Genetics, Vol. 155, 85-104, May 2000, Copyright © 2000

A Transmembrane Guanylyl Cyclase (DAF-11) and Hsp90 (DAF-21) Regulate a Common Set of Chemosensory Behaviors in Caenorhabditis elegans

Deborah A. Birnby1,2,a, Elizabeth Malone Link1,3,a, Jennifer J. Vowels2,a, Hong Tiana, Patrick L. Colacurcioa, and James H. Thomasa
a Department of Genetics, University of Washington, Seattle, Washington 98195-7360

Corresponding author: James H. Thomas, Department of Genetics, Box 357360, University of Washington, Seattle, WA 98195-7360., jht{at}genetics.washington.edu (E-mail)

Communicating editor: I. GREENWALD


*  ABSTRACT
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Caenorhabditis elegans daf-11 and daf-21 mutants share defects in specific chemosensory responses mediated by several classes of sensory neurons, indicating that these two genes have closely related functions in an assortment of chemosensory pathways. We report that daf-11 encodes one of a large family of C. elegans transmembrane guanylyl cyclases (TM-GCs). The cyclic GMP analogue 8-bromo-cGMP rescues a sensory defect in both daf-11 and daf-21 mutants, supporting a role for DAF-11 guanylyl cyclase activity in this process and further suggesting that daf-21 acts at a similar step. daf-11::gfp fusions are expressed in five identified pairs of chemosensory neurons in a pattern consistent with most daf-11 mutant phenotypes. We also show that daf-21 encodes the heat-shock protein 90 (Hsp90), a chaperone with numerous specific protein targets. We show that the viable chemosensory-deficient daf-21 mutation is an unusual allele resulting from a single amino acid substitution and that the daf-21 null phenotype is early larval lethality. These results demonstrate that cGMP is a prominent second messenger in C. elegans chemosensory transduction and suggest a previously unknown role for Hsp90 in regulating cGMP levels.


LIKE all free-living organisms, Caenorhabditis elegans responds to a variety of environmental stimuli. The presence of food affects locomotion, egg laying, and defecation (B. SAWIN, C. TRENT and H. R. HORVITZ, personal communication; LIU and THOMAS 1994 Down). Specific volatile and nonvolatile chemicals attract or repel C. elegans in chemotaxis assays (WARD 1973 Down; DUSENBERY 1974 Down; BARGMANN et al. 1993 Down), and a constitutively secreted pheromone regulates development (GOLDEN and RIDDLE 1982 Down, GOLDEN and RIDDLE 1984A Down). daf-11 and daf-21 mutants have similar defects in several of these responses (reviewed in RIDDLE and ALBERT 1997 Down), suggesting that the daf-11 and daf-21 gene products (DAF-11 and DAF-21) act at the same step to regulate chemosensory transduction in several types of sensory neurons.

In C. elegans, bilaterally symmetric pairs of ciliated sensory neurons in the head amphid sensilla mediate many chemosensory behaviors. For example, C. elegans is attracted to a variety of nonvolatile chemicals, including Cl-, cAMP, and biotin, which are sensed primarily by the ASE neurons (BARGMANN and HORVITZ 1991B Down). Response to these attractants is defective in both daf-11 and daf-21 mutants (VOWELS and THOMAS 1994 Down). C. elegans is also attracted to several volatile odorants, and different chemical classes are detected by the AWA, AWB, and AWC neurons (BARGMANN et al. 1993 Down). daf-11 and daf-21 mutants do not respond to isoamyl alcohol and benzaldehyde, which are sensed by the AWC neurons, but respond normally to odorants sensed by the AWA neurons (VOWELS and THOMAS 1994 Down). These mutant phenotypes suggest that both daf-11 and daf-21 mutants have functional deficits in two classes of sensory neurons, ASE and AWC.

The external environment also regulates formation of the C. elegans dauer larva, an alternative third-stage larva specialized for survival under harsh conditions (CASSADA and RUSSELL 1975 Down). A constitutively secreted pheromone is the main inducer of dauer formation (GOLDEN and RIDDLE 1982 Down, GOLDEN and RIDDLE 1984A Down). Temperature and food modulate the effect of this pheromone, with high temperature and low food levels favoring dauer formation (GOLDEN and RIDDLE 1984A Down, GOLDEN and RIDDLE 1984B Down). daf-11 and daf-21 mutants are Daf-c (dauer formation constitutive), forming dauers even in the absence of inducing conditions (RIDDLE et al. 1981 Down; THOMAS et al. 1993 Down). In addition to daf-11 and daf-21, several other genes regulate dauer formation, and most of these genes have been ordered into a genetic pathway by analysis of double mutants (reviewed in RIDDLE and ALBERT 1997 Down). The Daf-c genes daf-1, -4, -7, -8, and -14 are thought to act in parallel to daf-11 and -21 (THOMAS et al. 1993 Down) and encode components of a TGF-ß-like signaling pathway (GEORGI et al. 1990 Down; ESTEVEZ et al. 1993 Down; REN et al. 1996 Down; INOUE and THOMAS 2000 Down; A. ESTEVEZ and D. L. RIDDLE, personal communication). The Daf-c genes daf-2 and age-1 are thought to act in parallel to or downstream of daf-11 and -21 (THOMAS et al. 1993 Down; GOTTLIEB and RUVKUN 1994 Down) and encode components of an insulin-like signaling pathway (KIMURA et al. 1994 Down; MORRIS et al. 1996 Down). It is notable that analyses of pleiotropic mutant phenotypes and double mutant interactions have all identified shared properties of daf-11 and daf-21 mutants that are distinct from other Daf-c mutants (reviewed in RIDDLE and ALBERT 1997 Down).

Regulation of dauer formation is also mediated by particular classes of amphid sensory neurons, and the functions of these neurons have been determined by killing specified cells with a laser microbeam. When the ADF and ASI neurons are killed together, wild-type larvae form dauers constitutively (BARGMANN and HORVITZ 1991A Down; SCHACKWITZ et al. 1996 Down), indicating that these neurons normally repress dauer formation in the absence of inducing conditions. Varied evidence suggests that ADF and ASI mediate the function of the TGF-ß-like signaling branch of the dauer pathway (BARGMANN and HORVITZ 1991A Down; THOMAS et al. 1993 Down; SCHACKWITZ et al. 1996 Down). In contrast, the ASJ neurons promote dauer formation, since killing these cells suppresses dauer formation in response to pheromone (SCHACKWITZ et al. 1996 Down). Killing the ASJ neurons also suppresses the constitutive dauer formation of daf-11 and daf-21 mutants, suggesting that the Daf-c phenotype in these mutants results from activation of ASJ (SCHACKWITZ et al. 1996 Down). Other Daf-c genes that function in the TGF-ß-like signaling pathway or the insulin-like signaling pathway are distinct in that their Daf-c phenotype does not depend on the ASJ neurons. The ASJ neurons are also required for recovery from the dauer state (BARGMANN and HORVITZ 1991A Down) and daf-21 and most daf-11 dauers recover poorly (VOWELS and THOMAS 1994 Down). Mutations that disrupt the amphid sensory cilia have been used in epistasis experiments to demonstrate that the Daf-c phenotype of daf-11 and daf-21 mutants requires intact ciliated sensory endings, suggesting that DAF-11 and DAF-21 function in the sensory endings to mediate an early step in chemosensory signal transduction (VOWELS and THOMAS 1992 Down).

The various shared properties of daf-11 and daf-21 mutants indicate that these genes have closely related functions in several types of sensory neurons. Here we present molecular analyses of these two genes. We show that DAF-11 is homologous to transmembrane guanylyl cyclases (TM-GCs), which catalyze the formation of cyclic GMP (cGMP) from GTP. cGMP is a widely used second messenger that regulates kinases, other nucleotide cyclases, cyclic nucleotide phosphodiesterases, and cGMP-gated ion channels (reviewed in GOY 1991 Down). We show that DAF-11 is one of a large family of TM-GCs predicted by the C. elegans Genome Sequencing Consortium, suggesting that cGMP is a common second messenger in C. elegans. Expression of a daf-11::gfp reporter fusion is consistent with the known roles of DAF-11 in ASE, AWC, and ASJ. We demonstrate that a cGMP analogue rescues the Daf-c phenotypes of daf-11 and daf-21 mutants, indicating that in both cases the mutant phenotype results from reduced levels of cGMP. We also show that daf-21 encodes heat-shock protein 90 (Hsp90), a chaperone protein that stabilizes many diverse protein targets. Our analysis indicates that the Daf-c daf-21 mutation is an unusual allele and that a null mutation is lethal. We suggest a model in which Hsp90 is required to stabilize the DAF-11/TM-GC or another signal transduction component that regulates cGMP levels.


*  MATERIALS AND METHODS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Culture, strains, and genetics:
C. elegans strain maintenance and genetic nomenclature were as described (BRENNER 1974 Down; HORVITZ et al. 1979 Down). The following strains were used: N2 (wild type), BW1435 dpy-17(e164) ncl-1(e1865) unc-36(e251); him-8(e1490); her-1(y101hv1) unc-42(e270); ctDp11, CB1364 daf-4(e1364), CB1370 daf-2(e1370), CB1372 daf-7(e1372), DR20 daf-12(m20), DR40 daf-1(m40), DR77 daf-14(m77), DR87 daf-11(m87), JT191 daf-28(sa191), JT195 daf-11(sa195), JT5436 daf-8(e1393), JT5850 dpy-11(e224) daf-21(p673), JT5996 sqt-3(sc63) daf-21(p673) unc-76(e911), JT6130 daf-21(p673), JT6412 daf-11(m84); daf-12(m20), JT6561 daf-11(sa195); daf-12(m20), JT6672 lon-3(e2175) daf-21(p673), JT6857 dpy-17(e164) ncl-1(e1865) unc-36(e251); daf-21(p673); ctDp11, JT6901 dpy-17(e164) ncl-1(e1865) unc-36(e251); daf-11(sa195); ctDp11, JT6917 daf-4(e1364), JT6918 daf-7(e1372), JT6919 daf-14(m77), JT7672 tax-4(ks11), JT7673 tax-4(ks28), JT7674 tax-4(p678), JT8708 lon-3(e2175) daf-21(p673); saEx192 [pEM1; pRF4], JT8710 lon-3(e2175) daf-21(p673) V; saEx193 [pEM1; pRF4], JT7839 tax-4(ks11), JT7840 tax-4(ks28), JT7841 tax-4(p678), JT8712 lon-3(e2175) daf-21(p673); saEx194 [pEM12; pRF4], JT8776 lin-15(n765); saEx207, JT8903 lin-15(n765); saEx237, JT8904 lin-15(n765); saEx238, JT9386 daf11(sa195ts); saEx289, KK 627 itDf2/nT1 n754, LL1008 daf-21(nr2081)/nT1 n754, and MT5813 nDf42/nT1 n754.

To map daf-21(p673) genetically, we crossed him-5 males to sqt-3 daf-21 unc-76/+ + + hermaphrodites, picked non-Sqt non-Unc hermaphrodite cross-progeny, and then picked Sqt non-Unc and Unc non-Sqt recombinants in the next generation. The identification of recombinants was not biased by the daf-21 genotype due to maternal rescue of the daf-21 phenotype. We isolated strains homozygous for each recombinant chromosome and then scored the Him and Daf-c phenotypes. Of 23 Sqt non-Uncs, 15 were Him non-Daf, 6 were non-Him non-Daf, and 2 were Daf non-Him. Of 39 Unc non-Sqts, 25 were Daf non-Him, 9 were Daf Him, and 5 were Him non-Daf. These results are summarized in Fig 5A, and they indicate that daf-21 is roughly two-thirds of the way between him-5 and unc-76.



