| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Corresponding author: Charles F. Albright, DuPont Pharmaceuticals, 500 S. Ridgeway Ave., Glenolden, PA 19036., charles.f.albright{at}dupontpharma.com (E-mail)
Communicating editor: P. G. YOUNG
| ABSTRACT |
|---|
The Rheb GTPase is most similar in primary sequence to the Ras, Rap, R-Ras, and Ral GTPases, which regulate cell growth and differentiation in many cell types. A likely fission yeast homologue of mammalian Rheb, which we designated Rhb1, was identified by genome sequencing. Our investigation of rhb1 showed that rhb1- cells arrested cell growth and division with a terminal phenotype similar to that of nitrogen-starved cells. In particular, cells depleted of Rhb1 arrested as small, round cells with 1N DNA content, arrested more quickly in low-nitrogen medium, and induced expression of fnx1 and mei2 mRNA, two mRNAs that were normally induced by nitrogen starvation. Since mammalian Rheb binds and may regulate Raf-1, a Ras effector, we tested for functional overlap between Ras1 and Rhb1 in fission yeast. This analysis showed that Ras1 overexpression did not suppress rhb1- mutant phenotypes, Rhb1 overexpression did not suppress ras1- mutant phenotypes, and ras1- rhb1- double mutants had phenotypes equal to the sum of the corresponding single-mutant phenotypes. Hence, there is no evidence for overlapping functions between Ras1 and Rhb1. On the basis of this study, we hypothesize that Rhb1 negatively regulates entry into stationary phase when extracellular nitrogen levels are adequate for growth. If this hypothesis is correct, then Rhb1 and Ras1 regulate alternative responses to limiting nutrients.
THE Ras superfamily of proteins are low molecular mass GTPases that cycle between an active, GTP-bound form and an inactive, GDP-bound form (reviewed in ![]()
![]()
The Ras superfamily can be divided into subfamilies based on primary sequence comparisons (reviewed in ![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
The fission yeast Schizosaccharomyces pombe is a good model system to study Ras signaling. S. pombe contains a single Ras gene, ras1, that is required to respond to pheromones and maintain cell polarity (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
S. pombe cells respond to limiting nutrients in at least three ways. First, mating can occur when nitrogen is limiting and cells of the opposite mating type are present (reviewed in ![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
The conflicting data on the effect of Rheb on Raf-1 and the identification of a likely S. pombe Rheb homologue, which we designated rhb1, prompted us to study Rhb1. This analysis showed that cells depleted of Rhb1 arrested growth with a terminal phenotype similar to that of nitrogen-starved cells. On the basis of this terminal phenotype and the lack of interactions between rhb1 and ras1 mutants, we hypothesize that Rhb1 regulates the entry into stationary phase while Ras1 regulates mating. If this hypothesis is accurate, then Rhb1 and Ras regulate alternative responses to limiting nutrients.
| MATERIALS AND METHODS |
|---|
Strains and growth conditions:
The yeast strains used in this study are listed in Table 1. S. pombe was grown at 30° in yeast extract medium (YE) or minimal medium (MM) with required supplements at 75 mg/liter (![]()
![]()
![]()
![]()
|
To construct the rhb1- allele, a 2.27-kb DNA fragment, from 1.2 kb 5' of the rhb1 start codon to 0.8 kb 3' of the rhb1 stop codon was amplified using the polymerase chain reaction (PCR; oligonucleotides attttcgaaggttttcactcactc and aactgcagcttaaaacccgtatcgcagacctc). The resulting DNA fragment was digested with KpnI and PstI and then ligated with pBSK that was similarly digested to create pBSKrhb1. pBSKrhb1 was partially digested with EcoRV and completely digested with XhoI to remove most of the rhb1 coding region and ligated with a DNA fragment that contained the ura4+ gene that had been digested with SmaI and XhoI to create pBSK
rhb1. pBSK
rhb1 was digested with KpnI and PstI and the linear DNA fragment containing the ura4+ gene was transformed into SP870 x KGY248 diploids. Stable ura4+ transformants were selected and diploids with one disrupted rhb1 allele, rhb1-, were identified by Southern blot (![]()
Plasmids:
Plasmid manipulation and bacterial transformation were performed by standard techniques (![]()
![]()
![]()
![]()
![]()
Western blot analysis:
A total of 108 cells were harvested by centrifugation, washed once in Stop buffer (150 mM NaCl, 50 mM NaF, 10 mM EDTA, 1 mM NaN3), resuspended in Stop buffer, boiled 5 min, and pelleted (![]()
