Genetics, Vol. 155, 611-622, June 2000, Copyright © 2000

Loss of Rhb1, a Rheb-Related GTPase in Fission Yeast, Causes Growth Arrest With a Terminal Phenotype Similar to That Caused by Nitrogen Starvation

Kathleen E. Mach1,a, Kyle A. Furgea, and Charles F. Albrighta
a Department of Biochemistry, Vanderbilt University School of Medicine, Nashville, Tennessee 37232-0146

Corresponding author: Charles F. Albright, DuPont Pharmaceuticals, 500 S. Ridgeway Ave., Glenolden, PA 19036., charles.f.albright{at}dupontpharma.com (E-mail)

Communicating editor: P. G. YOUNG


*  ABSTRACT
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

The Rheb GTPase is most similar in primary sequence to the Ras, Rap, R-Ras, and Ral GTPases, which regulate cell growth and differentiation in many cell types. A likely fission yeast homologue of mammalian Rheb, which we designated Rhb1, was identified by genome sequencing. Our investigation of rhb1 showed that rhb1- cells arrested cell growth and division with a terminal phenotype similar to that of nitrogen-starved cells. In particular, cells depleted of Rhb1 arrested as small, round cells with 1N DNA content, arrested more quickly in low-nitrogen medium, and induced expression of fnx1 and mei2 mRNA, two mRNAs that were normally induced by nitrogen starvation. Since mammalian Rheb binds and may regulate Raf-1, a Ras effector, we tested for functional overlap between Ras1 and Rhb1 in fission yeast. This analysis showed that Ras1 overexpression did not suppress rhb1- mutant phenotypes, Rhb1 overexpression did not suppress ras1- mutant phenotypes, and ras1- rhb1- double mutants had phenotypes equal to the sum of the corresponding single-mutant phenotypes. Hence, there is no evidence for overlapping functions between Ras1 and Rhb1. On the basis of this study, we hypothesize that Rhb1 negatively regulates entry into stationary phase when extracellular nitrogen levels are adequate for growth. If this hypothesis is correct, then Rhb1 and Ras1 regulate alternative responses to limiting nutrients.


THE Ras superfamily of proteins are low molecular mass GTPases that cycle between an active, GTP-bound form and an inactive, GDP-bound form (reviewed in BOURNE et al. 1991 Down). Nucleotide cycling rates are increased by guanine-nucleotide exchange factors that catalyze production of the GTP-bound form and GTPase-activating proteins (GAPs) that catalyze GTP hydrolysis (reviewed in BOGUSKI and MCCORMICK 1993 Down). In mammals, the Ras superfamily of GTPases contains over 60 distinct proteins that regulate many biological processes, including cell growth and differentiation, nuclear transport, vesicular transport, and microfilament structures.

The Ras superfamily can be divided into subfamilies based on primary sequence comparisons (reviewed in BOURNE et al. 1991 Down). One such subfamily includes isoforms of the Ras, Rap, Ral, R-Ras, and Rheb GTPases that regulate cell growth and differentiation of many cell types (BOS 1997 Down; CAMPBELL et al. 1998 Down). While many studies of Ras, Rap, Ral, and R-Ras have been conducted, relatively few studies of Rheb are reported and some of these studies reach different conclusions. While two studies found that Rheb, like Ras, bound the Raf-1 kinase in a GTP-dependent manner, these studies disagreed on the consequences of Rheb binding to Raf-1 (CLARK et al. 1997 Down; YEE and WORELY 1997 Down). YEE and WORLEY (1997) found that Rheb binding to Raf-1 in vitro stimulated Raf-1 kinase activity, Rheb potentiated the transforming activity of Raf-1 in NIH-3T3 cells, and Rheb induced neurite outgrowth in PC12 cells. These investigators also found that Raf-1 phosphorylation by protein kinase A increased Raf-1 binding to Rheb (YEE and WORELY 1997 Down) in contrast to Raf-1 phosphorylation by protein kinase A that decreased Raf-1 binding to Ras (COOK and MCCORMICK 1993 Down; WU et al. 1993 Down). On the basis of these results, these investigators concluded that Rheb, like Ras, activated Raf-1. In contrast, CLARK et al. 1997 Down found that Rheb did not transform NIH-3T3 cells, Rheb inhibited cellular transformation of NIH-3T3 cells by activated H-Ras, and Rheb reduced Raf-1 kinase activity by activated H-Ras in Xenopus oocyte extracts (CLARK et al. 1997 Down). On the basis of these results, these investigators concluded that Rheb inhibited Raf-1 activation.

The fission yeast Schizosaccharomyces pombe is a good model system to study Ras signaling. S. pombe contains a single Ras gene, ras1, that is required to respond to pheromones and maintain cell polarity (FUKUI et al. 1986 Down; NADIN-DAVIS et al. 1986 Down). Cells without ras1 cannot conjugate, sporulate at reduced levels, and are round instead of rod shaped. Ras1 regulates these cellular processes by activating at least two pathways. In one pathway, Ras1 activates a mitogen-activated protein (MAP)-kinase cascade. In this pathway, Ras1 binds Byr2, a MEKK, and this binding is required to activate Byr2 (VAN AELST et al. 1993 Down; MASUDA et al. 1995 Down; TU et al. 1997 Down). Activated Byr2 activates Byr1, a MEK, and Byr1 activates Spk1, a MAP kinase (NADIN-DAVIS and NASIM 1988 Down; TODA et al. 1991 Down; WANG et al. 1991 Down). This Ras1-activated, MAP-kinase cascade is essential for conjugation and sporulation but does not affect cell morphology. In a second pathway, Ras1 binds Scd1, an exchange factor for the Cdc42 GTPase (FUKUI and YAMAMOTO 1988 Down; CHANG et al. 1994 Down). Cells without Scd1 are round and unable to conjugate but sporulate efficiently. Hence, fission yeast Ras1, like mammalian Ras, activates a MAP-kinase cascade, affects cell morphology, and regulates cellular differentiation.

S. pombe cells respond to limiting nutrients in at least three ways. First, mating can occur when nitrogen is limiting and cells of the opposite mating type are present (reviewed in DAVEY 1998 Down). Mating can also occur when carbon is limiting although the frequency is much lower than in nitrogen-starved cells. Following conjugation, meiosis and sporulation usually occur, leading to the formation of four haploid spores that are much more resistant to extracellular stresses than actively growing cells. Several signaling pathways coordinate the mating process. In particular, nutrient deprivation causes decreased intracellular cAMP (FUKUI et al. 1986 Down; MAEDA et al. 1990 Down; MOCHIZUKI and YAMAMOTO 1992 Down) and increased Spc1 kinase activity (SHIOZAKI and RUSSELL 1996 Down) while pheromones activate signaling pathways that include the Ras1-activated, MAP-kinase cascade. As an alternative to mating in response to low nutrients, S. pombe can enter stationary phase. Cells depleted of nitrogen typically enter stationary phase with a 1N DNA content (FANTES and NURSE 1977 Down; COSTELLO et al. 1986 Down; SU et al. 1996 Down). Such stationary-phase cells are smaller than actively growing cells, remain viable for several weeks, and have increased resistance to heat shock. In contrast, cells depleted of carbon or grown to saturation typically enter stationary phase with a 2N DNA content (COSTELLO et al. 1986 Down; SU et al. 1996 Down) and a size between that of actively growing cells and nitrogen-starved cells. While cAMP levels and Spc1 kinase activity may regulate entry into stationary phase, modulation of these pathways is not sufficient to induce stationary phase. In fact, relatively little is known about the presumed signaling pathways that control entry into stationary phase. One likely component of this response is the fnx1 gene; overexpression of fnx1, which encodes a likely proton-driven plasma membrane transporter of the multidrug resistance group, causes cells to arrest growth like nitrogen-starved cells (DIMITROV and SAZER 1998 Down).