View larger version (65K):
In this window
In a new window
Download PPT slide
 
Figure 1. The DAF-11 protein and homology to transmembrane guanylyl cyclases. (A) Splicing pattern of the daf-11 mRNA, as determined by comparison of genomic DNA sequence to cDNA sequence. (B) Predicted DAF-11 protein sequence. The putative transmembrane domain is boxed, the kinase homology domain is underlined, and the guanylyl cyclase domain is underlined twice. (C) Alignment of the guanylyl cyclase domain of DAF-11 and its closest relative outside of C. elegans, the sea urchin speract receptor (accession no. p16065).



View larger version (35K):
In this window
In a new window
Download PPT slide
 
Figure 2. Effects of 8-bromo-cGMP on dauer formation. (A) Dose response curve for daf-11, daf-21, and daf-8 mutants at 25° and on the wild type with pheromone. (B) Effect on other Daf-c mutants at 25°. Data for daf-11(sa195) and daf-8(e1393) animals are the same as in A and are shown for comparison. Bars indicate standard errors of the mean.




View larger version (182K):
In this window
In a new window
Download PPT slide
 
Figure 3. Expression of daf-11::gfp fusion transgene. (A and B) Fluorescence (A) and Nomarski (B) images of an L1 animal. Arrows in A and B point to the same locations. Expression is seen in the dendrites of amphid neurons (long arrows), in an AWC cell body (short white arrow in B), and an ASJ cell body (brightest spot toward the right in A and short black arrow in B). ASI and ASK (seen in A) are out of the plane of focus. (C and D) Fluorescence (C) and Nomarski (D) images of an adult. Arrows in D point to the sites of fluorescence in C, which are sensory cilia. Expression was also in the cell body (not shown). All photographs are of strain JT9386. (E) With the full length daf-11::gfp fusion, expression was observed in all cells listed, though infrequently in AWB. The short (fifth exon) daf-11::gfp fusion was expressed only in AWB, AWC, ASI, and ASK. NA, not applicable; NT, not tested.



View larger version (38K):
In this window
In a new window
Download PPT slide
 
Figure 4. Avoidance of the volatile repellent 2-nonanone. Response of wild type, daf-11; daf-12 double mutants and the daf-12 single mutant control. The daf-12(m20) allele was used in all cases. Response is calculated as [(no. of worms in the third of the plate containing 2-nonanone) - (no. of worms in the third of the plate opposite to the 2-nonanone)]/(total no. of worms). A strong avoidance response is -1. Each data point is the average of two to four assays with >300 worms total. Bars indicate the standard deviation among assays.



View larger version (18K):
In this window
In a new window
Download PPT slide
 
Figure 5. Cloning the daf-21 gene. (A) Genetic mapping of daf-21(p673). A portion of linkage group V is shown with the relative positions of three markers for which the genes have been previously cloned (VAN DER KEYL et al. 1994 Down; BLOOM and HORVITZ 1997 Down; PENNINGTON and MENEELY, personal communication). The number of recombinants (Sqt non-Unc and Unc non-Sqt) that we identified in each interval is shown. (B) Cosmid rescue of daf-21. A region of overlapping cosmids surrounding the predicted location of daf-21 is shown (WATERSTON et al. 1997 Down). The cosmids in boldface type are shown in more detail in C. (C) Part of the overlapping region of the rescuing cosmids is shown. Arrows indicate that the cosmids extend beyond the region depicted. Although the precise left endpoint of R08A2 is unknown, it is somewhere in the dotted part of the line. M05D1 and T10E3 rescued daf-21(p673) (one and three lines, respectively) and R08A2 gave intermediate rescue (three lines). The restriction sites used to create the two subclones pEM1 (5.8 kb) and pEM12 (3.7 kb) are shown. pEM1 rescued fully (two lines) and pEM12 rescued partially (one line). (D) The predicted genes in this region are shown aligned with the genomic subclones above in C. Arrows indicate the direction of transcription. The bold segments represent exons and the thinner lines represent introns. The arrow points to the location of the p673 mutation.

To test the nature of the daf-21(p673) mutation, we used deficiencies that delete the daf-21 gene. Wild-type males were crossed to heterozygous hermaphrodites carrying chromosome V deficiencies balanced by the nT1 n754 translocation. The dominant Unc phenotype of n754 was used to infer the genotype of the progeny. Non-Unc males (Df/+) were crossed to dpy-11 daf-21(p673) hermaphrodites and the progeny were raised and scored at 20° or 25°. Individuals were picked and daf-21(p673)/Df strains were identified based on the segregation of dead eggs. Dpy progeny were assumed to be daf-21(p673) homozygotes, since dpy-11 is linked to daf-21. We tested three deficiencies that delete the daf-21 region: nDf42, itDf2, and yDf8. All gave similar results.

The daf-21(nr2081) deletion was constructed in trans to the nT1 n754 balancer translocation for strain maintenance. Wild-type males were crossed to daf-21(nr2081)/+ heterozygotes and male progeny were crossed to nDf42/nT1 n754 hermaphrodites. Unc progeny were picked, allowed to have progeny, and screened by PCR for daf-21(nr2081). This procedure also served to outcross daf-21(nr2081) twice. We constructed daf-21(p673)/daf-21(nr2081) heterozygotes by crossing wild-type males to daf-21(nr2081)/nT1 n754 hermaphrodites and then crossing non-Unc male progeny to daf-21(p673) hermaphrodites. Non-dauer hermaphrodite progeny were picked individually and transferred to new plates each day for 3 days and were then used for PCR assays of nr2081. Three heterozygotes were obtained and in each case the progeny at 20° were similar. A total of 16% arrested as L1 or L2 larvae, 70% formed dauers, and 14% developed as non-dauers (n = 161).

To create worms with the genotype daf-21(p673)/daf-21(p673)/+, we used ctDp11, a free duplication containing part of chromosome V (including daf-21, her-1, and unc-42) and part of chromosome III (including dpy-17, ncl-1, and unc-36). We crossed dpy-17 ncl-1 unc-36; him-8; her-1 unc-24; ctDp11 males to dpy-17 ncl-1 unc-36; daf-21(p673) hermaphrodites. We picked wild-type progeny [dpy-17 ncl-1 unc-36him-8/+; her-1 unc-42 +/+ + daf-21(p673); ctDp11] and allowed them to self-fertilize. In the next generation, we picked non-Dpy non-Unc dauers (dpy-17 ncl-1 unc-36; daf-21; ctDp11) and then chose strains that segregated no males [him-8(+)]. To assay the Daf-c phenotype at 20°, we let parents carrying the duplication (p673/p673/+) lay eggs overnight and scored the progeny after 3 days. We found 7.2% of the progeny formed dauers (n = 568), in contrast to progeny of daf-21(p673)/+ mothers, which never form dauers.

PCR, DNA sequencing, and DNA oligonucleotides:
Sequencing was performed by the ABI dye terminator cycle sequencing method (Perkin-Elmer, Norwalk, CT) using either AmpliTaq DNA polymerase or AmpliTaq DNA polymerase FS. The PCR products were analyzed by the University of Washington Biochemistry and Pharmacology DNA Sequencing Facilities and by Axys Pharmaceuticals. PCR and sequencing primers were obtained from various sources, and sequences of all listed primers are available on request.

Molecular identification of daf-11:
daf-11(m597) was isolated by P. Albert and D. Riddle from a strain with active transposition of Tc1. Southern blots of genomic DNA from outcrossed m597 strains were probed with Tc1 DNA, and a 0.38-kb NdeI fragment was found to contain a 1.6-kb Tc1 insertion that cosegregated with m597 in recombinants. Genomic DNA from daf-11(m597) was digested with NdeI and used for nested inverse PCR with TC1 primers, and the products were ligated at low concentration to encourage intramolecular ligation. The PCR primers for the first round were oriented outward from the ends of Tc1 (OLG34 and OLG35). The primer for the second round (OLG23) is derived from the inverted repeat sequence at the ends of Tc1 and also oriented outward. The resulting PCR product was cloned into pBluescript II KS+ (Stratagene, La Jolla, CA) that had been digested with EcoRI and treated with Klenow to generate blunt ends to create plasmid pTJ277. We verified that pTJ277 contained DNA flanking the m597 Tc1 by using it as probe on Southern blots of genomic DNA from m597, from four phenotypic revertants of daf-11(m597), and from genetic recombinants that retained m597 but removed most of the rest of the Tc1-mutagenized chromosome V. In each case, polymorphisms were detected consistent with a Tc1 insertion only in the daf-11(m597) strains.

Determination of the daf-11 cDNA sequence:
pTJ277 was used as a probe to isolate genomic and cDNA phage. Five phages with overlapping genomic inserts were isolated at a frequency of 1.8 x 10-4 from the Stratagene {lambda} FIXII genomic library. Sequence analysis was performed on subclones from one of these phages to determine part of the daf-11 genomic sequence. This sequence was also compared to that generated by the C. ELEGANS SEQUENCING CONSORTIUM (1998), which sequenced the region containing daf-11 during the course of this work. daf-11 corresponds to the predicted gene B0240.3. From ~106 plaques from one cDNA library (A. FIRE, personal communication) and 3 x 105 plaques from another (BARSTEAD and WATERSTON 1989 Down), one daf-11 clone was recovered. This cDNA insert was subcloned into pBluescript II using the KpnI and SacI sites in the flanking phage DNA to create plasmid pTJ342, which was sequenced. Since this cDNA appeared incomplete on both ends, an additional 9 x 105 plaques from a mixed-stage C. elegans cDNA library (Stratagene) were probed with a 2.4-kb ClaI-HindIII genomic fragment containing most of the cyclase domain. One daf-11 cDNA clone was recovered, and its insert was excised into pBluescript II using helper phage K07, to generate plasmid pTJ584. On the basis of the presence of a poly(A) tail, pTJ584 appears complete at the 3' end, and it was sequenced to determine the 3' untranslated region (UTR) and exon boundaries at the 3' end of the gene. daf-11 mRNA sequence at the 5' end was determined from reverse transcriptase-PCR (RT-PCR) products generated with the GIBCO-BRL (Gaithersburg, MD) 5' RACE system (FROHMAN et al. 1988 Down). Mixed-stage RNA for the RT-PCR procedure was isolated either by the method of D. PILGRIM (personal communication) or essentially by the method of MILLER et al. 1988 Down. The 5' end was isolated in two pieces, one with primers from the coding region and the most 5' segment with a gene-specific primer and a primer to the C. elegans splice leader SL1. Sequencing of bulk RT-PCR product was performed on exons 1, 8, 9, 10, and parts of 2, 7, and 11. This sequence showed no evidence of a mixed population of cDNA. cDNA sequence from the rest of the gene was based on only one cDNA for each section, so alternative splicing cannot be ruled out for these regions.