Other techniques:
Northern blot analysis, flow cytometric analysis, sporulation rates, and microscopic techniques were performed as previously described (![]()
| RESULTS |
|---|
Rhb1 shares high sequence identity with the mammalian Rheb GTPase:
A hypothetical protein with high sequence identity to the mammalian Rheb GTPase was identified by the S. pombe Sequencing Group at the Sanger Centre. This hypothetical protein (SPBC428.16c), which we designated Rhb1, was sequenced as part of cosmid 428 on the left arm of chromosome II. The predicted Rhb1 protein has high sequence identity with human Rheb (52.2%), rat Rheb (52.2%), and hypothetical proteins Caenorhabditis elegans F54C8.5 (38.9%) and Saccharomyces cerevisiae YCR027c (37.3%; Fig 1). We will refer to these five GTPases as the Rheb-related GTPases since they are more similar to each other than to other Ras superfamily proteins. Consistent with the analysis of Rheb (![]()
![]()
![]()
|
In addition to overall sequence similarity, Rheb-related proteins share similarities to each other in likely functional domains (Fig 1; ![]()
![]()
![]()
![]()
![]()
![]()
rhb1 mRNA is constitutively expressed:
Rheb was originally identified as a protein whose mRNA was upregulated in hippocampal granule cells by seizures (![]()
![]()
![]()
![]()
|
rhb1 is essential for growth:
A null allele of rhb1, rhb1- was created by replacing one allele of rhb1 in diploids with the ura4+ gene (Fig 3A). Southern blot analysis confirmed that the ura4+ diploid strain contained one rhb1+ allele and one rhb1- allele (Fig 3B). The rhb1+/rhb1- heterozygous diploids were induced to sporulate and the resulting tetrads were dissected. In all cases, these tetrads segregated two ura-, viable spores and two nonviable spores (Fig 3C). rhb1- mutants were complemented by plasmids expressing rhb1+ (see below), confirming that the lethal phenotype was due to the lack of rhb1 function. While the rhb1- spores did not form colonies, these spores germinated and divided 13 times before arresting as small, rounded cells. We conclude that rhb1 is essential for growth.
|
Cells overexpressing wild-type or mutant rhb1 are indistinguishable from wild-type cells:
To further explore Rhb1 function, we tested the effect of Rhb1 overexpression. rhb1 containing an amino-terminal HA tag, rhb1-HA, was expressed using the thiamine-repressible nmt1+ promoter (![]()
|
To further characterize Rhb1 function, we generated three rhb1 mutants analogous to those with known phenotypes in H-ras (Table 2). The rhb1-Q64L mutant is analogous to the H-Ras-Q61L mutant, which is resistant to GAP-mediated GTPase stimulation and is, therefore, constitutively active (![]()
![]()
![]()
|
To test if rhb1-Q64L, rhb1-S20N, and rhb1-T38M were functional, we determined whether they complemented the rhb1- allele. For this purpose, rhb1 mutant expression plasmids were transformed into rhb1+/rhb1- diploids, diploids were induced to sporulate, and spores were germinated on plates that selected for the plasmid and the rhb1- allele. This analysis revealed that rhb1-Q64L, but not rhb1-S20N and rhb1-T38M, complemented the rhb1- allele (Table 2). Therefore, Rhb1-Q64L is functional while Rhb1-S20N and Rhb1-T38M are not functional.
rhb1- mutants arrest growth with a phenotype similar to nitrogen-starved cells:
Since rhb1 is an essential gene, we constructed a conditional rhb1 allele to more easily characterize the rhb1- phenotype. We first tested conditional expression of rhb1 in rhb1- mutants using the thiamine-repressible nmt1 promoter and its attenuated derivatives (![]()
![]()
![]()
|
We used the conditional expression of rhb1-D121A in rhb1- mutants, which we shall refer to as rhb1-D121A mutants, to further characterize the rhb1- phenotype. When actively growing rhb1-D121A mutants were shifted to media that repressed rhb1-D121A expression, cells completed about two doublings (6 hr) before cell division arrested (Fig 5B). Similar growth curves were observed with cultures at starting densities from 0.5 to 3.5 x 106 cells/ml (data not shown). However, growth arrest occurred sooner (4.5 hr) when rhb1-D121A was repressed in media with a poor nitrogen source (Fig 5B), indicating that rhb1-D121A mutants were hypersensitive to nitrogen deprivation. While terminally arrested rhb1-D121A mutants remained viable, as judged by phase-contrast microscopy, phloxine B staining, and vital dye staining (data not shown), rhb1-D121A mutants did not resume growth when the thiamine was removed from the media. Potential reasons for the irreversibility of the rhb1-D121A arrest will be discussed later.