The conflicting data on the effect of Rheb on Raf-1 and the identification of a likely S. pombe Rheb homologue, which we designated rhb1, prompted us to study Rhb1. This analysis showed that cells depleted of Rhb1 arrested growth with a terminal phenotype similar to that of nitrogen-starved cells. On the basis of this terminal phenotype and the lack of interactions between rhb1 and ras1 mutants, we hypothesize that Rhb1 regulates the entry into stationary phase while Ras1 regulates mating. If this hypothesis is accurate, then Rhb1 and Ras regulate alternative responses to limiting nutrients.


*  MATERIALS AND METHODS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Strains and growth conditions:
The yeast strains used in this study are listed in Table 1. S. pombe was grown at 30° in yeast extract medium (YE) or minimal medium (MM) with required supplements at 75 mg/liter (MORENO et al. 1991 Down). A derivative of MM, designated MMGlu, was also used, which contained 5 mM glutamate, instead of 100 mM ammonium chloride, as the nitrogen source. S. pombe transformations were performed by the LiAcetate method (WARSHAWSKY and MILLER 1994 Down). nmt1 promoters were repressed by addition of 40 µM thiamine to media (MAUNDRELL 1993 Down). The KGY248 x SP870 diploid was made by protoplast fusion (ALFA et al. 1993 Down).


 
View this table:
In this window
In a new window

 
Table 1. Yeast strains used in this study

To construct the rhb1- allele, a 2.27-kb DNA fragment, from 1.2 kb 5' of the rhb1 start codon to 0.8 kb 3' of the rhb1 stop codon was amplified using the polymerase chain reaction (PCR; oligonucleotides attttcgaaggttttcactcactc and aactgcagcttaaaacccgtatcgcagacctc). The resulting DNA fragment was digested with KpnI and PstI and then ligated with pBSK that was similarly digested to create pBSKrhb1. pBSKrhb1 was partially digested with EcoRV and completely digested with XhoI to remove most of the rhb1 coding region and ligated with a DNA fragment that contained the ura4+ gene that had been digested with SmaI and XhoI to create pBSK{Delta}rhb1. pBSK{Delta}rhb1 was digested with KpnI and PstI and the linear DNA fragment containing the ura4+ gene was transformed into SP870 x KGY248 diploids. Stable ura4+ transformants were selected and diploids with one disrupted rhb1 allele, rhb1-, were identified by Southern blot (AUSUBEL et al. 1995 Down). The resulting rhb1+/rhb1- diploid, KM249, was sporulated on MMGlu plates and tetrads were dissected.

Plasmids:
Plasmid manipulation and bacterial transformation were performed by standard techniques (SAMBROOK et al. 1989 Down). For expression vectors, rhb1 was amplified by PCR with oligonucleotides (cgggatccatggctcctattaaatctcgta and cttaaacccgtatcgcagacctc), digested with BamHI and EcoRV, and ligated with pREP3XHA, pREP41X, or pREP81X (BASI et al. 1993 Down; FORSBURG 1993 Down; MAUNDRELL 1993 Down) that were digested with BamHI and SmaI to generate p3XHArhb1, p41Xrhb1, and p81Xrhb1, respectively. rhb1 mutants were made by site-directed mutagenesis (KUNKEL 1985 Down).

Western blot analysis:
A total of 108 cells were harvested by centrifugation, washed once in Stop buffer (150 mM NaCl, 50 mM NaF, 10 mM EDTA, 1 mM NaN3), resuspended in Stop buffer, boiled 5 min, and pelleted (FISHER and NURSE 1996 Down). Protein extracts were made by resuspending cells in 100 µl HB (25 mM HEPES, 60 mM ß-glycerophosphate, 15 mM MgCl2, 15 mM EGTA, 0.1 mM NaVanadate) with 1% SDS, 300 mg glass beads, and then mixing for 30 sec at high speed with a beadbeater (Biospec Products, Inc., Bartlesville, OK). Proteins were separated by SDS-PAGE (5% of extract per lane) and transferred to nitrocellulose membranes. HA-Rhb1 was detected using HA.11 antibodies (Babco, Richmond, CA) diluted 1:10,000 in 100 mM Tris, pH 7.5, 0.9% NaCl, 0.1% Tween 20. Bound antibodies were detected with a 1:10,000 dilution of anti-mouse IgG-HRP and enhanced chemiluminescence reagents.

Other techniques:
Northern blot analysis, flow cytometric analysis, sporulation rates, and microscopic techniques were performed as previously described (MACH et al. 1998 Down). mRNA levels were quantitated by phosphoimager analysis and normalized to the amount of cam1 mRNA that correlated well with the amount of ribosomal RNA in each sample. Yeast were stained with 0.5 mg/ml phloxine B (Sigma, St. Louis) to visualize dead cells and FungoLIGHT (Molecular Probes, Eugene, OR) according to manufacturer's instructions to visualize live cells.


*  RESULTS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Rhb1 shares high sequence identity with the mammalian Rheb GTPase:
A hypothetical protein with high sequence identity to the mammalian Rheb GTPase was identified by the S. pombe Sequencing Group at the Sanger Centre. This hypothetical protein (SPBC428.16c), which we designated Rhb1, was sequenced as part of cosmid 428 on the left arm of chromosome II. The predicted Rhb1 protein has high sequence identity with human Rheb (52.2%), rat Rheb (52.2%), and hypothetical proteins Caenorhabditis elegans F54C8.5 (38.9%) and Saccharomyces cerevisiae YCR027c (37.3%; Fig 1). We will refer to these five GTPases as the Rheb-related GTPases since they are more similar to each other than to other Ras superfamily proteins. Consistent with the analysis of Rheb (YAMAGATA et al. 1994 Down), Rheb-related GTPases have at least 30% sequence identity with H-Ras, Rap1, RalA, and their close relatives, but <25% sequence identity with other Ras superfamily GTPases, such as RhoA, Rab6, Arf, and Ran (HIGGINS et al. 1996 Down). Hence, Rheb-related GTPases are most similar to Ras superfamily GTPases that control cell growth and differentiation (CAMPBELL et al. 1998 Down).



View larger version (81K):
In this window
In a new window
Download PPT slide
 
Figure 1. Sequence alignment of S. pombe Rhb1 (AL034382), human Rheb (Z29677), S. cerevisiae YCR027c, S. pombe Ras1 (X03771), and human H-Ras (J00277). Shaded amino acids are identical to S. pombe Rhb1. H-Ras codon 12 (*), the core effector domain (box), and likely prenylation site (**) are indicated. Sequences were aligned with the DNASTAR Lasergene alignment program.