Determination of daf-21 cDNA sequence:
The 5.8-kb BamHI insert in pEM1 was used as a probe to isolate cDNA phage from a mixed-stage C. elegans cDNA library (Stratagene). Approximately 3% of plaques hybridized to this probe that contains C47E8.4 and daf-21/Hsp90. The inserts for 12 positive plaques were excised into pBluescript II using helper phage K07. On the basis of restriction digest with EcoRI, we found that 11 of the 12 were clearly related. We sequenced the longest, pEM29, with gene-specific primers designed on the basis of the Genefinder (P. GREEN, personal communication) prediction for the Hsp90 coding sequence. This analysis confirmed all of the intron-exon splicing predictions and revealed a 3' untranslated region of at least 117 bp. Our analysis of 12 publicly available 3' expressed sequence tags showed that the five most extensive sequences end at the same point as pEM29, suggesting this is the true 3' end of the mRNA. We did not find evidence of a poly(A) tail. The 5' end of pEM29 is exactly at the predicted ATG start codon. To determine the true 5' end of daf-21, we used the GIBCO-BRL 5' RACE system for RT-PCR (FROHMAN et al. 1988 Down). Mixed-stage RNA was isolated as above. A daf-21-specific primer (OLG 344) was used for first strand cDNA synthesis, and the 5' end was amplified with a second daf21-specific primer (OLG367) and an SL1-specific primer (OLG193). Sequencing of the RT-PCR product showed a 5' untranslated leader of 4 bp between the SL1 spliced leader and the daf-21 ATG.

Sequence of daf-11 and daf-21 mutations:
DNA was amplified by PCR from total genomic DNA (WOOD 1988 Down) or from lysed worms, and bulk PCR products were sequenced. Mutations were sequenced on both strands with gene-specific primers. For daf-11(m87), daf-11(p169), and daf-11(sa203) only the coding region of the cyclase domain was sequenced. For daf-11(sa195), all coding sequence upstream of the nonsense mutation was sequenced, and for daf-11(m84) the entire coding sequence was determined. For daf-21(p673) the genomic sequence spanning the entire coding region was sequenced. For daf-21(nr2081), only the region immediately adjacent to the deletion was sequenced.

Modification of Genefinder predictions of gcy genes:
We analyzed the Genefinder predictions for gcy-1 to gcy-18, all of the TM-GC genes fully sequenced at the time. The GCY-1 through GCY-18 proteins and a selected set of previously reported TM-GCs were subjected to an initial multiple alignment with CLUSTALW 1.4. We manually inspected the resulting alignments for regions in which specific Genefinder-predicted proteins appeared to have deletions of conserved sequence or insertions of unconserved sequence in a conserved region. Typically, these stood out dramatically in a multiple alignment, and all but one occurred precisely at Genefinder-predicted exon-intron boundaries. In these cases, we manually scanned genomic sequence for splice sites that would produce clearly improved alignments. In four cases, such an alternative splice was found. F23H12.6 (GCY-13) had an anomalous insertion of VSRHENP after predicted amino acid (aa) 614; use of a splice donor 21 nucleotides (nt) upstream (2215 nt from the predicted ATG, splice junction sequence AGT ^ GTGAGTC) precisely eliminated the anomaly. F23H12.6 (GCY-13) also had an anomalous deletion of 10 amino acids (following the F23H12.6 predicted sequence FFSDVVGFT); use of a splice donor 30 nt downstream (4495 nt from the predicted ATG, splice junction sequence CAG ^ GCGAGTT) added 10 amino acids (VLANKSTPLQ) that restored typical similarity to other TM-GCs. [This alteration is questionable because it requires the use of an unusual splice donor sequence. To test the validity of this change, we performed a BLASTP search of the nr GenBank data set with an 18-amino-acid sequence (VGFTVLANKSTPLQVVNL) centered on the inserted 10 amino acids. All 34 hits with P values <0.9 were TM-GCs.] ZK455.2 (GCY-9) had an anomalous insertion of VCKLRQKII after predicted aa941, which was precisely removed by using a splice donor 27 nt upstream (4742 nt from the predicted ATG, splice junction sequence CAG ^ GTTTGCC). B0024.6 (GCY-6) had an anomalous insertion of 18 amino acids (RKIF QKSTNISSSFHLFS) after predicted aa1161 that was precisely removed by creating a new 54-nt intron (starting 5798 nt from the predicted ATG, splice donor sequence AAC ^ GTAAAAT and splice acceptor sequence GTTTCAG ^ CTG). While this approach to amending Genefinder predictions is not rigorous and may have ignored some errors, we think it highly likely that the revised protein predictions more closely approximate the true structures. As a partial test of validity we performed TBLASTN searches (default parameters), using as the query the protein most closely related to the gene under analysis. This permits detection of conserved protein coding regions in a manner independent of Genefinder predictions. In each case, the TBLASTN match to the target gene verified our exon assignment.

The gcy names for TM-GCs correspond to cosmid names from the C. elegans Sequencing Consortium as follows (see also YU et al. 1997 Down): daf-11 = B0240.3; gcy-1 = AH6.1; gcy-2 = R134.2; gcy-3 = R134.1; gcy-4 = ZK970.5; gcy-5 = ZK970.6; gcy-6 = B0024.6; gcy-7 = F52E1.4; gcy-8 = C49H3.2; gcy-9 = ZK455.2; gcy-10 = odr-1 = R01E6.1; gcy-11 = C30G4.3 (missing TM domain; see text); gcy-12 = F08B1.2; gcy-13 = F23H12.6; gcy-14 = ZC412.2; gcy-15 = ZC239.7; gcy-16 = F27H7.c; gcy-17 = W03-F11.2; gcy-18 = ZK896.8; gcy-19 = C17F4.6; gcy-20 = F21H7.9; gcy-21 = F22E5.3; gcy-22 = T03D8.5; gcy-23 = T26C12.4; gcy-24 = W03F11.2; gcy-25:Y105C5B.a; gcy-26 = ZK896.8; gcy-27 = C06A12.4. For completeness, we also assigned names to the seven predicted soluble guanylyl cyclases as follows: gcy-31 = T07D1.1; gcy-32 = C06B3.8; gcy-33 = F57F5.2; gcy-34 = M04G-12.3; gcy-35 = T04D3.4; gcy-36 = C46E1.2; gcy-37 = C54E4.3.

8-Bromo-cGMP assays:
Plates (2 cm) were filled with 2 ml NGM agar (WOOD 1988 Down) with 8-bromo-cGMP (Sigma, St. Louis) added to a given concentration from a freshly made 250 mM stock. The next day, a fresh overnight stock of Escherichia coli OP50 in Luria broth (LB) was harvested and resuspended at 5% (w/v) in sterile H2O. Twenty microliters of this bacteria was spotted onto each plate and allowed to dry for a few hours. Eight to 20 gravid hermaphrodites were picked on and allowed to lay eggs at room temperature for up to 3 hr and then removed. These plates, generally containing 50–120 eggs, were placed in a sealed box at 25°. Since 8-bromo-cGMP reduced growth synchrony, plates grown at 25° were scored at various times, generally several times for each plate, between 36 and 52 hr after egg laying. Since 8-bromo-cGMP induced dauer recovery in daf-11(sa195) dauers (data not shown), one set of experiments was scored particularly frequently to be certain that the drug blocks dauer formation rather than inducing rapid recovery. In all experiments, obvious dauers, L3s, or older animals were removed at each inspection and counted; the remaining L1 and L2 animals were left to continue growth. At the end of 52 hr, animals that were still L1s or L2s were scored as arrested. The frequency of dauer formation was based only on the dauers, L3s, and older animals and was averaged across all similar assay plates. For most data points, more than 100 worms were counted and assays were performed on at least 2 different days. The following were exceptions: one daf-8 intermediate concentration and daf-11(m87) 1.25 mM assays (done only 1 day each) and daf-8 2.5 mM assay (45 worms). 8-Bromo-cAMP (Sigma) assays were done in the same manner.

In several 8-bromo-cGMP assays, many animals arrested as L1 or L2 larvae or formed larvae with only some characteristics of dauers. We interpret this to mean that 8-bromo-cGMP can affect non-dauer development as well as execution of the dauer developmental program. These animals generally constituted <25% of the total, and they were excluded from the data presented. The following were exceptions to this low frequency: daf-11(m87) 0.6 mM 8-bromo-cGMP (34% not counted); daf-11(sa195) 1.25 and 2.5 mM 8-bromo-cGMP (about 40% not counted); daf-21(p673) 1.25, 2.5, and 5 mM 8-bromo-cGMP (about 50% not counted); daf-4(e1364) 5 mM 8-bromo-cGMP (42% not counted); daf-8(e1393) 2.5 and 5 mM 8-bromo-cGMP (about 50% not counted); daf-2(e1370) 5 mM 8-bromo-cGMP (62% not counted); tax-4(ks11) 5 mM 8-bromo-cGMP (67% not counted); tax-4(p678) 5 mM 8-bromo-cGMP (43% not counted). Conclusions based on these data were essentially unchanged if the partial-dauer animals were counted as dauers.

Construction of daf-11::gfp fusions:
The 4.2 kb upstream of daf-11 plus the entire genomic coding region was cloned in two pieces from PCR products generated from the daf-11-containing cosmid W04E7. Taq polymerase was mixed 100:1 with Pfu polymerase to reduce the mutation rate (after BARNES 1994 Down). Primers were designed with restriction enzyme sites to facilitate cloning. OLG376 (XmaI site added) and OLG378 (XhoI site added) were used to amplify the 5' part and OLG377 (XmaI site added) and OLG363 (BamHI site added) were used to amplify the 3' part. OLG376 and OLG377 each changed two nucleotides in intron 6 to produce the XmaI site used in cloning. Sequential cloning of these two PCR products joined them at the shared XmaI site to reconstruct the daf-11 genomic structure. This fragment was subcloned into the SalI and BamHI sites of pPD95.70 to make pTJ642, an in-frame fusion of a nuclear localization signal and green fluorescent protein (GFP) to the DAF-11 C terminus, and into pPD95.79 to generate pTJ643, a similar fusion without a nuclear localization sequence (NLS). A shorter translational daf-11::gfp fusion was generated by cloning a single PCR product (primers OLG311 and OLG310) into the NsiI and BamHI sites of pPD95.67 to create pTJ536. A. FIRE, S. XU, J. AHNN and G. SEYDOUX (personal communication) provided all of the fusion vectors.

Construction of daf-21 subclones:
We constructed subclones of T10E3, a daf-21 rescuing cosmid, by digesting it with either BamHI, PstI, or StuI and shotgun cloning fragments into pBluescript SK+ (Stratagene). One fully rescuing subclone (pEM1) was recovered, which contained a 5.8-kb BamHI fragment. pEM1 was digested with XmaI and a 3.7-kb fragment (shown in Fig 5) extending from the insert XmaI site to the vector XmaI site was subcloned into pBluescript SK+ to create pEM12.

Construction and analysis of transgenic worms:
daf-11 transgenics were generated by injection (MELLO et al. 1991 Down) of lin-15(n765) animals, using a lin-15 rescuing plasmid (pbLH98 at 60 ng/µl) as a transformation marker (HUANG et al. 1994 Down). The concentrations of key experimental DNAs were: full-length daf-11::gfp fusion (pTJ643) at 200 ng/µl, and daf-11 (exon 5)::gfp fusion (pTJ536) at 50 ng/µl. We also analyzed a full-length daf-11::nls-gfp fusion (pTJ642), injected at 200 ng/µl, which gave nuclear-localized patterns that were otherwise similar to the non-NLS fusion. For pTJ643, injected daf-11(sa195); lin-15(n765) animals were grown at 20° for 1 day and then transferred to 25° and screened for non-Muv (lin-15-rescued) or non-Daf (daf-11-rescued) progeny. For Fig 3E, GFP expression was analyzed in two independent lines containing the full-length, NLS construct [JT8903 lin-15 (n765); saEx237 and JT8904 lin-15(n765); saEx238]. Animals were grown at 25° to enable identification of transgenic animals. GFP expression was observed using epifluorescence microscopy and fluorescent cells were identified by Nomarski microscopy on the same animal. Photographs were taken on Kodak Elite II slide film (ISO 400) and were digitally formatted. Adobe Photoshop was used to adjust brightness and contrast, add annotation, and convert color to gray scale.