The terminally arrested rhb1-D121A mutant cells were stained with 4',6-diamidino-2-phenylindole (DAPI) and Calcofluor to visualize DNA and septal material. This analysis showed that rhb1-D121A mutants arrested as small, round cells without detectable defects in karyokinesis or cytokinesis (Fig 5C). Since the terminal phenotype of these mutants resembled cells starved for nitrogen, a direct comparison of nitrogen-starved cells was performed. This analysis showed that rhb1+ cells starved for nitrogen were morphologically indistinguishable from terminally arrested rhb1-D121A mutants (Fig 5C).
Wild-type cells starved of nitrogen enter stationary phase with a 1N DNA content while cells starved for carbon enter stationary phase with a 2N DNA content (![]()
![]()
Nitrogen-starved cells induced fnx1 and mei2 mRNA (![]()
![]()
![]()
Ras1 and Rhb1 do not perform overlapping functions:
Since mammalian Rheb binds Raf-1, a Ras effector, and may influence Raf-1 function, several genetic experiments were conducted to test for interactions between Rhb1 and Ras1. We first tested for cross-suppression of mutant phenotypes. ras1- mutants cannot conjugate, have reduced sporulation rates, and are round, instead of rod shaped. To determine if Rhb1 could suppress any of these defects, Rhb1 and Rhb1-Q64L, a functional and potentially activated mutant, were overexpressed in ras1- mutants. This analysis showed that overexpression of neither Rhb1 nor Rhb1-Q64L affected the morphology, conjugation rate, or sporulation rate of ras1- mutants (Table 3; data not shown). Control experiments verified that Ras1 expression complemented all the defects of ras1- mutants (Table 3; data not shown). To determine if Ras1 could suppress the lethality of rhb1- mutants, Ras1 and Ras1-V12, an activated mutant, were overexpressed in rhb1+/rhb1- diploids, diploids were induced to sporulate, and spores were germinated on plates where only rhb1- mutants could grow. This analysis revealed that neither ras1 nor ras-V17 suppressed the lethality of rhb1- mutants (data not shown). In contrast, rhb1 expression complemented rhb1- mutants (Fig 5A). We conclude that Ras1 overexpression cannot suppress rhb1- mutant phenotypes and Rhb1 overexpression cannot suppress ras1- mutant phenotypes.
|
To further test for potential overlapping functions shared by ras1 and rhb1, we crossed the ras1- mutation into the background of the conditional rhb1- mutants and analyzed the phenotype of the resulting double mutant. The ras1- rhb1-D121A mutants were round, did not conjugate, grew at a rate indistinguishable from ras1+rhb1+ cells, and arrested growth at a rate (Fig 6) and with a DNA content that was indistinguishable from rhb1-D121A mutants (data not shown). Hence, ras1- rhb1-D121A mutants had phenotypes that were equal to the sum of phenotypes of the corresponding single mutants. The lack of genetic interactions between ras1 and rhb1 mutations suggests that Ras1 and Rhb1 GTPases perform nonoverlapping functions.
|
rhb1-D121A mutants are only slightly affected by mutations in the cAMP pathway:
The cAMP pathway plays a critical role in the response of fission yeast to changes in extracellular nutrients. For instance, cyr1- mutants, which lack adenylate cyclase activity and consequently cAMP, have characteristics of starved cells even when grown in plentiful nutrients. In particular, cyr1- mutants grow slower than wild-type cells and conjugate in the presence of excess nutrients (![]()
![]()
|
| DISCUSSION |
|---|
This study investigated the S. pombe rhb1 gene. The predicted Rhb1 protein is most similar to Rheb-related GTPases that are found in budding yeast, C. elegans, rats, and humans. The sequence similarity of the Rheb-related proteins, especially at residues analogous to H-Ras codon 12, the effector domain, and CAAX box, suggests that these proteins perform similar cellular functions. While C. elegans F54C8.5 protein is more similar to the Rheb-related proteins than to other Ras superfamily GTPases, this C. elegans protein differs from other Rheb-related proteins at three amino acids in its effector domain, suggesting that it may perform unique functions. rhb1 mRNA was expressed at similar levels in actively growing cells, nitrogen-starved cells, and osmotically stressed cells, suggesting that rhb1, unlike the mammalian rheb gene, is not transcriptionally regulated.