In addition to overall sequence similarity, Rheb-related proteins share similarities to each other in likely functional domains (Fig 1; BOURNE et al. 1991 Down). A glycine at codon 12 of H-Ras is essential for GAP-stimulated GTP hydrolysis and mutations of this amino acid cause a constitutively active protein (BOURNE et al. 1990 Down; BOGUSKI and MCCORMICK 1993 Down). All of the Rheb-related proteins, however, have arginine at the residue analogous to H-Ras codon 12, which is consistent with the finding that RasGAPs do not stimulate Rheb GTPase activity (YAMAGATA et al. 1994 Down). Furthermore, Rheb-related proteins differ at only one of nine residues in the effector region while Rheb-related proteins and H-Ras differ at three residues in the effector region. Hence, Rheb-related GTPases may share some effectors with Ras as well as have Rheb-specific effectors. Finally, Rheb, like Ras, is farnesylated (CLARK et al. 1997 Down). Based on their CAAX-box sequences, other Rheb-related GTPases are likely farnesylated (MOORES et al. 1991 Down).

rhb1 mRNA is constitutively expressed:
Rheb was originally identified as a protein whose mRNA was upregulated in hippocampal granule cells by seizures (YAMAGATA et al. 1994 Down). Rheb transcription was also induced in Balb/c 3T3 fibroblasts by serum stimulation and PC12 cells by epidermal-growth factor and basic fibroblast-growth factor (GROMOV et al. 1995 Down; CLARK et al. 1997 Down; YEE and WORELY 1997 Down). To test for transcriptional regulation of rhb1, we determined the transcription levels of rhb1 mRNA in actively growing cells, nitrogen-starved cells, and osmotically stressed cells. This analysis revealed a single rhb1 mRNA transcript of ~1 kb that was present at similar levels in each of these samples (Fig 2). Since some of the nitrogen-starved cells in this experiment mated, we conclude that nitrogen starvation, mating, and osmotic stress do not significantly alter the amount of rhb1 mRNA.



View larger version (79K):
In this window
In a new window
Download PPT slide
 
Figure 2. Expression of rhb1 mRNA. Total RNA from SP870 cells that were actively growing (0) or nitrogen starved for 6 or 12 hr, as indicated, and KGY246 cells that were actively growing (0) or osmotically stressed with 1.2 M KCl for 6 or 12 hr, as indicated, was processed for Northern analysis with a DNA fragment that contained the Rhb1 coding sequence (top). The amount of ribosomal RNAs in each sample (bottom) reflects the amount of mRNA in each sample.

rhb1 is essential for growth:
A null allele of rhb1, rhb1- was created by replacing one allele of rhb1 in diploids with the ura4+ gene (Fig 3A). Southern blot analysis confirmed that the ura4+ diploid strain contained one rhb1+ allele and one rhb1- allele (Fig 3B). The rhb1+/rhb1- heterozygous diploids were induced to sporulate and the resulting tetrads were dissected. In all cases, these tetrads segregated two ura-, viable spores and two nonviable spores (Fig 3C). rhb1- mutants were complemented by plasmids expressing rhb1+ (see below), confirming that the lethal phenotype was due to the lack of rhb1 function. While the rhb1- spores did not form colonies, these spores germinated and divided 1–3 times before arresting as small, rounded cells. We conclude that rhb1 is essential for growth.



View larger version (34K):
In this window
In a new window
Download PPT slide
 
Figure 3. rhb1 is essential for growth. (A) Partial restriction enzyme map of the rhb1 (top) and rhb1- (bottom) genomic loci. Restriction enzymes: K, KpnI; RV, EcoRV; C, ClaI; X, XhoI. Line, 500 bp. (B) Southern blot of DNA from rhb1+ and rhb1+/rhb1- diploids digested with ClaI and probed with the ClaI-KpnI fragment indicated by the line in A. (C) Growth of spores from rhb1+/rhb1- diploids. The four spores from a single tetrad are contained within each vertical column.

Cells overexpressing wild-type or mutant rhb1 are indistinguishable from wild-type cells:
To further explore Rhb1 function, we tested the effect of Rhb1 overexpression. rhb1 containing an amino-terminal HA tag, rhb1-HA, was expressed using the thiamine-repressible nmt1+ promoter (MAUNDRELL 1993 Down). The HA tag did not interfere with Rhb1 function since rhb1-HA complemented the rhb1- allele (data not shown). When rhb1+ cells were induced to express HA-Rhb1, HA-Rhb1 protein was detected by Western blotting after 12 hr and increased in amount for at least 6 more hr (Fig 4). Although the HA-Rhb1 protein was expressed at high levels, this overexpression did not alter the growth rate, morphology, or conjugation rate of these cells (data not shown). Overexpression of rhb1 without an epitope tag gave indistinguishable results.



View larger version (50K):
In this window
In a new window
Download PPT slide
 
Figure 4. Expression of HA-Rhb1 and HA-Rhb1 mutants. Wild-type cells (SP870) that contained pREP3XHA (con.), p3XHArhb1 (Rhb1+), p3XHArhb1-Q64L (Q64L), p3XHArhb1-S20N (S20N), or p3XHArhb1-T38M (T38M) were grown to midlog phase in MM without thiamine for the indicated time in hours. Cellular lysates were then prepared and analyzed by Western blotting with anti-HA antibodies. HA-Rhb1 and HA-Rhb1 mutants are indicated by the arrow.

To further characterize Rhb1 function, we generated three rhb1 mutants analogous to those with known phenotypes in H-ras (Table 2). The rhb1-Q64L mutant is analogous to the H-Ras-Q61L mutant, which is resistant to GAP-mediated GTPase stimulation and is, therefore, constitutively active (BOGUSKI and MCCORMICK 1993 Down). The rhb1-S20N mutant is analogous to the H-Ras-S17N mutant, which sequesters exchange factors in nonproductive complexes resulting in a dominant-negative protein (BOGUSKI and MCCORMICK 1993 Down). The rhb1-T38M mutant is analogous to the H-Ras-T35M mutant, which fails to bind downstream effectors and is, therefore, nonfunctional (STANG et al. 1997 Down). Each of these rhb1 mutants was expressed using a thiamine-repressible promoter and contained an amino-terminal HA tag. Although these mutants were efficiently expressed (Fig 4), no differences in the growth rate, cell morphology, or mating of these cells were found relative to rhb1+ cells (data not shown). Indistinguishable results were obtained when mutants lacked the amino-terminal HA tag (data not shown). Hence, neither of the rhb1 mutants analogous to dominant mutants in H-Ras had dominant phenotypes in fission yeast.


 
View this table:
In this window
In a new window

 
Table 2. Analysis of rhb1 mutants

To test if rhb1-Q64L, rhb1-S20N, and rhb1-T38M were functional, we determined whether they complemented the rhb1- allele. For this purpose, rhb1 mutant expression plasmids were transformed into rhb1+/rhb1- diploids, diploids were induced to sporulate, and spores were germinated on plates that selected for the plasmid and the rhb1- allele. This analysis revealed that rhb1-Q64L, but not rhb1-S20N and rhb1-T38M, complemented the rhb1- allele (Table 2). Therefore, Rhb1-Q64L is functional while Rhb1-S20N and Rhb1-T38M are not functional.

rhb1- mutants arrest growth with a phenotype similar to nitrogen-starved cells:
Since rhb1 is an essential gene, we constructed a conditional rhb1 allele to more easily characterize the rhb1- phenotype. We first tested conditional expression of rhb1 in rhb1- mutants using the thiamine-repressible nmt1 promoter and its attenuated derivatives (BASI et al. 1993 Down; FORSBURG 1993 Down). This analysis showed that rhb1 expressed from a plasmid complemented the rhb1- allele even when the weakest nmt1+ promoter was repressed (Fig 5A). We then tested rhb1 mutants analogous to mutants in other Ras-family GTPases that had conditional phenotypes. One of these mutants, rhb1-D121A, was analogous to S. cerevisiae tem1-3, a temperature-sensitive allele (SHIRAYAMA et al. 1994 Down). Although rhb1-D121A mutants were not temperature sensitive for growth (data not shown), repression of the attenuated nmt1 promoter expressing Rhb1-D121A caused cells to arrest growth (Fig 5A). Like Rhb1, expression of Rhb1-D121A at high levels in rhb1+ and rhb1- cells caused no detectable phenotype, showing that rhb1-D121A had no dominant phenotypes (data not shown). On the basis of the lack of dominant phenotypes and the similarity of the terminal phenotype of rhb1- and rhb1-D121A mutants, we conclude that rhb1-D121A is a hypomorphic allele.