For analysis of pheromone effects on GFP expression in daf-11 mutants, lin-15(n765); saEx238 or daf-11(sa195); saEx289 animals were grown on 50–80 µl of pheromone at 25° as described (THOMAS et al. 1993 Down), conditions sufficient to induce over 90% dauer formation in the wild type. GFP expression in L1 larvae was observed 1 day after eggs were laid, and dauers were counted and assayed for GFP expression 2 days after eggs were laid.

daf-21 transgenics were generated similarly except that the dominant rol-6(su1006dm) marker (pRF4, 200 ng/µl) was used as the marker. daf-21(p673) mutants have few progeny and injections in this background yielded few transformants, so we injected into the wild type with cosmids (5 ng/µl, individually or in pools) or plasmid subclones (15 or 20 ng/µl). We then crossed the heritable transgenic arrays into a daf-21(p673) background. We used a linked, visible marker to follow daf-21 in crosses because maternal rescue prohibited scoring the Daf-c phenotype in the progeny of daf-21/+ mothers. lon-3 daf-21/++ males were crossed to transgenic Rol hermaphrodites (saEx*), and Rol cross-progeny were allowed to self-fertilize. From plates that segregated Lons, we identified strains of the genotype lon-3 daf-21; saEx*. We found that the Lon phenotype is best scored in adults, when it largely suppresses the Rol phenotype. Therefore, in these strains there are Rol larvae, and most of the adults are Lon non-Rol. In all cases, some dauers segregated indicating that daf-21(p673) must be homozygous. To assay rescue, we determined the frequency of dauer formation in synchronous larval populations grown uncrowded at 25°. Strains with full rescue had only 10–30% dauers, strains with partial rescue had 40–50% dauers, and strains with no rescue had >80% dauers.

Rescue of dauer formation and dauer recovery by saEx289:
Plates were prepared and assayed as for 8-bromo-cGMP assays (above), except that 80 µl of M9, pheromone solution, or a mixture (0, 10, or 20 units of pheromone) were added. Eggs were laid at room temperature for 3 hr and then plates were shifted to 25°. Dauers and L3 or older animals were counted and all L3 or older animals were removed once or twice per day starting at 48 hr. At 96 hr the number of dauers remaining on the plate was counted. The percentage of dauer formation was calculated as 100 x (no. of dauers)/(total no. of worms) at 48 hr, and the percentage of recovery was calculated as 100 x (total no. of recovered animals)/(total no. of recovered animals + dauers left on plate at 96 hr). Dauers that crawled up the side of the plate were not counted, as they did not have a chance to recover. Each data point was repeated on at least 2 days and on four to nine plates.

Chemotaxis assays:
Assays of chemotaxis to NaCl were performed as described (BARGMANN and HORVITZ 1991B Down) except that worms were allowed to swim for 15–30 min on a chemotaxis plate without attractant between the last wash and the assay. This step allowed the worms to better acclimate to the assay conditions and led to more reproducible results (C. BARGMANN, personal communication). Volatile avoidance assays with 2-nonanone were performed as described (TROEMEL et al. 1997 Down) except that worms were washed three times with S basal and once with water. Worms were grown and assays were performed at 20°. Because a large fraction of daf-11 mutant animals form dauers at 20°, daf-12 double mutants were assayed, with a daf-12 single mutant as control (as in VOWELS and THOMAS 1994 Down).

Mosaic analysis:
Four gravid adults of genotype dpy-17(e164) ncl-1(e1865) unc-36(e251); daf-11(sa195); ctDp11 were placed on a plate at 25°. Three days later, non-Unc dauer mosaics were identified either visually or (in most cases) by flooding the plate with 1% SDS and picking animals that were alive and thrashed (1% SDS kills non-dauers and Unc dauers did not thrash). Mosaics were inspected by Nomarski microscopy, and cells were assayed for the presence or absence of the duplication by observing the Ncl (enlarged nucleolus) phenotype of several amphid cells. It was sometimes not possible to unambiguously identify all amphid neurons in each animal. In most cases, ASI, ADL, ASK, ASE, ASH, AWC, AUA, and ASJ neurons on each side were analyzed, and often several other cells were also analyzed.

Identification of the daf-21(nr2081) deletion mutation:
A library of mutagenized worms was screened by PCR with nested primers (LIU et al. 1999 Down) to identify a daf-21 deletion called nr2081. The primers were C47E8.5 F1 (5' ATTCGTAATTCCGACCCTGC), C47E8.5 R1 (5' TTCTGTAGATGCGGGAAGCG), C47E8.5 F2 (5' TGCCAAATGAATCAAGCGGC), and C47E8.5 R2 (5' AAGCGTGAGATTGTGGCTCCTC) and resulted in a 2844-bp band in wild type. A mutant with a smaller band was identified, and sequencing of the mutant band showed an 860-bp deletion plus a 3-bp insertion. This mutation is predicted to remove amino acids 32–287 and to add 94 novel amino acids from another reading frame. To follow nr2081 in crosses, we used three primers, two that span the deletion and one within the deletion. Together these primers resulted in diagnostic bands for the mutant and wild type that could be scored simultaneously in heterozygotes.


*  RESULTS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

daf-11 encodes a transmembrane guanylyl cyclase:
We cloned daf-11 using m597, a transposon-tagged allele isolated from a strain with active Tc1 transposition (kindly provided by P. Albert and D. Riddle). Southern blot analysis revealed a Tc1 insertion present in strains containing m597 and absent in recombinants and revertants not containing m597 (data not shown). We cloned genomic DNA flanking this Tc1 insertion by inverse PCR and used the flanking DNA to isolate phages from cDNA and genomic DNA libraries. The two daf-11 cDNAs isolated were both incomplete, but together permitted determination of the last 3 kb of the poly(A)-terminated daf-11 mRNA. We completed sequence at the 5' end of the mRNA from RT-PCR products. We also determined genomic sequence for most of the gene from subclones of genomic phage. The Genome Sequence Consortium completed the sequence of this region during the course of our work. Comparison of the genomic sequence to the cDNA sequence indicated that the daf-11 mRNA contains 17 exons and spans almost 8 kb of genomic DNA (Fig 1A). The mRNA contains one long open reading frame predicted to encode a 1077-amino-acid protein that is a member of the TM-GC family (Fig 1B and Fig C).

Transmembrane guanylyl cyclases catalyze the production of cyclic GMP from GTP and have been identified in animals from C. elegans to humans (reviewed in YUEN and GARBERS 1992 Down; DREWETT and GARBERS 1994 Down). They function in various signal transduction systems including a chemotaxis response in sea urchin sperm, regulation of blood pressure by natriuretic peptides, and visual signaling in mammals. TM-GCs consist of an N-terminal extracellular domain, a single transmembrane domain, and an intracellular region. The intracellular region contains a domain with homology to protein kinases (KHD, kinase homology domain) and a C-terminal GC domain that catalyzes the conversion of GTP to cGMP. The KHD lacks key residues required for kinase catalytic activity (YUEN and GARBERS 1992 Down). The DAF-11 protein contains each of these characteristic domains (Fig 1B). As is true of most TM-GCs, strong DAF-11 homology to other guanylyl cyclases is restricted to the KHD and cyclase domains. An alignment of the cyclase domain of DAF-11 and its closest relative outside of C. elegans, the sea urchin speract receptor, is shown in Fig 1C. The speract receptor and DAF-11 share 22% identity and 47% similarity in the KHD and 43% identity and 64% similarity in the cyclase domain.

We used BLAST searches (ALTSCHUL et al. 1990 Down) to identify other guanylyl cyclase-related genes in the nearly complete C. elegans genome sequence (C. ELEGANS SEQUENCING CONSORTIUM 1998 Down). As of 10/99, these searches had identified a total of 28 C. elegans genes that are clearly related to TM-GCs. The 27 TM-GC genes other than daf-11 were named gcy-1 through gcy-27 (similar to guanylyl cyclase). Corresponding names from the C. elegans Genome Project are described in MATERIALS AND METHODS and by YU et al. 1997 Down. On the basis of our analysis of daf-11 and the fact that GFP fusions to several other gcy promoters are expressed in chemosensory neurons (YU et al. 1997 Down), it seems likely that most of the C. elegans TM-GCs are involved in chemosensory signal transduction processes.

Seven other genes were identified with higher similarity to soluble guanylyl cyclases (not shown). Since over 95% of all C. elegans genes are included in this analysis (J. SULSTON and R. WATERSTON, personal communication), these observations suggest that all C. elegans guanylyl cyclases fall into one of these two previously defined families. Distinguishing between the TM and soluble GCs was straightforward based both on degree of identity in the cyclase domain and other structural features of each class of proteins.

Sequence changes in daf-11 mutants:
daf-11 alleles vary in their phenotypic effects (THOMAS et al. 1993 Down; VOWELS and THOMAS 1994 Down). To determine the specific effects of daf-11 mutations on protein function, we sequenced PCR products generated from mutant genomic DNA. Identified mutations are indicated in Fig 1B. Of the known daf-11 mutations, three of the sequenced alleles (m597, sa195, and m87) confer the strongest defects, consistent with a strong loss-of-function or null phenotype: a strong Daf-c phenotype at 25° but not at 15°, chemotaxis defects to nonvolatile and some volatile attractants, and severely defective dauer recovery at all temperatures (VOWELS and THOMAS 1994 Down). sa195 is a nonsense mutation at Q450, which is predicted to truncate DAF-11 before the KHD and the cyclase domains; it is the best candidate for a daf-11 molecular null allele. m597 results from a Tc1 insertion in the KHD, in the codon I518. m87 is a missense mutation in the cyclase domain that changes S866 to F in a highly conserved region (Fig 1B and Fig C). A fourth allele, p169, has a missense mutation that changes the highly conserved G867 to R in the cyclase domain. The dauer phenotypes of the p169 mutant are consistent with a strong loss-of-function allele (strong Daf-c at 25°, weak Daf-c at 15°, poor dauer recovery), but other phenotypes have not been tested.