rhb1 is essential for growth since rhb1- spores germinated but arrested growth after 13 divisions as small, rounded cells. The rhb1- terminal phenotype was further analyzed using the conditional expression of rhb1-D121A, a hypomorphic mutant. When rhb1-D121A expression was repressed, cells underwent approximately two cell divisions before arresting cell growth and division as small, rounded cells with a 1N DNA content. The similarity of this terminal phenotype to that of nitrogen-starved cells prompted us to test for other similarities. This analysis showed that rhb1-D121A mutants were hypersensitive to nitrogen levels in the media and transcriptionally induced two genes, fnx1 and mei2, that are induced in rhb1+ cells that are nitrogen starved.
Our analysis of rbh1- mutants revealed only one difference between rhb1- cells and nitrogen-starved cells: rhb1-D121A mutants were terminally arrested while nitrogen-starved cells resumed growth when nitrogen levels were increased. Several mechanisms could explain the irreversibility of the rhb1-D121A growth arrest. First, rhb1-D121A mutants might lose viability by lysis or another lethal event. While this possibility cannot be excluded, microscopic examination of the rhb1-D121A arrested cells provided no evidence of cell lysis or other abnormalities. Second, rhb1-D121A arrested cells may have entered an aberrant stationary state. Entry into stationary phase in yeast is a complex process (reviewed in ![]()
On the basis of structural and regulatory similarities between Ras superfamily GTPases, it is frequently possible to construct dominant-positive mutants and dominant-negative mutants that can help analyze GTPase functions. The analogous mutants in rhb1 were, however, uninformative. In particular, neither the potential dominant-positive mutant, rhb1-Q64L, nor the potential dominant-negative mutant, rhb1-S20N, had dominant phenotypes when overexpressed. In light of these results, it is interesting that overexpression of the analogous Rheb mutants also failed to affect the growth of NIH-3T3 cells (![]()
![]()
We found no evidence for overlapping functions regulated by Ras1 and Rhb1. In particular, overexpression of ras1 did not suppress the lethality of rhb1- mutants and overexpression of rhb1 did not suppress the morphological or mating defects of ras1null mutants. Furthermore, ras1- rhb1-D121A mutants had phenotypes that would be expected from simply adding the phenotypes of ras1- and rhb1-D121A mutants. We were particularly interested in shared effectors for Rhb1 and Ras1 since mammalian Rheb and H-Ras both bind Raf-1 (![]()
![]()
On the basis of the analysis of rhb1- mutants, we hypothesize that Rhb1 negatively regulates entry into stationary phase when extracellular nitrogen levels are adequate for growth. An analogous function for mammalian Rheb would be consistent with the transcriptional induction of rheb mRNA by growth factors and the similarity of Rheb-related GTPases to other Ras superfamily GTPases that regulate cell growth and differentiation. If this hypothesized function for Rhb1 is correct, then what pathways might be regulated by Rhb1? cAMP levels and Spc1 kinase activity are part of two pathways that respond to extracellular nutrients. rhb1 mutant phenotypes are not, however, consistent with Rhb1 signaling exclusively through the pathways that regulate cAMP or Spc1. In particular, mutants without cAMP continue to grow (![]()
![]()
![]()
![]()
![]()
| FOOTNOTES |
|---|
1 Present address: Department of Developmental Biology, Stanford University School of Medicine, Stanford, CA 94305. ![]()
| ACKNOWLEDGMENTS |
|---|
We thank Dr. Kathleen Gould for providing strains and plasmids used in this study and David McFarland and Melanie Wright for assistance with flow cytometric analysis. Experiments were performed in part through the use of the VUMC Cell Imaging Resource (supported by CA68485 and DK20593). This work was supported by National Institutes of Health grant GM-51952.
Manuscript received July 8, 1999; Accepted for publication March 3, 2000.
| LITERATURE CITED |
|---|
ALFA, C., J. HYAMS, M. MCLEOD and E. WARBRIK, 1993 Experiments With Fission Yeast: A Laboratory Course Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
AUSUBEL, F., R. BRENT, R. KINGSTON, D. MOORE, J. SEIDMAN et al., (Editors), 1995 Current Protocols in Molecular Biology. John Wiley & Sons, New York.