View larger version (107K):
In this window
In a new window
Download PPT slide
 
Figure 5. Analysis of rhb1- mutant phenotypes. (A) rhb1-D121A mutants have a conditional growth phenotype. rhb1- mutants (KM250) containing either p81Xrhb1 [p(rhb1+)] or p81Xrhb1-D121A [p(rhb1-D121A)] were grown to saturation and fivefold dilutions of cells were spotted on plates without (-) or with (+) thiamine. (B) rhb1-D121A mutants arrest cell division when rhb1-D121A expression is repressed. rhb1+ cells (KGY246) or rhb1- cells (KM251) containing p81Xrhb1-D121A [p(rhb1-D121A)] were grown in MM or MMGlu, thiamine was added at time zero, and cell number was determined. (C) rhb1-D121A mutants arrest cell growth with a morphology similar to that of nitrogen-starved cells. Actively growing rhb1+ cells (KGY28) were starved for nitrogen (minus nitrogen) for 21 hr and cells were visualized with differential interference contrast microscopy (left) or DAPI and Calcofluor (right). rhb1- cells (KM251) containing p81Xrhb1-D121A [p(rhb1-D121A)] were grown to midlog phase in MM (induced) and thiamine was added to the medium of some cultures for 21 hr (repressed). Cells were visualized as above. (D) rhb1-D121A mutants arrest cell growth with a DNA content similar to that of nitrogen-starved cells. rhb1+ cells (SP870) or rhb1- cells (KM251) with p81Xrhb1-D121A [p(rhb1-D121A)] were grown to midlog phase in MM (left) or MMGlu (right), thiamine was added at time zero, and samples from the indicated times were analyzed for DNA content. The locations of 1N and 2N DNA content are indicated. (E) rhb1-D121A mutants transcriptionally induce fnx1 and mei2 mRNA. Thiamine was added to actively growing rhb1- cells (KM251) with p81Xrhb1-D121A at time zero, total RNA was prepared from samples taken at the indicated times in hours, and Northern blots were probed for fnx1, mei2, and cam1, as a loading control.

We used the conditional expression of rhb1-D121A in rhb1- mutants, which we shall refer to as rhb1-D121A mutants, to further characterize the rhb1- phenotype. When actively growing rhb1-D121A mutants were shifted to media that repressed rhb1-D121A expression, cells completed about two doublings (6 hr) before cell division arrested (Fig 5B). Similar growth curves were observed with cultures at starting densities from 0.5 to 3.5 x 106 cells/ml (data not shown). However, growth arrest occurred sooner (4.5 hr) when rhb1-D121A was repressed in media with a poor nitrogen source (Fig 5B), indicating that rhb1-D121A mutants were hypersensitive to nitrogen deprivation. While terminally arrested rhb1-D121A mutants remained viable, as judged by phase-contrast microscopy, phloxine B staining, and vital dye staining (data not shown), rhb1-D121A mutants did not resume growth when the thiamine was removed from the media. Potential reasons for the irreversibility of the rhb1-D121A arrest will be discussed later.

The terminally arrested rhb1-D121A mutant cells were stained with 4',6-diamidino-2-phenylindole (DAPI) and Calcofluor to visualize DNA and septal material. This analysis showed that rhb1-D121A mutants arrested as small, round cells without detectable defects in karyokinesis or cytokinesis (Fig 5C). Since the terminal phenotype of these mutants resembled cells starved for nitrogen, a direct comparison of nitrogen-starved cells was performed. This analysis showed that rhb1+ cells starved for nitrogen were morphologically indistinguishable from terminally arrested rhb1-D121A mutants (Fig 5C).

Wild-type cells starved of nitrogen enter stationary phase with a 1N DNA content while cells starved for carbon enter stationary phase with a 2N DNA content (COSTELLO et al. 1986 Down; SU et al. 1996 Down). Flow cytometric analysis was used to measure the DNA content of rhb1-D121A mutants as they arrested growth. This analysis revealed that the fraction of cells with 1N DNA content increased as Rhb1-D121A was depleted, eventually reaching a level similar to that of nitrogen-starved cells (Fig 5D). Hence, the morphology and DNA content of rhb1-D121A mutants were similar to that of cells starved for nitrogen and differed from that of cells starved for carbon.

Nitrogen-starved cells induced fnx1 and mei2 mRNA (WANTANABE et al. 1988 Down; DIMITROV and SAZER 1998 Down). To test if rhb1-D121A mutants also induced fnx1 and mei2 mRNA, we prepared total RNA from cells that were repressed for rhb1-D121A expression and measured these mRNA levels by Northern blotting. This analysis revealed that fnx1 mRNA was indeed increased when rhb1-D121A was repressed (Fig 5E). Peak levels occurred 4.5 hr after rhb1-D121A was repressed at the time just before cell growth ceased. Quantitation of fnx1 mRNA levels showed a maximal increase of fourfold relative to actively growing rhb1+ or rhb1-D121A cells. For comparison, fnx1 mRNA was induced sevenfold when wild-type cells were starved for nitrogen (DIMITROV and SAZER 1998 Down). The expression of mei2 mRNA was also induced as rhb1-D121A was repressed (Fig 5E). In the case of mei2 mRNA, a ninefold increase in mei2 mRNA levels was observed 8 hr after rhb1-D121A was repressed at which time cell growth had stopped. In conclusion, rhb1-D121A mutants exhibit several features of nitrogen-starved cells. In particular, terminally arrested rhb1-D121A mutants stopped cell growth and division as small, round cells with a 1N DNA content and increased expression of two mRNAs that were induced in rhb1+ cells starved for nitrogen.

Ras1 and Rhb1 do not perform overlapping functions:
Since mammalian Rheb binds Raf-1, a Ras effector, and may influence Raf-1 function, several genetic experiments were conducted to test for interactions between Rhb1 and Ras1. We first tested for cross-suppression of mutant phenotypes. ras1- mutants cannot conjugate, have reduced sporulation rates, and are round, instead of rod shaped. To determine if Rhb1 could suppress any of these defects, Rhb1 and Rhb1-Q64L, a functional and potentially activated mutant, were overexpressed in ras1- mutants. This analysis showed that overexpression of neither Rhb1 nor Rhb1-Q64L affected the morphology, conjugation rate, or sporulation rate of ras1- mutants (Table 3; data not shown). Control experiments verified that Ras1 expression complemented all the defects of ras1- mutants (Table 3; data not shown). To determine if Ras1 could suppress the lethality of rhb1- mutants, Ras1 and Ras1-V12, an activated mutant, were overexpressed in rhb1+/rhb1- diploids, diploids were induced to sporulate, and spores were germinated on plates where only rhb1- mutants could grow. This analysis revealed that neither ras1 nor ras-V17 suppressed the lethality of rhb1- mutants (data not shown). In contrast, rhb1 expression complemented rhb1- mutants (Fig 5A). We conclude that Ras1 overexpression cannot suppress rhb1- mutant phenotypes and Rhb1 overexpression cannot suppress ras1- mutant phenotypes.