Two other daf-11 alleles confer unusual phenotypes. The daf-11(sa203) mutant was strongly Daf-c at 25°, but also formed 88% dauers at 15° (N = 234). sa203 has a nonsense mutation at Q904, just at the end of the conserved residues of the cyclase domain (Fig 1B and Fig C). We speculate that the sa203 mRNA expresses a truncated protein product that interferes with the function of another protein. Alternatively, a second undetected mutation may be responsible for the unusual phenotype. The daf-11(m84) mutant is also unusual: it is very strongly Daf-c at both 15° and 25°, the dauers recover much more quickly and efficiently than do other daf-11 mutants, and m84 adults have only weak defects in response to the volatile attractant isoamyl alcohol (VOWELS and THOMAS 1994 Down). For each of these phenotypes, the unusual daf-11(m84) phenotypes are still seen when in trans to the strong alleles m87 and sa195. m84 is slightly dominant to the wild-type allele for its dauer formation phenotype (VOWELS and THOMAS 1994 Down). These data suggest that the m84 mutation affects only some of the functions of DAF-11, and that it may encode a protein that interferes with the function of other proteins. daf-11(m84) causes a G806 to E change, affecting an unconserved residue in a relatively conserved part of the cyclase domain (Fig 1B and Fig C).

cGMP signaling is perturbed in daf-11 and daf-21 mutants:
To test the biological relevance of the DAF-11 sequence homology to TM-GCs and to test directly for a role for cGMP in chemosensation, we assayed the effect on dauer formation of the membrane permeant cGMP analogue 8-bromo-cGMP (Fig 2A). If the daf-11 mutant phenotype is due to a loss of guanylyl cyclase activity, supplementing with 8-bromo-cGMP might suppress the Daf-c phenotype. When grown at 25° with plentiful food without 8-bromo-cGMP, over 95% of daf-11(sa195) and daf-11(m87) animals formed dauers. In contrast, when 5 mM 8-bromo-cGMP was added to the growth medium, <1% formed dauers. Intermediate concentrations of the drug caused intermediate suppression of the Daf-c phenotype. 8-Bromo-cGMP similarly suppressed pheromone-induced dauer formation in the wild type in a dose-dependent manner, directly implicating cGMP in normal dauer formation.

We hypothesized that 8-bromo-cGMP suppressed dauer formation daf-11 mutants by substituting for the cGMP normally synthesized by the DAF-11 protein. This hypothesis predicts that 8-bromo-cGMP would not suppress mutations in genes that act downstream of or in parallel to daf-11. As predicted, we found that 8-bromo-cGMP did not prevent constitutive dauer formation in mutants for daf-1, daf-4, daf-7, daf-8, daf-14, daf-2, or daf-28 (Fig 2B). On the basis of gene interactions, it is thought that all of these genes act downstream of or in parallel to daf-1 (RIDDLE et al. 1981 Down; THOMAS et al. 1993 Down; GOTTLIEB and RUVKUN 1994 Down; MALONE et al. 1996 Down). In contrast, 8-bromo-cGMP fully suppressed the Daf-c phenotype of daf-21(p673) (Fig 2A, and see below). To test whether this suppression is specific to cGMP, we tested the response of daf-11, daf-21, daf-1, daf-4, daf-7, daf-14, daf-2, and daf-28 mutants to 8-bromo-cAMP. At 5 mM, 8-bromo-cAMP caused developmental arrest in the wild type, but 0.5 mM 8-bromo-cAMP allowed normal growth and had no effect on dauer formation in any of the Daf-c strains (data not shown). These results implicate cGMP in dauer formation and provide direct evidence that DAF-11 functions in vivo as a guanylyl cyclase.

daf-11 expression in sensory neurons controlling dauer formation and dauer recovery:
To identify cells in which daf-11 is expressed, we constructed a fusion gene containing 4.2 kb upstream of daf-11 and the entire genomic coding region with GFP (CHALFIE et al. 1994 Down) fused at the C terminus. A transgenic array containing this construct (saEx289) rescued the Daf-c phenotype of daf-11(sa195) animals (Fig 3E). All GFP-expressing cells were amphid neurons, as identified by comparison to the known positions and processes of all neurons (WHITE et al. 1986 Down). GFP expression was visible in the ciliated sensory endings, as expected, as well as in the cell bodies and dendrites (Fig 3). In some adults, expression was seen only in the ciliated endings (Fig 3C and Fig D) and the cell bodies (not shown), indicating that within the dendritic compartment the protein is preferentially localized to the ciliated endings. The expression pattern we observed was generally consistent with phenotypic evidence for daf-11 function in specific sensory pathways, as discussed below and summarized in Fig 3E.

The GFP fusion protein was reproducibly expressed in the amphid neuron classes ASJ and ASI, both implicated in regulating dauer formation. Constitutive dauer formation in daf-11 mutants is dependent on the function of the ASJ neurons (SCHACKWITZ et al. 1996 Down), and expression of daf-11::gfp in ASJ neurons supports a model in which the DAF-11 guanylyl cyclase acts in ASJ to regulate dauer pheromone response. A simple possibility is that cGMP produced by DAF-11 inhibits the dauer-promoting activity of ASJ neurons, thus preventing dauer formation, and that dauer pheromone or daf-11 mutations reduce the cGMP level, activating the ASJ neurons and inducing dauer formation.

In contrast to the ASJ neurons, the ASI neurons function together with another neuron class, ADF, to repress dauer formation in the absence of dauer-inducing conditions (BARGMANN and HORVITZ 1991A Down; SCHACKWITZ et al. 1996 Down). Various results suggest that ASI neurons repress dauer formation by secreting DAF-7, a TGF-ß related protein (BARGMANN and HORVITZ 1991A Down; THOMAS et al. 1993 Down; REN et al. 1996 Down; SCHACKWITZ et al. 1996 Down). Expression of daf-11::gfp in ASI was unexpected, since genetic evidence supports a daf-11 function that acts in parallel to daf-7 (THOMAS et al. 1993 Down; SCHACKWITZ et al. 1996 Down). Several explanations might reconcile these findings. First, one of the many other TM-GCs that have been identified in C. elegans (above; YU et al. 1997 Down) may function in ASI neurons redundantly with the DAF-11 TM-GC, thus masking a role for daf-11 in ASI neurons. Second, it is possible that daf-11 function in ASI neurons is unrelated to dauer formation. Third, expression of daf-11::gfp in ASI could be an artifact of our assay: an unexpectedly large fraction of gfp fusions to neuronally expressed genes show expression in ASI neurons (TROEMEL et al. 1995 Down; D. A. BIRNBY, E. M. LINK, J. J. VOWELS, H. TIAN, P. L. COLACURCIO and J. H. THOMAS, unpublished data). As an independent approach to testing daf-11 function in dauer formation, we undertook mosaic analysis of daf-11(sa195). Unfortunately, analysis of several putative mosaics from over 250,000 animals screened (see MATERIALS AND METHODS) led to only two conclusions. First, daf-11(sa195) is very slightly dominant in the strain used for mosaic analysis, complicating interpretation of mosaic losses. Second, loss of daf-11 in any of several amphid neurons (including the ASJ class) slightly increased the likelihood of dauer formation, with no clear pattern of critical cells (data not shown). Taken together with previous studies (SCHACKWITZ et al. 1996 Down), these results suggest that daf-11 function in preventing dauer formation may be primarily in ASJ neurons, but that daf-11 also acts in other cells.

Under appropriate environmental conditions, dauers recover and resume their normal life cycle (CASSADA and RUSSELL 1975 Down). Cell-kill experiments show that ASJ is the only amphid neuron class essential for this recovery (BARGMANN and HORVITZ 1991A Down). Strong daf-11 mutants are severely defective in recovery from the dauer state (VOWELS and THOMAS 1994 Down). We hypothesized that daf-11 might function in ASJ neurons to promote dauer recovery. To test this hypothesis, we assayed expression of daf-11::gfp in dauers that were induced by dauer pheromone at 25°. Expression in ASJ of the rescuing fusion array saEx238 was analyzed in 13 dauers (26 cells). We saw definite expression in ASJ in 6 cells and expression in 12 more cells whose positions were consistent with ASJ. The arrangement of neurons in the dauer larva is somewhat different from that in the well-described L1 larva, and positive identification was not always possible. These results show that daf-11 is expressed in ASJ neurons in most or all dauers and is consistent with a function of DAF-11 in ASJ neurons to promote recovery from the dauer state.

The dauer-inducing pheromone does not affect daf-11::gfp:
Exposing animals to the dauer-inducing pheromone strongly reduces expression of daf-7::gfp fusions, suggesting that the effects of the pheromone on this TGF-ß pathway are mediated at the level of daf-7 expression (SCHACKWITZ et al. 1996 Down; REN et al. 1996 Down). In contrast, exposure to dauer pheromone had no effect on expression of a full-length daf-11::gfp fusion in any cells (data not shown), suggesting that pheromone affects this pathway at a level other than daf-11 transcription. Since 8-bromo-cGMP suppresses the Daf-c phenotype of daf-11 mutants and blocks the dauer-inducing effects of the pheromone in wild-type larvae, dauer pheromone presumably reduces cGMP levels in daf-11-expressing neurons. It is possible that pheromone directly inactivates DAF-11 guanylyl cyclase activity, perhaps by binding to the extracellular domain. However, given the pleiotropy of daf-11 mutations, this is an unlikely general model for daf-11 function. We favor a model in which pheromone regulates cGMP levels indirectly, by binding an unidentified receptor or receptors and initiating a transduction process that ultimately stimulates a cGMP phosphodiesterase or reduces DAF-11 guanylyl cyclase activity. A phosphodiesterase is involved in cGMP-mediated visual transduction in mammals, where it is activated by light to lower cGMP levels in rod outer segments (MIKI et al. 1975 Down).

daf-11 expression in cells regulating chemotaxis and 2-nonanone avoidance:
daf-11::gfp expression was also seen in AWC and ASK neurons (Fig 3E). The AWC class is required for chemotaxis toward the volatile attractants isoamyl alcohol and benzaldehyde. Since daf-11 mutants are defective in response to these attractants, expression in AWC neurons was predicted. There is evidence that the ASK neurons play a minor role in chemotaxis to lysine and possibly other nonvolatile attractants (BARGMANN and HORVITZ 1991B Down). The ASK class may also play a small part in promoting dauer formation in response to pheromone (SCHACKWITZ et al. 1996 Down). daf-11 may function in ASK neurons in one of these responses. Expression in AWC and ASK was variable, which may indicate lower levels of daf-11 expression in these neurons or may result from incomplete regulatory sequences in the transgene.

A shorter daf-11 fusion construct, with the same promoter region plus only the first 136 codons of daf-11 (up to the fifth exon) fused to gfp, was expressed consistently in the AWC and AWB neurons and was expressed occasionally in the ASI and ASK neurons (Fig 3E). (Another transgenic array containing the same construct had consistent expression in ASI neurons, but the strain stopped expressing detectable GFP before quantititative data were collected.) Reinspection of strains carrying the full-length daf-11 fusion also revealed occasional expression in AWB cells. Presumably the differences in expression among fusions result from internal daf-11 regulatory sequences, but we have not further investigated this. The AWB neurons are required for avoidance of the repulsive compound 2-nonanone (TROEMEL et al. 1997 Down), prompting us to test this response in daf-11 mutants. To facilitate growth, the strains tested also contained a daf-12 mutation to prevent dauer formation, and the daf-12 single mutant was tested as a control (see MATERIALS AND METHODS). We found that both daf-11(sa195) and daf-11(m84) mutants are defective in response to either undiluted or a 10-1 dilution of 2-nonanone (Fig 4). Together these results indicate a role for daf-11 in AWB sensory transduction.

