Development and Virulence
Microbiol. Mol. Biol. Rev., December 1, 2000; 64(4): 746 - 785.
[Abstract] [Full Text] [PDF]