 
View this table:
In this window
In a new window

 
Table 3. Effect of rhb1 mutants on sporulation of ras1- diploids

To further test for potential overlapping functions shared by ras1 and rhb1, we crossed the ras1- mutation into the background of the conditional rhb1- mutants and analyzed the phenotype of the resulting double mutant. The ras1- rhb1-D121A mutants were round, did not conjugate, grew at a rate indistinguishable from ras1+rhb1+ cells, and arrested growth at a rate (Fig 6) and with a DNA content that was indistinguishable from rhb1-D121A mutants (data not shown). Hence, ras1- rhb1-D121A mutants had phenotypes that were equal to the sum of phenotypes of the corresponding single mutants. The lack of genetic interactions between ras1 and rhb1 mutations suggests that Ras1 and Rhb1 GTPases perform nonoverlapping functions.



View larger version (16K):
In this window
In a new window
Download PPT slide
 
Figure 6. rhb1-D121A ras1- mutants arrest growth like rhb1-D121A mutants. rhb1- ras1- cells (KM252) or rhb1- cells (KM251) containing p81Xrhb1-D121A [p(rhb1-D121A)] were grown in MM, thiamine was added at time zero, and cell number was determined.

rhb1-D121A mutants are only slightly affected by mutations in the cAMP pathway:
The cAMP pathway plays a critical role in the response of fission yeast to changes in extracellular nutrients. For instance, cyr1- mutants, which lack adenylate cyclase activity and consequently cAMP, have characteristics of starved cells even when grown in plentiful nutrients. In particular, cyr1- mutants grow slower than wild-type cells and conjugate in the presence of excess nutrients (MAEDA et al. 1990 Down). In contrast, cgs1- mutants, which lack phosphodiesterase activity and consequently accumulate elevated cAMP, do not appropriately respond to nutritional deprivation. In particular, cgs1- mutants fail to arrest growth properly in response to nutrient deprivation leading to elongated cells with decreased viability upon starvation (DEVOTI et al. 1991 Down). To look for genetic interactions between the cAMP pathway and Rhb1, rhb1-D121A cyr1- and rhb1-D121A cgs1- double mutants were constructed and analyzed. rhb1-D121A cyr1- mutants resembled cyr1- mutants in that they grew slower than wild-type cells (data not shown). When rhb1-D121A was repressed by thiamine addition, cell division and growth ceased and rhb1-D121A cyr1- cells arrested with a morphology that was indistinguishable from rhb1-D121A mutants (data not shown). The rhb1-D121A cyr1- mutants reproducibly stopped exponential growth ~1 hr before rhb1-D121A mutants (Fig 7). In contrast, rhb1-D121A cgs1- mutants were morphologically indistinguishable from rhb1-D121A mutants during exponential growth and following terminal arrest (data not shown). rhb1-D121A cgs1- mutants reproducibly stopped exponential growth ~1 hr after rhb1-D121A mutants (Fig 7). Hence, while we observed subtle interactions between rhb1-D121A mutations and cyr1- or cgs1- mutations, we did not observe epistasis, suppression, or dramatic synthetic phenotypes suggesting that Rhb1 functions on a pathway distinct from the cAMP pathway.



View larger version (22K):
In this window
In a new window
Download PPT slide
 
Figure 7. Mutations in the cAMP pathway only slightly affect the arrest of rhb1-D121A mutants. rhb1- cyr1- cells (KFY60), rhb1- cgs1- cells (KFY61), or rhb1- cells (KM251) containing p81Xrhb1-D121A [p(rhb1-D121A)] were grown in MM, thiamine was added at time zero, and cell number was determined.


*  DISCUSSION
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

This study investigated the S. pombe rhb1 gene. The predicted Rhb1 protein is most similar to Rheb-related GTPases that are found in budding yeast, C. elegans, rats, and humans. The sequence similarity of the Rheb-related proteins, especially at residues analogous to H-Ras codon 12, the effector domain, and CAAX box, suggests that these proteins perform similar cellular functions. While C. elegans F54C8.5 protein is more similar to the Rheb-related proteins than to other Ras superfamily GTPases, this C. elegans protein differs from other Rheb-related proteins at three amino acids in its effector domain, suggesting that it may perform unique functions. rhb1 mRNA was expressed at similar levels in actively growing cells, nitrogen-starved cells, and osmotically stressed cells, suggesting that rhb1, unlike the mammalian rheb gene, is not transcriptionally regulated.

rhb1 is essential for growth since rhb1- spores germinated but arrested growth after 1–3 divisions as small, rounded cells. The rhb1- terminal phenotype was further analyzed using the conditional expression of rhb1-D121A, a hypomorphic mutant. When rhb1-D121A expression was repressed, cells underwent approximately two cell divisions before arresting cell growth and division as small, rounded cells with a 1N DNA content. The similarity of this terminal phenotype to that of nitrogen-starved cells prompted us to test for other similarities. This analysis showed that rhb1-D121A mutants were hypersensitive to nitrogen levels in the media and transcriptionally induced two genes, fnx1 and mei2, that are induced in rhb1+ cells that are nitrogen starved.

Our analysis of rbh1- mutants revealed only one difference between rhb1- cells and nitrogen-starved cells: rhb1-D121A mutants were terminally arrested while nitrogen-starved cells resumed growth when nitrogen levels were increased. Several mechanisms could explain the irreversibility of the rhb1-D121A growth arrest. First, rhb1-D121A mutants might lose viability by lysis or another lethal event. While this possibility cannot be excluded, microscopic examination of the rhb1-D121A arrested cells provided no evidence of cell lysis or other abnormalities. Second, rhb1-D121A arrested cells may have entered an aberrant stationary state. Entry into stationary phase in yeast is a complex process (reviewed in WERNER-WASHBURNE et al. 1993 Down) and Rhb1 inactivation may be only one of multiple signals required for this transition. Third, Rhb1-D121A may not be adequately expressed in the terminally arrested cells after thiamine is removed from the media. Consistent with this hypothesis, rhb1-D121A spores germinated more slowly than rhb1+ spores, suggesting that Rhb1-D121A levels are limiting for spore germination even when the rhb1-D121A promoter was never repressed (data not shown). Further experiments will be needed to differentiate between these possibilities.

On the basis of structural and regulatory similarities between Ras superfamily GTPases, it is frequently possible to construct dominant-positive mutants and dominant-negative mutants that can help analyze GTPase functions. The analogous mutants in rhb1 were, however, uninformative. In particular, neither the potential dominant-positive mutant, rhb1-Q64L, nor the potential dominant-negative mutant, rhb1-S20N, had dominant phenotypes when overexpressed. In light of these results, it is interesting that overexpression of the analogous Rheb mutants also failed to affect the growth of NIH-3T3 cells (CLARK et al. 1997 Down). Further analysis of these rhb1 mutants showed that rhb1-Q64L, but not rhb1-S20N and rhb1-T38M, was functional since it complemented rhb1- mutants. Once again, similar results were obtained with mammalian Rheb mutants where Rheb and Rheb-Q64L, but not Rheb-S20N, antagonized cellular transformation of NIH-3T3 cells by H-RasV12 (CLARK et al. 1997 Down).