In addition to their other phenotypes, daf-11 mutants are defective in chemotaxis toward nonvolatile chemicals, a process mediated primarily by the ASE neurons. However, daf-11::gfp expression in ASE cells was only rarely seen in larvae bearing the longer fusion and was never seen (0/21 cells) in adults grown at 20° (the temperature at which chemotaxis assays are performed). This lack of expression could be because the fusion lacks regulatory sequences or because the effect of the daf-11 mutation on chemotaxis is not mediated through ASE. We found that the longer fusion could partially rescue the daf-11 chemotaxis defect (Fig 3E), supporting the idea of an ASE-independent effect of daf-11 on chemotaxis. However, daf-11::gfp expression is weak and variable in some cells and it remains possible that a low level of daf-11 expression in ASE neurons was not identified by our reporter assay.

daf-21 encodes an Hsp90:
Genetic analysis has indicated that daf-21 acts at the same step as daf-11 in the dauer formation pathway (THOMAS et al. 1993 Down), and daf-11 and daf-21(p673) mutants have nearly identical defects in sensing odorants (VOWELS and THOMAS 1994 Down). Furthermore, the suppression of the daf-21(p673) Daf-c phenotype by 8-bromo-cGMP suggests that the daf-21(p673) mutation, like daf-11 mutations, reduces cGMP levels. Therefore, we also cloned the daf-21 gene. We genetically mapped daf-21 with respect to three cloned genes (see MATERIALS AND METHODS) and used the genetic distances to infer an approximate physical position for daf-21 (Fig 5A). We used transformation rescue with cosmids and cosmid subclones to localize daf-21 to a 5.8-kb genomic fragment that fully rescues the Daf-c phenotype of daf-21(p673) (Fig 5B and Fig C). The C. ELEGANS SEQUENCING CONSORTIUM (1998) predicted two divergently transcribed genes in this interval: C47E8.4 and C47E8.5, which encodes the C. elegans heat-shock protein 90. Two lines of evidence indicate that daf-21 corresponds to the Hsp90 gene. First, a subclone (pEM12) that contains the Hsp90 coding region and about 1 kb of upstream sequences partially rescues the daf-21 Daf-c phenotype, despite lacking >70% of the C47E8.4 coding region (Fig 5C). Second, by sequencing daf-21(p673) genomic DNA, we identified a missense mutation in the Hsp90 coding region. This mutation changes E292 to K, a dramatic charge change in a highly conserved amino acid that is likely to affect protein function (Fig 5D and Fig 6).



View larger version (56K):
In this window
In a new window
Download PPT slide
 
Figure 6. The Hsp90 protein family. Selected members of the Hsp90 protein family are represented as boxes. The two shaded regions in each protein are the conserved N-terminal (left) and C-terminal (right) domains. The number of amino acids in the charged linker region between the two domains is indicated. The percent identity between pairs of proteins is shown for both the N-terminal and C-terminal domains. In the upper representation of DAF-21, the location of the E292K mutation in daf-21(p673) is shown by the black circle, and the extent of the deletion in daf-21(nr2081) is shown by the heavy line. Protein sequences were aligned using the ClustalW program in MacVector (Oxford Molecular Group).

Hsp90 proteins consist of two highly conserved domains connected by a charged linker region (reviewed in SCHEIBEL and BUCHNER 1998 Down; BUCHNER 1999 Down). Both the N-terminal and C-terminal domains contain chaperone sites (YOUNG et al. 1997 Down; SCHEIBEL et al. 1998 Down). The N-terminal domain includes an ATP-binding pocket and a cleft that is large enough to accommodate polypeptides (PRODROMOU et al. 1997A Down, PRODROMOU et al. 1997B Down; STEBBINS 1997). ATP binding is required for Hsp90 function (OBERMANN et al. 1998 Down; GRENERT et al. 1999 Down) and induces peptide dissociation from the N-terminal domain (SCHEIBEL et al. 1998 Down). The charged linker varies in length from 0 amino acids in E. coli to 50 amino acids in humans. This charged region enhances binding of the amino-terminal domain to denatured protein and mediates an effect of bound peptide on ATP affinity (SCHEIBEL et al. 1999 Down). The C-terminal domain binds promiscuously to partially folded proteins in an ATP-independent manner (SCHEIBEL et al. 1998 Down) and is required for Hsp90 dimerization (NEMOTO et al. 1995 Down; MENG et al. 1996 Down; NEMOTO and SATO 1998 Down). The C. elegans Hsp90 protein includes all of these domains (Fig 6), and the E292K change in p673 affects an early amino acid in the C-terminal domain.

In vertebrates, there are two Hsp90 cytoplasmic isoforms, {alpha} and ß. In addition there is a third cytosolic relative, Trap-1/Hsp75, that lacks the charged region (CHEN et al. 1996 Down; SONG et al. 1996 Down). A fourth Hsp90 relative called GRP94/GP96 is found in the endoplasmic reticulum. DAF-21/Hsp90 is 74 and 76% identical to human Hsp90{alpha} and Hsp90ß, respectively, and is clearly most closely related to these proteins (Fig 6). There are no other predicted C. elegans genes with this degree of similarity to Hsp90, indicating that there is a single C. elegans Hsp90 ortholog. However, there are predicted C. elegans genes orthologous to Trap-1/Hsp75 (R151.7) and GRP94/GP96 (T05E11.3; Fig 6). Hsp90 is a highly abundant protein whose expression is increased further under conditions of stress. Consistent with abundant expression, we and others have identified many daf-21/Hsp90 cDNAs (WATERSTON et al. 1992 Down; W. R. MCCOMBIE, J. M. KELLEY, L. AUBIN, M. GOSCOECHEA, M. G. FITZGERALD, A. WU, M. D. ADAMS, M. DUBNICK, A. R. KERLAVAGE, J. C. VENTER and C. A. FIELDS, personal communication; Y. KOHARA, H. MITSUKI, A. NISHIGAKI, T. MOTOHASHI, A. SUGIMOTO and H. TABARA, personal communication). Approximately 3% of clones in a mixed stage cDNA library hybridized to the pEM1 rescuing subclone. It is intriguing that previous studies showed daf-21/Hsp90 transcription is elevated in dauers (DALLEY and GOLOMB 1992 Down), though this is unlikely to explain the daf-21(p673) Daf-c phenotype. Sequencing of a cDNA and RT-PCR products confirmed the predicted intron-exon structure and showed that the mRNA is trans-spliced to the C. elegans spliced leader SL1.

daf-21(p673) is not a loss-of-function mutation:
It is known from genetic studies in yeast and Drosophila that Hsp90 is required for viability (BORKOVITCH et al. 1989; CUTFORTH and RUBIN 1994 Down; VAN DER STRATEN et al. 1997 Down). In contrast, daf-21(p673) mutants have an assortment of sensory defects and reduced fertility, but otherwise grow nicely in the laboratory. We investigated whether daf-21(p673) is a loss-of-function mutation by testing daf-21(p673) in trans to three deficiencies that delete the gene. We crossed Df/+ males to daf-21(p673) homozygous hermaphrodites. If p673 were a loss-of-function allele, we would expect that the daf-21(p673)/Df progeny would form dauers or display some more severe phenotype such as larval arrest (if p673 were a partial loss-of-function allele enhanced by the Df). However, we found that the daf-21(p673)/Df animals were perfectly viable and did not form dauers (Table 1). This result indicates that two copies of daf-21(p673) are required for the Daf-c phenotype and suggests that the Daf-c phenotype is not due to loss of daf-21 function. The deficiencies did have obvious effects on the daf-21(p673) phenotype, however. daf-21(p673) homozygotes have reduced fertility (VOWELS 1994 Down), and this phenotype was enhanced by the deficiencies such that the daf-21(p673)/Df heterozygotes are nearly sterile at 25°. In addition, although daf-21(p673)/+ animals never have dauer progeny, ~40% of daf-21(p673) homozygotes from daf-21(p673)/Df mothers form dauers at 20°. These results also confirm that the deficiencies delete the daf-21 gene, as expected from genetic map data. We conclude that daf-21(p673) is not a simple loss-of-function mutation and that dosage of the mutant allele is important in determining the phenotype.


 
View this table:
In this window
In a new window

 
Table 1. Summary of daf-21 phenotypes

To determine the null phenotype of daf-21, we obtained a deletion mutation kindly provided by Axys Pharmaceuticals, NemaPharm Group. The mutant was isolated according to the method of LIU et al. 1999 Down(see MATERIALS AND METHODS) and contained an 860-bp deletion plus a 3-bp insertion. This mutation is predicted to remove amino acids 32–287 and to add 94 novel amino acids from another reading frame. daf-21(nr2081) deletion homozygotes arrested growth at the L2 to L3 larval stages (Table 1), indicating that Hsp90 is essential in C. elegans, as it is in yeast and Drosophila (BORKOVITCH et al. 1989; CUTFORTH and RUBIN 1994 Down; VAN DER STRATEN et al. 1997 Down). To confirm that p673 and nr2081 are allelic, we examined daf-21(p673)/daf-21(nr2081) heterozygotes. We found that these animals have many (70%, n = 161) dauer progeny at 20°, indicating that these mutations fail to complement for the dauer-constitutive phenotype. Of the remaining progeny, about half arrested as L1 or L2 larvae and about half developed as non-dauers. We note that in combination with daf-21(p673), the daf-21(nr2081) deletion mutation has a stronger effect on dauer formation than any of the three large deficiencies tested, suggesting that the deficiencies delete other genes relevant to dauer formation.

Though gain-of-function mutations most often display some degree of dominance, daf-21(p673) is recessive in the sense that daf-21(p673)/+ heterozygotes never form dauers. We tested for weak dominance by using a duplication to create animals with three copies of the daf-21 locus (see MATERIALS AND METHODS). While daf-21(p673)/+ mothers made 0% dauer progeny at 25°, daf-21(p673)/daf-21(p673)/+ mothers grown in parallel made approximately 7% dauer progeny (Table 1). We conclude that two copies of the daf-21(p673) allele probably result in a stronger mutant phenotype, consistent with the model that daf-21(p673) is a weak gain-of-function mutation.


*  DISCUSSION
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

A variety of shared mutant phenotypes suggest that the C. elegans genes daf-11 and daf-21 act at the same step to regulate chemosensory transduction in several of the exposed, ciliated amphid neurons. First, mutations in both genes cause defects in chemotaxis to the nonvolatile attractants Cl-, cAMP, and biotin (VOWELS and THOMAS 1994 Down), responses controlled primarily by the ASE neurons with lesser contributions from the ADF, ASG, and ASI neurons (BARGMANN and HORVITZ 1991B Down). Second, daf-11 and daf-21 mutants are defective in response to the volatile attractants isoamyl alcohol and benzaldehyde (VOWELS and THOMAS 1994 Down), behaviors that require the AWC neurons (BARGMANN et al. 1993 Down). A third shared phenotype is constitutive dauer formation, a developmental process normally regulated by the environment (RIDDLE et al. 1981 Down; THOMAS et al. 1993 Down). This dauer-constitutive phenotype is suppressed in both daf-11 and daf-21 mutants by killing the dauer-promoting neurons ASJ, suggesting that this phenotype results from activation of the ASJ neurons (SCHACKWITZ et al. 1996 Down). In addition, mutations that disrupt the sensory cilia have been used in epistasis experiments to demonstrate that the dauer-constitutive phenotype in daf-11 and daf-21 mutants requires intact ciliated sensory endings, suggesting that these genes play a role in an early step of chemosensory signal transduction (VOWELS and THOMAS 1992 Down). Other Daf-c genes function in a TGF-ß-like signaling pathway or in an insulin-like signaling pathway, but these are distinct from daf-11 and daf-21 because their Daf-c phenotypes are not dependent on the ASJ neurons or on structurally normal sensory cilia (VOWELS and THOMAS 1992 Down; THOMAS et al. 1993 Down; GOTTLIEB and RUVKUN 1994 Down; SCHACKWITZ et al. 1996 Down).