BASI, G., E. SCHMID, and K. MAUNDRELL, 1993 TATA box mutations in the Schizosaccharomyces pombe nmt1 promoter affect transcription efficiency but not transcription start point or thiamine repressibility. Gene 123:131-136[Medline].
BAUMAN, P. and C. ALBRIGHT, 1998 Functional analysis of domains in the Byr2 kinase. Biochimie 80:621-625[Medline].
BOGUSKI, M. S. and F. MCCORMICK, 1993 Proteins regulating ras and its relatives. Nature 366:643-654[Medline].
BOS, J., 1997 Ras-like GTPases. Biochim. Biophys. Acta 1333:M19-M31[Medline].
BOURNE, H. R., D. A. SANDERS, and F. MCCORMICK, 1990 The GTPase superfamily: a conserved switch for diverse cell functions. Nature 348:125-132[Medline].
BOURNE, H., D. SANDERS, and F. MCCORMICK, 1991 The GTPase superfamily: conserved structure and molecular mechanism. Nature 349:117-127[Medline].
CAMPBELL, S. L., R. KHOSRAVI-FAR, K. L. ROSSMAN, G. J. CLARK, and C. J. DER, 1998 Increasing complexity of Ras signaling. Oncogene 17:1395-1413[Medline].
CHANG, E. C., M. BARR, Y. WANG, V. JUNG, and H.-P. XU et al., 1994 Cooperative interaction of S. pombe proteins required for mating and morphogenesis. Cell 79:131-141[Medline].
CLARK, G. J., M. S. KINCH, K. ROGERS-GRAHAM, S. M. SEBTI, and A. D. HAMILTON et al., 1997 The Ras-related protein Rheb is farnesylated and antagonizes Ras signaling and transformation. J. Biol. Chem. 272:10608-10615
COOK, S. J. and F. MCCORMICK, 1993 Inhibition by cAMP of ras-dependent activation of raf.. Science 262:1069-1072
COSTELLO, G., L. RODGERS, and D. BEACH, 1986 Fission yeast enters the stationary phase G0 from either mitotic G1 or G2. Curr. Genet. 11:119-125.
DAVEY, J., 1998 Fusion of a fission yeast. Yeast 14:1529-1566[Medline].
DEVOTI, J., G. SEYDOUX, D. BEACH, and M. MCLEOD, 1991 Interaction between ran1+ protein kinase and cAMP dependent protein kinase as negative regulators of fission yeast meiosis. EMBO J. 10:3759-3768[Medline].
DIMITROV, K. and S. SAZER, 1998 The role of fnx1, a fission yeast multidrug resistance protein, in the transition of cells to a quiescent G0 state. Mol. Cell. Biol. 18:5239-5246
FANTES, P. and P. NURSE, 1977 Control of cell size at division in fission yeast by a growth-modulated size control over nuclear division. Exp. Cell Res. 107:377-386[Medline].
FISHER, D. and P. NURSE, 1996 A single fission yeast mitotic cyclin B p34cdc2 kinase promotes both S-phase and mitosis in the absence of G1 cyclins. EMBO J. 15:850-860[Medline].
FORSBURG, S., 1993 Comparison of Schizosaccharomyces pombe expression systems. Nucleic Acids Res. 21:2955-2956
FUKUI, Y. and M. YAMAMOTO, 1988 Isolation and characterization of Schizosaccharomyces pombe mutants phenotypically similar to ras1-. Mol. Gen. Genet. 215:26-31[Medline].
FUKUI, Y., T. KOZASA, Y. KAZIRO, T. TAKEDA, and M. YAMAMOTO, 1986 Role of a ras homolog in the life cycle of Schizosaccharomyces pombe.. Cell 44:329-336[Medline].
GROMOV, P. S., P. MADSEN, N. TOMERUP, and J. E. CELIS, 1995 A novel approach for expression cloning of small GTPases: identification, tissue distribution and chromosome mapping of the human homolog of rheb. FEBS Lett. 377:221-226[Medline].
HIGGINS, D., J. THOMPSON, and T. GIBSON, 1996 Using CLUSTAL for multiple sequence alignments. Methods Enzymol. 266:383-402[Medline].