We found no evidence for overlapping functions regulated by Ras1 and Rhb1. In particular, overexpression of ras1 did not suppress the lethality of rhb1- mutants and overexpression of rhb1 did not suppress the morphological or mating defects of ras1null mutants. Furthermore, ras1- rhb1-D121A mutants had phenotypes that would be expected from simply adding the phenotypes of ras1- and rhb1-D121A mutants. We were particularly interested in shared effectors for Rhb1 and Ras1 since mammalian Rheb and H-Ras both bind Raf-1 (CLARK et al. 1997 Down; YEE and WORELY 1997 Down). In many ways, the Byr2 kinase is analogous to Raf-1 since activated Ras binds both kinases to cause their translocation to the plasma membrane and activation of a MAP-kinase cascade. The sporulation of ras1- diploids provides a sensitive assay for Byr2 activation in vivo (BAUMAN and ALBRIGHT 1998). Even in this assay, though, there was no evidence that Rhb1 or Rhb1-Q64L stimulated Byr2 activity.

On the basis of the analysis of rhb1- mutants, we hypothesize that Rhb1 negatively regulates entry into stationary phase when extracellular nitrogen levels are adequate for growth. An analogous function for mammalian Rheb would be consistent with the transcriptional induction of rheb mRNA by growth factors and the similarity of Rheb-related GTPases to other Ras superfamily GTPases that regulate cell growth and differentiation. If this hypothesized function for Rhb1 is correct, then what pathways might be regulated by Rhb1? cAMP levels and Spc1 kinase activity are part of two pathways that respond to extracellular nutrients. rhb1 mutant phenotypes are not, however, consistent with Rhb1 signaling exclusively through the pathways that regulate cAMP or Spc1. In particular, mutants without cAMP continue to grow (YOUNG et al. 1989 Down; MAEDA et al. 1990 Down) while mutants that hyperactivate Spc1 are large, swollen, and frequently lyse (MILLAR et al. 1995 Down; SHIOZAKI and RUSSELL 1995 Down). Alternatively, Fnx1 expression or activity might be negatively regulated by Rhb1 since Fnx1 overexpression caused cells to enter stationary phase and Fnx1 is likely localized to the plasma membrane (DIMITROV and SAZER 1998 Down). However, even if Rhb1 negatively regulates Fnx1, Rhb1 must perform other essential functions since fnx1- mutants are viable and can enter stationary phase in some conditions. Our inability to identify likely Rhb1-signaling pathways by comparison to other mutant phenotypes means that additional biochemical and genetic approaches will be needed to further understand Rhb1 function.


*  FOOTNOTES

1 Present address: Department of Developmental Biology, Stanford University School of Medicine, Stanford, CA 94305. Back


*  ACKNOWLEDGMENTS

We thank Dr. Kathleen Gould for providing strains and plasmids used in this study and David McFarland and Melanie Wright for assistance with flow cytometric analysis. Experiments were performed in part through the use of the VUMC Cell Imaging Resource (supported by CA68485 and DK20593). This work was supported by National Institutes of Health grant GM-51952.

Manuscript received July 8, 1999; Accepted for publication March 3, 2000.


*  LITERATURE CITED
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

ALFA, C., J. HYAMS, M. MCLEOD and E. WARBRIK, 1993 Experiments With Fission Yeast: A Laboratory Course Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

AUSUBEL, F., R. BRENT, R. KINGSTON, D. MOORE, J. SEIDMAN et al., (Editors), 1995 Current Protocols in Molecular Biology. John Wiley & Sons, New York.

BASI, G., E. SCHMID, and K. MAUNDRELL, 1993  TATA box mutations in the Schizosaccharomyces pombe nmt1 promoter affect transcription efficiency but not transcription start point or thiamine repressibility. Gene 123:131-136[Medline].

BAUMAN, P. and C. ALBRIGHT, 1998  Functional analysis of domains in the Byr2 kinase. Biochimie 80:621-625[Medline].

BOGUSKI, M. S. and F. MCCORMICK, 1993  Proteins regulating ras and its relatives. Nature 366:643-654[Medline].

BOS, J., 1997  Ras-like GTPases. Biochim. Biophys. Acta 1333:M19-M31[Medline].

BOURNE, H. R., D. A. SANDERS, and F. MCCORMICK, 1990  The GTPase superfamily: a conserved switch for diverse cell functions. Nature 348:125-132[Medline].

BOURNE, H., D. SANDERS, and F. MCCORMICK, 1991  The GTPase superfamily: conserved structure and molecular mechanism. Nature 349:117-127[Medline].

CAMPBELL, S. L., R. KHOSRAVI-FAR, K. L. ROSSMAN, G. J. CLARK, and C. J. DER, 1998  Increasing complexity of Ras signaling. Oncogene 17:1395-1413[Medline].

CHANG, E. C., M. BARR, Y. WANG, V. JUNG, and H.-P. XU et al., 1994  Cooperative interaction of S. pombe proteins required for mating and morphogenesis. Cell 79:131-141[Medline].

CLARK, G. J., M. S. KINCH, K. ROGERS-GRAHAM, S. M. SEBTI, and A. D. HAMILTON et al., 1997  The Ras-related protein Rheb is farnesylated and antagonizes Ras signaling and transformation. J. Biol. Chem. 272:10608-10615[Abstract/Free Full Text].

COOK, S. J. and F. MCCORMICK, 1993  Inhibition by cAMP of ras-dependent activation of raf.. Science 262:1069-1072[Abstract/Free Full Text].

COSTELLO, G., L. RODGERS, and D. BEACH, 1986  Fission yeast enters the stationary phase G0 from either mitotic G1 or G2. Curr. Genet. 11:119-125.

DAVEY, J., 1998  Fusion of a fission yeast. Yeast 14:1529-1566[Medline].

DEVOTI, J., G. SEYDOUX, D. BEACH, and M. MCLEOD, 1991  Interaction between ran1+ protein kinase and cAMP dependent protein kinase as negative regulators of fission yeast meiosis. EMBO J. 10:3759-3768[Medline].

DIMITROV, K. and S. SAZER, 1998  The role of fnx1, a fission yeast multidrug resistance protein, in the transition of cells to a quiescent G0 state. Mol. Cell. Biol. 18:5239-5246[Abstract/Free Full Text].

FANTES, P. and P. NURSE, 1977  Control of cell size at division in fission yeast by a growth-modulated size control over nuclear division. Exp. Cell Res. 107:377-386[Medline].

FISHER, D. and P. NURSE, 1996  A single fission yeast mitotic cyclin B p34cdc2 kinase promotes both S-phase and mitosis in the absence of G1 cyclins. EMBO J. 15:850-860[Medline].

FORSBURG, S., 1993  Comparison of Schizosaccharomyces pombe expression systems. Nucleic Acids Res. 21:2955-2956[Free Full Text].

FUKUI, Y. and M. YAMAMOTO, 1988  Isolation and characterization of Schizosaccharomyces pombe mutants phenotypically similar to ras1-. Mol. Gen. Genet. 215:26-31[Medline].

FUKUI, Y., T. KOZASA, Y. KAZIRO, T. TAKEDA, and M. YAMAMOTO, 1986  Role of a ras homolog in the life cycle of Schizosaccharomyces pombe.. Cell 44:329-336[Medline].