C. elegans dauer formation provides a genetic model for TM-GC function in sensory transduction:
In addition to daf-11, several other genes are candidates for functioning in sensory transduction events controlling dauer formation. A model for this transduction process is provided by mammalian visual transduction, in which a TM-GC (RetGC) is known to function (reviewed in KOUTALOS and YAO 1993; HURLEY 1987 Down). In this pathway, the heterotrimeric G-protein transducin mediates activation of a cGMP phosphodiesterase in response to light (BAEHR et al. 1982 Down). Two G-protein {alpha} subunits, gpa-2 and gpa-3, are implicated in dauer formation. Loss-of-function mutations in these genes cause a Daf-d (dauer formation defective) phenotype, and animals carrying activated gpa-2 or gpa-3 transgenes have a Daf-c phenotype (ZWAAL et al. 1997 Down). gpa-3::lacZ is expressed in amphid neurons that regulate dauer formation, and the Daf-c phenotype of animals carrying an activated gpa-3 transgene is suppressed by defects in the ciliated endings of the amphid neurons (ZWAAL et al. 1997 Down). These findings are consistent with a role for gpa-3 analogous to that of transducin in visual transduction. However, loss of gpa-3 function weakly suppresses the Daf-c phenotype of daf-11(m47) (ZWAAL et al. 1997 Down), suggesting that gpa-3 functions either downstream of or in parallel to daf-11. Thus the relationship between these genes and daf-11 is unclear. A putative cyclic nucleotide phosphodiesterase (F26A1.14) has been identified by the C. ELEGANS SEQUENCING CONSORTIUM (1998), but it is not yet known whether this gene is involved in dauer formation.

In visual transduction, cGMP acts directly on an excitatory cyclic nucleotide gated ion channel (FESENKO et al. 1985 Down). In C. elegans, tax-4 and tax-2 have recently been shown to encode {alpha} and ß subunits of a cyclic nucleotide gated ion channel (COBURN and BARGMANN 1996 Down; KOMATSU et al. 1996 Down). A tax-4::gfp fusion is expressed in the amphid neurons ASK, ASI, ASG, ASE, AFD, AWC, and ASJ (KOMATSU et al. 1996 Down), a set that includes four of the five neurons in which daf-11::gfp fusions are expressed, and tax-4 mutants have a weak dauer-constitutive phenotype (COBURN et al. 1998 Down). If TAX-4 is a target of cGMP synthesized by DAF-11, the Daf-c phenotype of tax-4 mutants should not be suppressed by growth on 8-bromo-cGMP. As predicted, we found that 8-bromo-cGMP had no effect on dauer formation in tax-4 mutants (Fig 3B). In contrast to tax-4 mutants, tax-2 mutants do not form dauers even at 27° (data not shown), a condition that induces dauer formation more strongly than 25° (M. AILION, personal communication; MALONE et al. 1996 Down). However, tax-2 mutants are weaker than tax-4 mutants in many respects (COBURN and BARGMANN 1996 Down), so this does not rule out a role for tax-2 in dauer formation.

This genetic model system can be used to determine in vivo the functions of the three domains of the TM-GC molecule as well as the relationships among the components of a cGMP transduction pathway. Mutations already exist in many of these genes and gene disruptions could be generated in the phosphodiesterase and in other potential components discovered by sequence analysis (ZWAAL et al. 1993 Down; LIU et al. 1999 Down). These mutants could be used to analyze the functional relationships among these genes in the control of dauer formation. In addition, animals carrying daf-11 transgenes mutated in specific domains or amino acids can be generated and analyzed in a daf-11 null background. The combination of these techniques will generate a better understanding of the role of transmembrane guanylyl cyclase signaling in vivo.

The KHD of the transmembrane-guanylyl cyclase gene family:
We analyzed the sequence of 14 of the C. elegans TM-GC genes in more detail (all the genes with complete sequence at the time of the analysis). With the exception of DAF-11, all of our protein sequence analysis was done with gene products predicted by the Genefinder program (P. GREEN, personal communication), with minor amendments described in MATERIALS AND METHODS. Thirteen of the 14 analyzed TM-GCs have the standard TM-GC structure, a transmembrane domain separating a large extracellular domain from the intracellular kinase homology and cyclase domains. The one exception, GCY-11, is quite similar to other TM-GCs except that it appears to lack a predicted transmembrane domain. Since this difference might be due to a Genefinder error or gcy-11 might be a pseudogene, it was not further analyzed.

Though all previously reported TM-GCs have large extracellular domains, these domains are highly divergent from one another and in most cases a function has not been identified. Two features of the C. elegans genes nevertheless suggest that these extracellular domains consistently have important functions. First, 27 of the 28 C. elegans genes in the completed genome sequence are predicted to have a large extracellular domain of similar size. Second, a limited amount of homology is apparent in this domain between nearly all of the C. elegans TM-GCs and those of other organisms. This ranges as high as 28% identity between GCY-12 and the Drosophila DrGC-1 (MCNEIL et al. 1995 Down), but is usually restricted to a few short regions that may represent shared structural elements. We hypothesize that the sequence divergence among TM-GC extracellular domains reflects binding of divergent ligands rather than a lack of functional significance.

The sequencing of a large set of divergent TM-GCs affords important new insight into the conserved features of the kinase homology domain. An alignment of the KHD of the 13 analyzed C. elegans proteins and 5 from other organisms is shown in Fig 7, with annotations showing the blocks of conservation observed in bona fide protein kinases (HANKS et al. 1988 Down). Although the KHD is related to protein kinases, nearly all members of the TM-GC family, including the new members from C. elegans, lack key amino acid residues required for kinase catalytic activity (HANKS et al. 1988 Down; YUEN and GARBERS 1992 Down; Fig 7 legend), indicating that this domain does not have kinase activity. Importantly, the ATP-binding domain found in all kinases is clearly not conserved in the KHD of TM-GCs (Domain I, Fig 7). Previous reports that the KHDs of specific TM-GCs have weak but significant similarity to kinase ATP-binding domains (SINGH et al. 1988 Down; CHINKERS et al. 1989 Down) are not supported by our comparison of TM-GCs as a group (Fig 7). This observation potentially confounds interpretation of data that ATP affects cyclase activity (CHINKERS et al. 1991 Down; PARKINSON et al. 1994 Down). For example, ATP appears to protect the enterotoxin receptor cyclase from inactivation (VAANDRAGER et al. 1993A Down, VAANDRAGER et al. 1993B Down) and ATP potentiates the effects of the ligand ANP on GC-A (CHINKERS and GARBERS 1989 Down). On the basis of our results with DAF-21/Hsp90, we speculate that these effects are mediated by ATP-Hsp90 interactions with TM-GCs.





View larger version (285K):
In this window
In a new window
Download PPT slide
 
Figure 7. TM-GC family of C. elegans. Alignment of the KHD of 13 C. elegans TM-GCs and 5 TM-GCs from other organisms. Residues that are identical in half or more sequences are shaded black; those that are similar are shaded gray. The domains that are best conserved in protein kinases are overlined and numbered according to HANKS et al. 1988 Down. Of particular note is the clear lack of homology in the kinase ATP-binding domain (domain I) among TM-GCs or between them and kinases. Only two TM-GCs have sequences that are remotely similar to the conserved ATP-binding residues (underlined) and even these are poor matches. The kinase residues that are nearly invariant in all kinases are given above the TM-GC alignment. A domain that is conserved in TM-GCs but is not present in kinases is boxed. Large arrows show residues that are probably necessary for kinase catalysis (not conserved in KHDs).

Some conserved regions of the guanylyl cyclase KHD are not particularly conserved in true protein kinases, especially C-terminal to block III and N-terminal to block I (Fig 7). These facts suggest that the KHD diverged from true protein kinases before the divergence of known TM-GCs from one another. Despite the differences between protein kinases and the KHD of TM-GCs, there is a clear general parallel between their most conserved stretches (Fig 7). These parallels in sequence conservation indicate that the TM-GC and protein kinase groups have been subject to related selective pressure. We speculate that this conservation reflects selection for a common protein binding domain rather than enzymatic kinase activity. One possible binding partner for this domain is DAF-21/Hsp-90.

DAF-21 is Hsp90:
The previously described phenotypic similarities between daf-11 mutants and the daf-21(p673) mutant suggested that the two gene products have closely related biochemical functions. Furthermore, our new finding that a cGMP analogue rescues both daf-11 and daf-21 mutants strengthens this hypothesis. On the basis of the fact that daf-11 encodes a TM-GC, we speculated that the DAF-21 protein might also regulate cGMP levels. Detailed knowledge of the role of cGMP in other transduction pathways (see above) suggested such candidates as a phosphodiesterase, a guanylyl cyclase activating protein (GCAP), a G protein, another GC, or a cyclic nucleotide gated channel. Instead, our molecular analysis indicates that daf-21 encodes the C. elegans ortholog of Hsp90, a chaperone protein. This very unexpected result suggests a previously undescribed role for Hsp90 in regulating one or more proteins involved in cGMP signaling.

Three lines of evidence support our conclusion that daf-21 encodes Hsp90. Initially transformation rescue with small genomic subclones suggested the Hsp90-encoding gene is daf-21. However, as shown in Fig 5, there is only a 612-bp segment separating the Hsp90 coding region and C47E8.4, a divergently transcribed gene that is homologous to human XAP-5 (MAZZARELLA et al. 1997 Down). Therefore, it was difficult to construct subclones that retained Hsp90 and its complete promoter yet definitively deleted all of the C47E8.4 coding region. However, pEM12, which can encode only the first 110 amino acids of the 394 predicted for C47E8.4, still rescues daf-21(p673) partially. We attribute the incompleteness of the rescue to the fact that pEM12 has only 1044 bp upstream of the Hsp90 translation start site. To confirm the gene assignment, we identified an E292 to K change in the Hsp90 coding region in the daf-21(p673) mutant. Finally, we identified a deletion predicted to severely truncate the Hsp90 protein and showed that it fails to complement daf-21(p673).

In other organisms, Hsp90 is reported to be one of the most highly expressed proteins (1–2% of total). In accord with this, we found that ~3% of C. elegans cDNA clones hybridized to an Hsp90 probe. Surprisingly, reduction of Hsp90 expression to 5% of normal was shown to have little effect in Saccharomyces cerevisiae (PICARD et al. 1990 Down; XU and LINDQUIST 1993 Down). We speculate that the maternal rescue of the daf-21(p673) mutant phenotypes is a consequence of high levels of Hsp90 protein or RNA contributed to the developing egg by the mother, combined with tolerance for greatly reduced levels of Hsp90 function.

A possible role of Hsp90 in chemosensory transduction:
Although Hsp90 function is not entirely understood, two related functions have been ascribed to this chaperone protein (reviewed in SCHEIBEL and BUCHNER 1998 Down; BUCHNER 1999 Down; CAPLAN 1999 Down; MAYER and BUKAU 1999 Down). First, it is believed that Hsp90 is important for refolding denatured or misfolded proteins. In an in vitro assay, Hsp90 prevented the irreversible aggregation of denatured proteins and promoted refolding (WEICH et al. 1992 Down). As for all heat-shock proteins, Hsp90 expression is induced upon heat shock (WELCH and FERAMISCO 1982 Down; JAKOB et al. 1995 Down; FREEMAN and MORIMOTO 1996 Down; SCHUMACHER et al. 1996 Down), consistent with this general role in handling unfolded proteins. In C. elegans, transcription of Hsp90 is increased 15-fold in dauers compared to non-dauers (DALLEY and GOLOMB 1992 Down), providing additional chaperone activity under the stressful conditions that dauers are capable of enduring. Hsp90 plays a second role in the absence of stress by stably binding to specific target proteins and helping them to achieve their mature structures. Typically, the Hsp90-bound target protein is inactive but capable of being activated, and Hsp90 then dissociates from the target protein upon its activation (reviewed in SCHEIBEL and BUCHNER 1998 Down; BUCHNER 1999 Down; CAPLAN 1999 Down; MAYER and BUKAU 1999 Down). There is no evidence that Hsp90 acts as a general chaperone for folding all newly synthesized proteins. For example, an S. cerevisiae temperature-sensitive defect in hsp82 (the Hsp90 ortholog) does not lead to a widespread accumulation of unfolded proteins (NATHAN et al. 1997 Down).