KUNKEL, T. A., 1985 Rapid and efficient site-specific mutagenesis without phenotypic selection. Proc. Natl. Acad. Sci. USA 82:488-492
MACH, K. E., Q. CHENG, and C. F. ALBRIGHT, 1998 ras1 and pat1 alleles interact to quantitatively and qualitatively alter conjugation in fission yeast. Curr. Genet. 34:172-182[Medline].
MAEDA, T., T. MOCHIZUKI, and M. YAMAMOTO, 1990 Adenylyl cyclase is dispensable for vegetative cell growth in the fission yeast Schizosaccharomyces pombe.. Proc. Natl. Acad. Sci. USA 87:7814-7818
MASUDA, T., K. KARIYA, M. SHINKAI, T. OKADA, and T. KATAOKA, 1995 Protein kinase byr2 is a target of ras1 in the fission yeast Schizosaccharomyces pombe.. J. Biol. Chem. 270:1979-1982
MAUNDRELL, K., 1993 Thiamine-repressible expression vectors pREP and pRIP for fission yeast. Gene 123:127-130[Medline].
MILLAR, J. B., A. BUCK, and M. G. WILKINSON, 1995 Pyp1 and Pyp2 PTPases dephosphorylate an osmosensing MAP kinase controlling cell size at division in fission yeast. Genes Dev. 9:2117-2130
MOCHIZUKI, N. and M. YAMAMOTO, 1992 Reduction in the intracellular cAMP level triggers initiation of sexual development in fission yeast. Mol. Gen. Genet. 233:17-24[Medline].
MOORES, S., M. SCHABER, S. MOSSER, E. RANDS, and M. O'HARA et al., 1991 Sequence dependence of protein isoprenylation. J. Biol. Chem. 266:14603-14610
MORENO, S., A. KLAR, and P. NURSE, 1991 Molecular genetic analysis of fission yeast Schizosaccharomyces pombe.. Methods Enzymol. 194:795-823[Medline].
NADIN-DAVIS, S. A. and A. NASIM, 1988 A gene which encodes a predicted protein kinase can restore some functions of the ras gene in fission yeast. EMBO J. 7:985-993[Medline].
NADIN-DAVIS, S. A., A. NASIM, and D. BEACH, 1986 Involvement of ras in sexual differentiation but not in growth control in fission yeast. EMBO J. 11:2963-2971.
SAMBROOK, J., E. F. FRITSCH and T. MANIATIS, 1989 Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
SHIOZAKI, K. and P. RUSSELL, 1995 Cell-cycle control linked to extracellular environment by MAP kinase pathway in fission yeast. Nature 378:739-743[Medline].
SHIOZAKI, K. and P. RUSSELL, 1996 Conjugation, meiosis, and the osmotic stress response are regulated by the Spc1 kinase through Atf1 transcription factor in fission yeast. Genes Dev. 10:2276-2288
SHIRAYAMA, M., Y. MATSUI, and A. TOH-E, 1994 The yeast TEM1 gene, which encodes a GTP-binding protein, is involved in termination of M phase. Mol. Cell. Biol. 14:7476-7482
SONG, K., K. E. MACH, C.-Y. CHEN, T. REYNOLDS, and C. F. ALBRIGHT, 1996 A novel suppressor of ras1 in fission yeast, bry4, is a dosage-dependent inhibitor of cytokinesis. J. Cell Biol. 133:1307-1319
STANG, S., D. BOTTORFF, and J. STONE, 1997 Interaction of activated Ras with Raf-1 alone may be sufficient for transformation of rat2 cells. Mol. Cell. Biol. 17:3047-3055[Abstract].
SU, S. S. Y., Y. TANAKA, I. SAMEJIMA, K. TANAKA, and M. YANAGIDA, 1996 A nitrogen starvation-induced dormant G0 state in fission yeast: the establishment from uncommitted G1 state and its delay for return to proliferation. J. Cell Sci. 109:1347-1357[Abstract].
TODA, T., M. SHIMANUKI, and M. YANAGIDA, 1991 Fission yeast genes that confer resistance to staurosporine encode an AP-1-like transcription factor and a protein kinase related to the mammalian ERK1/MAP2 and budding yeast FUS3 and KSS1 kinases. Genes Dev. 5:60-73
TU, H., M. BARR, D. DONG, and M. WIGLER, 1997 Multiple regulatory domains on the Byr2 protein kinase. Mol. Cell. Biol. 17:5876-5887[Abstract].