GROMOV, P. S., P. MADSEN, N. TOMERUP, and J. E. CELIS, 1995  A novel approach for expression cloning of small GTPases: identification, tissue distribution and chromosome mapping of the human homolog of rheb. FEBS Lett. 377:221-226[Medline].

HIGGINS, D., J. THOMPSON, and T. GIBSON, 1996  Using CLUSTAL for multiple sequence alignments. Methods Enzymol. 266:383-402[Medline].

KUNKEL, T. A., 1985  Rapid and efficient site-specific mutagenesis without phenotypic selection. Proc. Natl. Acad. Sci. USA 82:488-492[Abstract/Free Full Text].

MACH, K. E., Q. CHENG, and C. F. ALBRIGHT, 1998  ras1 and pat1 alleles interact to quantitatively and qualitatively alter conjugation in fission yeast. Curr. Genet. 34:172-182[Medline].

MAEDA, T., T. MOCHIZUKI, and M. YAMAMOTO, 1990  Adenylyl cyclase is dispensable for vegetative cell growth in the fission yeast Schizosaccharomyces pombe.. Proc. Natl. Acad. Sci. USA 87:7814-7818[Abstract/Free Full Text].

MASUDA, T., K. KARIYA, M. SHINKAI, T. OKADA, and T. KATAOKA, 1995  Protein kinase byr2 is a target of ras1 in the fission yeast Schizosaccharomyces pombe.. J. Biol. Chem. 270:1979-1982[Abstract/Free Full Text].

MAUNDRELL, K., 1993  Thiamine-repressible expression vectors pREP and pRIP for fission yeast. Gene 123:127-130[Medline].

MILLAR, J. B., A. BUCK, and M. G. WILKINSON, 1995  Pyp1 and Pyp2 PTPases dephosphorylate an osmosensing MAP kinase controlling cell size at division in fission yeast. Genes Dev. 9:2117-2130[Abstract/Free Full Text].

MOCHIZUKI, N. and M. YAMAMOTO, 1992  Reduction in the intracellular cAMP level triggers initiation of sexual development in fission yeast. Mol. Gen. Genet. 233:17-24[Medline].

MOORES, S., M. SCHABER, S. MOSSER, E. RANDS, and M. O'HARA et al., 1991  Sequence dependence of protein isoprenylation. J. Biol. Chem. 266:14603-14610[Abstract/Free Full Text].

MORENO, S., A. KLAR, and P. NURSE, 1991  Molecular genetic analysis of fission yeast Schizosaccharomyces pombe.. Methods Enzymol. 194:795-823[Medline].

NADIN-DAVIS, S. A. and A. NASIM, 1988  A gene which encodes a predicted protein kinase can restore some functions of the ras gene in fission yeast. EMBO J. 7:985-993[Medline].

NADIN-DAVIS, S. A., A. NASIM, and D. BEACH, 1986  Involvement of ras in sexual differentiation but not in growth control in fission yeast. EMBO J. 11:2963-2971.

SAMBROOK, J., E. F. FRITSCH and T. MANIATIS, 1989 Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

SHIOZAKI, K. and P. RUSSELL, 1995  Cell-cycle control linked to extracellular environment by MAP kinase pathway in fission yeast. Nature 378:739-743[Medline].

SHIOZAKI, K. and P. RUSSELL, 1996  Conjugation, meiosis, and the osmotic stress response are regulated by the Spc1 kinase through Atf1 transcription factor in fission yeast. Genes Dev. 10:2276-2288[Abstract/Free Full Text].

SHIRAYAMA, M., Y. MATSUI, and A. TOH-E, 1994  The yeast TEM1 gene, which encodes a GTP-binding protein, is involved in termination of M phase. Mol. Cell. Biol. 14:7476-7482[Abstract/Free Full Text].

SONG, K., K. E. MACH, C.-Y. CHEN, T. REYNOLDS, and C. F. ALBRIGHT, 1996  A novel suppressor of ras1 in fission yeast, bry4, is a dosage-dependent inhibitor of cytokinesis. J. Cell Biol. 133:1307-1319[Abstract/Free Full Text].

STANG, S., D. BOTTORFF, and J. STONE, 1997  Interaction of activated Ras with Raf-1 alone may be sufficient for transformation of rat2 cells. Mol. Cell. Biol. 17:3047-3055[Abstract/Free Full Text].

SU, S. S. Y., Y. TANAKA, I. SAMEJIMA, K. TANAKA, and M. YANAGIDA, 1996  A nitrogen starvation-induced dormant G0 state in fission yeast: the establishment from uncommitted G1 state and its delay for return to proliferation. J. Cell Sci. 109:1347-1357[Abstract].

TODA, T., M. SHIMANUKI, and M. YANAGIDA, 1991  Fission yeast genes that confer resistance to staurosporine encode an AP-1-like transcription factor and a protein kinase related to the mammalian ERK1/MAP2 and budding yeast FUS3 and KSS1 kinases. Genes Dev. 5:60-73[Abstract/Free Full Text].

TU, H., M. BARR, D. DONG, and M. WIGLER, 1997  Multiple regulatory domains on the Byr2 protein kinase. Mol. Cell. Biol. 17:5876-5887[Abstract/Free Full Text].

VAN AELST, L., M. BARR, S. MARCUS, A. POLVERINO, and M. WIGLER, 1993  Complex formation between ras and raf and other protein kinases. Proc. Natl. Acad. Sci. USA 90:6213-6217[Abstract/Free Full Text].

WANG, Y., H.-P. XU, M. RIGGS, L. RODGERS, and M. WIGLER, 1991  byr2, a Schizosaccharomyces pombe gene encoding a protein kinase capable of partial suppression of the ras1 mutant phenotype. Mol. Cell. Biol. 11:3554-3563[Abstract/Free Full Text].

WANTANABE, Y., Y. IINO, K. FURAHATA, C. SHIMODA, and M. YAMAMOTO, 1988  The S. pombe mei2 gene encoding a crucial molecule for commitment to meiosis is under the regulation of cAMP. EMBO J. 7:761-767[Medline].

WARSHAWSKY, D. and L. MILLER, 1994  Improved method for rapid transformation of intact Schizosaccharomyces pombe cells. Biotechniques 16:798-799[Medline].

WERNER-WASHBURNE, M., E. BRAUN, G. JOHNSTON, and R. SINGER, 1993  Stationary phase in the yeast Saccharomyces cerevisiae.. Microbiol. Rev. 57:383-401[Abstract/Free Full Text].

WU, J., P. DENT, T. JELINEK, A. WOLFMAN, and M. J. WEBER et al., 1993  Inhibition of the EGF-activated MAP kinase signaling pathway by adenosine 3',5'-monophosphate. Science 262:1065-1069[Abstract/Free Full Text].

YAMAGATA, K., L. K. SANDERS, W. E. KAUFMANN, W. YEE, and C. A. BARNES et al., 1994  rheb, a growth factor and synaptic activity regulated gene, encodes a novel Ras-related protein. J. Biol. Chem. 269:16333-16369[Abstract/Free Full Text].

YEE, W. M. and P. F. WORELY, 1997  Rheb interacts with Raf-1 and may function to integrate growth factor- and protein kinase A-dependent signals. Mol. Cell. Biol. 17:921-933[Abstract/Free Full Text].

YOUNG, D., M. RIGGS, J. FIELD, A. VOJTEK, and D. BROEK et al., 1989  The adenylyl cyclase gene from Schizosaccharomyces pombe.. Proc. Natl. Acad. Sci. USA 86:7989-7993[Abstract/Free Full Text].




This article has been cited by other articles:


Home page
GeneticsHome page
T. Murai, Y. Nakase, K. Fukuda, Y. Chikashige, C. Tsutsumi, Y. Hiraoka, and T. Matsumoto
Distinctive Responses to Nitrogen Starvation in the Dominant Active Mutants of the Fission Yeast Rheb GTPase
Genetics, October 1, 2009; 183(2): 517 - 527.
[Abstract] [Full Text] [PDF]


Home page
GENES CELLSHome page
T. Hayashi, M. Hatanaka, K. Nagao, Y. Nakaseko, J. Kanoh, A. Kokubu, M. Ebe, and M. Yanagida
Rapamycin sensitivity of the Schizosaccharomyces pombe tor2 mutant and organization of two highly phosphorylated TOR complexes by specific and common subunits.
Genes Cells, December 1, 2007; 12(12): 1357 - 1370.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
T. Matsuo, Y. Otsubo, J. Urano, F. Tamanoi, and M. Yamamoto
Loss of the TOR Kinase Tor2 Mimics Nitrogen Starvation and Activates the Sexual Development Pathway in Fission Yeast
Mol. Cell. Biol., April 15, 2007; 27(8): 3154 - 3164.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
R. Weisman, I. Roitburg, M. Schonbrun, R. Harari, and M. Kupiec
Opposite Effects of Tor1 and Tor2 on Nitrogen Starvation Responses in Fission Yeast
Genetics, March 1, 2007; 175(3): 1153 - 1162.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. Urano, T. Sato, T. Matsuo, Y. Otsubo, M. Yamamoto, and F. Tamanoi
Point mutations in TOR confer Rheb-independent growth in fission yeast and nutrient-independent mammalian TOR signaling in mammalian cells
PNAS, February 27, 2007; 104(9): 3514 - 3519.
[Abstract] [Full Text] [PDF]


Home page
GENES CELLSHome page
M. Uritani, H. Hidaka, Y. Hotta, M. Ueno, T. Ushimaru, and T. Toda
Fission yeast Tor2 links nitrogen signals to cell proliferation and acts downstream of the Rheb GTPase
Genes Cells, December 1, 2006; 11(12): 1367 - 1379.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
B. Alvarez and S. Moreno
Fission yeast Tor2 promotes cell growth and represses cell differentiation
J. Cell Sci., November 1, 2006; 119(21): 4475 - 4485.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
Y. Nakase, K. Fukuda, Y. Chikashige, C. Tsutsumi, D. Morita, S. Kawamoto, M. Ohnuki, Y. Hiraoka, and T. Matsumoto
A Defect in Protein Farnesylation Suppresses a Loss of Schizosaccharomyces pombe tsc2+, a Homolog of the Human Gene Predisposing to Tuberous Sclerosis Complex
Genetics, June 1, 2006; 173(2): 569 - 578.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
M. van Slegtenhorst, A. Mustafa, and E. P. Henske
Pas1, a G1 cyclin, regulates amino acid uptake and rescues a delay in G1 arrest in Tsc1 and Tsc2 mutants in Schizosaccharomyces pombe
Hum. Mol. Genet., October 1, 2005; 14(19): 2851 - 2858.
[Abstract] [Full Text] [PDF]


Home page
Microbiol. Mol. Biol. Rev.Home page
K. Inoki, H. Ouyang, Y. Li, and K.-L. Guan
Signaling by Target of Rapamycin Proteins in Cell Growth Control
Microbiol. Mol. Biol. Rev., March 1, 2005; 69(1): 79 - 100.
[Abstract] [Full Text] [PDF]


Home page
J BiochemHome page
K. Saito, Y. Araki, K. Kontani, H. Nishina, and T. Katada
Novel Role of the Small GTPase Rheb: Its Implication in Endocytic Pathway Independent of the Activation of Mammalian Target of Rapamycin
J. Biochem., March 1, 2005; 137(3): 423 - 430.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
Y. Li, K. Inoki, and K.-L. Guan
Biochemical and Functional Characterizations of Small GTPase Rheb and TSC2 GAP Activity
Mol. Cell. Biol., September 15, 2004; 24(18): 7965 - 7975.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
N. Hay and N. Sonenberg
Upstream and downstream of mTOR
Genes & Dev., August 15, 2004; 18(16): 1926 - 1945.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. van Slegtenhorst, E. Carr, R. Stoyanova, W. D. Kruger, and E. P. Henske
Tsc1+ and tsc2+ Regulate Arginine Uptake and Metabolism in Schizosaccharomyces pombe
J. Biol. Chem., March 26, 2004; 279(13): 12706 - 12713.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
Y. Kim, D. Ramirez-Montealegre, and D. A. Pearce
A role in vacuolar arginine transport for yeast Btn1p and for human CLN3, the protein defective in Batten disease
PNAS, December 23, 2003; 100(26): 15458 - 15462.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. P. Tabancay Jr., C.-L. Gau, I. M. P. Machado, E. J. Uhlmann, D. H. Gutmann, L. Guo, and F. Tamanoi
Identification of Dominant Negative Mutants of Rheb GTPase and Their Use to Implicate the Involvement of Human Rheb in the Activation of p70S6K
J. Biol. Chem., October 10, 2003; 278(41): 39921 - 39930.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
P. H. Patel, N. Thapar, L. Guo, M. Martinez, J. Maris, C.-L. Gau, J. A. Lengyel, and F. Tamanoi
Drosophila Rheb GTPase is required for cell cycle progression and cell growth
J. Cell Sci., September 1, 2003; 116(17): 3601 - 3610.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. F. Castro, J. F. Rebhun, G. J. Clark, and L. A. Quilliam
Rheb Binds Tuberous Sclerosis Complex 2 (TSC2) and Promotes S6 Kinase Activation in a Rapamycin- and Farnesylation-dependent Manner
J. Biol. Chem., August 29, 2003; 278(35): 32493 - 32496.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
K. Inoki, Y. Li, T. Xu, and K.-L. Guan
Rheb GTPase is a direct target of TSC2 GAP activity and regulates mTOR signaling
Genes & Dev., August 1, 2003; 17(15): 1829 - 1834.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
J. C. Panepinto, B. G. Oliver, J. R. Fortwendel, D. L. H. Smith, D. S. Askew, and J. C. Rhodes
Deletion of the Aspergillus fumigatus Gene Encoding the Ras-Related Protein RhbA Reduces Virulence in a Model of Invasive Pulmonary Aspergillosis
Infect. Immun., May 1, 2003; 71(5): 2819 - 2826.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
A. Decottignies, I. Sanchez-Perez, and P. Nurse
Schizosaccharomyces pombe Essential Genes: A Pilot Study
Genome Res., March 1, 2003; 13(3): 399 - 406.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
P. Papadaki, V. Pizon, B. Onken, and E. C. Chang
Two Ras Pathways in Fission Yeast Are Differentially Regulated by Two Ras Guanine Nucleotide Exchange Factors
Mol. Cell. Biol., July 1, 2002; 22(13): 4598 - 4606.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
A. M. Joussen, S. Huang, V. Poulaki, K. Camphausen, W.-D. Beecken, B. Kirchhof, and A. P. Adamis
In Vivo Retinal Gene Expression in Early Diabetes
Invest. Ophthalmol. Vis. Sci., November 1, 2001; 42(12): 3047 - 3057.
[Abstract] [Full Text] [PDF]