VAN AELST, L., M. BARR, S. MARCUS, A. POLVERINO, and M. WIGLER, 1993 Complex formation between ras and raf and other protein kinases. Proc. Natl. Acad. Sci. USA 90:6213-6217
WANG, Y., H.-P. XU, M. RIGGS, L. RODGERS, and M. WIGLER, 1991 byr2, a Schizosaccharomyces pombe gene encoding a protein kinase capable of partial suppression of the ras1 mutant phenotype. Mol. Cell. Biol. 11:3554-3563
WANTANABE, Y., Y. IINO, K. FURAHATA, C. SHIMODA, and M. YAMAMOTO, 1988 The S. pombe mei2 gene encoding a crucial molecule for commitment to meiosis is under the regulation of cAMP. EMBO J. 7:761-767[Medline].
WARSHAWSKY, D. and L. MILLER, 1994 Improved method for rapid transformation of intact Schizosaccharomyces pombe cells. Biotechniques 16:798-799[Medline].
WERNER-WASHBURNE, M., E. BRAUN, G. JOHNSTON, and R. SINGER, 1993 Stationary phase in the yeast Saccharomyces cerevisiae.. Microbiol. Rev. 57:383-401
WU, J., P. DENT, T. JELINEK, A. WOLFMAN, and M. J. WEBER et al., 1993 Inhibition of the EGF-activated MAP kinase signaling pathway by adenosine 3',5'-monophosphate. Science 262:1065-1069
YAMAGATA, K., L. K. SANDERS, W. E. KAUFMANN, W. YEE, and C. A. BARNES et al., 1994 rheb, a growth factor and synaptic activity regulated gene, encodes a novel Ras-related protein. J. Biol. Chem. 269:16333-16369
YEE, W. M. and P. F. WORELY, 1997 Rheb interacts with Raf-1 and may function to integrate growth factor- and protein kinase A-dependent signals. Mol. Cell. Biol. 17:921-933[Abstract].
YOUNG, D., M. RIGGS, J. FIELD, A. VOJTEK, and D. BROEK et al., 1989 The adenylyl cyclase gene from Schizosaccharomyces pombe.. Proc. Natl. Acad. Sci. USA 86:7989-7993
This article has been cited by other articles:
![]() |
T. Hayashi, M. Hatanaka, K. Nagao, Y. Nakaseko, J. Kanoh, A. Kokubu, M. Ebe, and M. Yanagida Rapamycin sensitivity of the Schizosaccharomyces pombe tor2 mutant and organization of two highly phosphorylated TOR complexes by specific and common subunits. Genes Cells, December 1, 2007; 12(12): 1357 - 1370. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Matsuo, Y. Otsubo, J. Urano, F. Tamanoi, and M. Yamamoto Loss of the TOR Kinase Tor2 Mimics Nitrogen Starvation and Activates the Sexual Development Pathway in Fission Yeast Mol. Cell. Biol., April 15, 2007; 27(8): 3154 - 3164. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Weisman, I. Roitburg, M. Schonbrun, R. Harari, and M. Kupiec Opposite Effects of Tor1 and Tor2 on Nitrogen Starvation Responses in Fission Yeast Genetics, March 1, 2007; 175(3): 1153 - 1162. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Urano, T. Sato, T. Matsuo, Y. Otsubo, M. Yamamoto, and F. Tamanoi Point mutations in TOR confer Rheb-independent growth in fission yeast and nutrient-independent mammalian TOR signaling in mammalian cells PNAS, February 27, 2007; 104(9): 3514 - 3519. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Uritani, H. Hidaka, Y. Hotta, M. Ueno, T. Ushimaru, and T. Toda Fission yeast Tor2 links nitrogen signals to cell proliferation and acts downstream of the Rheb GTPase Genes Cells, December 1, 2006; 11(12): 1367 - 1379. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Alvarez and S. Moreno Fission yeast Tor2 promotes cell growth and represses cell differentiation J. Cell Sci., November 1, 2006; 119(21): 4475 - 4485. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Nakase, K. Fukuda, Y. Chikashige, C. Tsutsumi, D. Morita, S. Kawamoto, M. Ohnuki, Y. Hiraoka, and T. Matsumoto A Defect in Protein Farnesylation Suppresses a Loss of Schizosaccharomyces pombe tsc2+, a Homolog of the Human Gene Predisposing to Tuberous Sclerosis Complex Genetics, June 1, 2006; 173(2): 569 - 578. [Abstract] [Full Text] [PDF] |
||||
![]() |