The rules governing the specificity of Hsp90 interaction with target proteins seem elusive. Hsp90 is promiscuous in that it interacts with targets as varied as nuclear hormone receptors, kinases, tubulin, nitric oxide synthase, and telomerase (see BUCHNER 1999 Down for a summary). Yet Hsp90 can also be quite selective, illustrated by the fact that Hsp90 is far more important for v-src kinase function than that of the nearly identical c-src (XU and LINDQUIST 1993 Down; XU et al. 1999 Down). Because Hsp90 target proteins do not share common sequences or known structural motifs, it has been hypothesized that Hsp90 recognizes unfolded structures of proteins with complex folding pathways or with unstable intermediates. Complexes of Hsp90 and target proteins also include different assortments of conserved cochaperones and Hsp90 partner proteins (reviewed in SCHEIBEL and BUCHNER 1998 Down; BUCHNER 1999 Down; CAPLAN 1999 Down). There are homologs of most of these in C. elegans (Hsp-70 ~ many genes; Hip ~ T12D8.8; Hsp40 ~ F54D5.8; Hop ~ R09E12.3; p23 ~ ZC395.10 (weak homology); Cdc37 ~ W08F4.8; FKBP51 and FKBP52 ~ F31D4.3; Cyp40 ~ none; PP5 ~ Y39B6B.FF; Cns1p ~ C17G10.2). It is intriguing that one of these partner proteins, PP5 (a protein-serine phosphatase) associates with the KHD of the atrial natriuretic peptide receptor (a TM-GC; CHINKERS 1994 Down).

On the basis of the known functions of Hsp90, we hypothesize that DAF-21/Hsp90 associates with the DAF-11 TM-GC, perhaps to stabilize an inactive form of the cyclase. This model of physical association can be tested, for example, by coimmunoprecipitation of Hsp90 and DAF-11. An alternative explanation for the shared phenotypes of daf-11 and daf-21 mutants is that Hsp90 stabilizes an unidentified protein required for DAF-11-dependent chemosensory transduction. The daf-21(p673) E292K mutation causes relatively limited phenotypes (specific sensory defects and reduced fertility) and is not a null mutation. Therefore, the daf-21(p673) mutation may interfere relatively specifically with stabilization of a chemosensory transduction component (such as DAF-11) without seriously impairing other Hsp90 functions. However, a more detailed knowledge of how Hsp90 binds to its targets and cochaperones is needed to understand the consequences of this change.


*  FOOTNOTES

1 These authors contributed equally to this work. Back
2 Present address: QIAGEN Inc., 28159 Avenue Stanford, Valencia, CA 91355. Back
3 Present address: Cambria Biosciences, LLC, 2 Preston Ct., Medford, MA 01730. Back


*  ACKNOWLEDGMENTS

We thank D. Riddle and P. Albert for the daf-11(m597) allele; S. Xu, J. Ahnn, G. Seydoux, and Andy Fire for GFP vectors; Jing Chen and Jill Spoerke (Axys Pharmaceuticals, NemaPharm Group) for generation of the daf-21(nr2081) deletion mutation; the Caenorhabditis Genetics Center for strains; the C. elegans Genome Sequencing Consortium for sequence data and for cosmids; R. BARSTEAD and A. FIRE for cDNA libraries; Axys Pharmaceuticals, NemaPharm Group and Cambria Biosciences LLC for resources and equipment; K. Iwasaki for RNA; J. Beavo for advice about 8-bromo-cGMP; S. Yu and D. Garbers for sharing data prior to publication; B. Sawin, C. Trent, H. R. Horvitz, C. Bargmann, M. Ailion, D. Weinshenker, P. Green, D. Pilgrim, K. Kemphues, M. Hengartner, and M. Gilbert for sharing unpublished information. We also thank M. Ailion for helpful comments on the manuscript and C. Bargmann and all members of our laboratory for fruitful conversation. D.A.B. and J.J.V. were supported by National Institutes of Health (NIH) Training Grant T32 GM-07735. E.M.L. was supported by a grant from the American Cancer Society. This work was also supported by NIH grant GM-48700 to J.H.T.

Manuscript received November 4, 1999; Accepted for publication January 10, 2000.


*  LITERATURE CITED
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

ALTSCHUL, S. F., W. GISH, W. MILLER, E. W. MYERS, and D. J. LIPMAN, 1990  Basic local alignment search tool. J. Mol. Biol. 215:403-410[Medline].

BAEHR, W., E. A. MORITA, R. J. SWANSON, and M. L. APPLEBURY, 1982  Characterization of bovine rod outer segment G-protein. J. Biol. Chem. 257:6452-6460[Free Full Text].

BARGMANN, C. I. and H. R. HORVITZ, 1991a  Control of larval development by chemosensory neurons in Caenorhabditis elegans.. Science 251:1243-1246[Abstract/Free Full Text].

BARGMANN, C. I. and H. R. HORVITZ, 1991b  Chemosensory neurons with overlapping functions direct chemotaxis to multiple chemicals in C. elegans.. Neuron 7:729-742[Medline].

BARGMANN, C. I., E. HARTWIEG, and H. R. HORVITZ, 1993  Odorant-selective genes and neurons mediate olfaction in C. elegans.. Cell 74:515-527[Medline].

BARNES, W. M., 1994  PCR amplification of up to 35-kb DNA with high fidelity and high yield from lambda bacteriophage templates. Proc. Natl. Acad. Sci. USA 91:2216-2220[Abstract/Free Full Text].

BARSTEAD, R. J. and R. H. WATERSTON, 1989  The basal component of the nematode dense-body is vinculin. J. Biol. Chem. 264:10177-10185[Abstract/Free Full Text].

BLOOM, L. and H. R. HORVITZ, 1997  The Caenorhabditis elegans gene unc-76 and its human homologs define a new gene family involved in axonal outgrowth and fasciculation. Proc. Natl. Acad. Sci. USA 94:3414-3419[Abstract/Free Full Text].

BORKOVICH, K. A., F. W. FARRELLY, D. B. FINKELSTEIN, J. TAULIEN, and S. LINDQUIST, 1989  hsp82 is an essential protein that is required in higher concentrations for growth of cells at higher temperatures. Mol. Cell. Biol. 9:3919-3930[Abstract/Free Full Text].

BRENNER, S., 1974  The genetics of Caenorhabditis elegans.. Genetics 77:71-94[Abstract/Free Full Text].

BUCHNER, J., 1999  Hsp90 & Co.—a holding for folding. Trends Biochem. Sci. 24:136-141[Medline].

Genome sequence of the nematode C. elegans: a platform for investigating biology. (1998) Science 282:2012-2018[Abstract/Free Full Text].

CAPLAN, A. J., 1999  Hsp90's secrets unfold: new insights from structural and functional studies. Trends Cell Biol. 9:262-268[Medline].

CASSADA, R. and R. L. RUSSELL, 1975  The dauer larva, a post-embryonic developmental variant of the nematode Caenorhabditis elegans.. Dev. Biol. 46:326-342[Medline].

CHALFIE, M., Y. TU, G. EUSKIRCHEN, W. W. WARD, and D. C. PRASHER, 1994  Green fluorescent protein as a marker for gene expression. Science 263:802-805[Abstract/Free Full Text].

CHEN, C. F., Y. CHEN, K. DAI, P. L. CHEN, and D. J. RILEY et al., 1996  A new member of the hsp90 family of molecular chaperones interacts with the retinoblastoma protein during mitosis and after heat shock. Mol. Cell. Biol. 16:4691-4699[Abstract].

CHINKERS, M., 1994  Targeting of a distinctive protein-serine phosphatase to the protein kinase-like domain of the atrial natriuretic peptide receptor. Proc. Natl. Acad. Sci. USA 91:11075-11079[Abstract/Free Full Text].

CHINKERS, M. and D. L. GARBERS, 1989  The protein kinase domain of the ANP receptor is required for signaling. Science 245:1392-1394[Abstract/Free Full Text].

CHINKERS, M., D. L. GARBERS, M. S. CHANG, D. G. LOWE, and H. M. CHIN et al., 1989  A membrane form of guanylate cyclase is an atrial natriuretic peptide receptor. Nature 338:78-83[Medline].

CHINKERS, M., S. SINGH, and D. L. GARBERS, 1991  Adenine nucleotides are required for activation of rat atrial natriuretic peptide receptor/guanylyl cyclase expressed in a baculovirus system. J. Biol. Chem. 266:4088-4093[Abstract/Free Full Text].

COBURN, C. M. and C. I. BARGMANN, 1996  A putative cyclic nucleotide-gated channel is required for sensory development and function in C. elegans.. Neuron 17:695-706[Medline].

COBURN, C. M., I. MORI, Y. OHSHIMA, and C. I. BARGMANN, 1998  A cyclic nucleotide-gated channel inhibits sensory axon outgrowth in larval and adult Caenorhabditis elegans: a distinct pathway for maintenance of sensory axon structure. Development 125:249-258[Abstract].

CUTFORTH, T. and G. M. RUBIN, 1994  Mutations in Hsp83 and cdc37 impair signaling by the sevenless receptor tyrosine kinase in Drosophila. Cell 77:1027-1036[Medline].

DALLEY, B. K. and M. GOLOMB, 1992  Gene expression in the Caenorhabditis elegans dauer larva: developmental regulation of Hsp90 and other genes. Dev. Biol. 151:80-90[Medline].

DREWETT, J. G. and D. L. GARBERS, 1994  The family of guanylyl cyclase receptors and their ligands. Endocr. Rev. 15:135-162[Abstract/Free Full Text].

DUSENBERY, D. B., 1974  Analysis of chemotaxis in the nematode Caenorhabditis elegans by countercurrent separation. J. Exp. Zool. 188:41-48[Medline].

ESTEVEZ, M., L. ATTISANO, J. L. WRANA, P. S. ALBERT, and J. MASSAGUE et al., 1993  The daf-4 gene encodes a bone morphogenetic protein receptor controlling C. elegans dauer larva development. Nature 365:644-649[Medline].

FESENKO, E. E., S. S. KOLESNIKOV, and A. L. LYUBARSKY, 1985  Induction by cyclic GMP of cationic conductance in plasma membrane of retinal rod outer segment. Nature 313:310-313[Medline].

FREEMAN, B. C. and R. I. MORIMOTO, 1996  The human cytosolic molecular chaperones hsp90, hsp70 (hsc70) and hdj-1 have distinct roles in recognition of a non-native protein and protein refolding. EMBO J. 15:2969-2979[Medline].

FROHMAN, M. A., M. K. DUSH, and G. R. MARTIN, 1988  Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer. Proc. Natl. Acad. Sci. USA 85:8998-9002[Abstract/Free Full Text].

GEORGI, L. L., P. S. ALBERT, and D. L. RIDDLE, 1990  daf-1, a C. elegans gene controlling dauer larva development, encodes a novel receptor protein kinase. Cell 61:635-645[Medline].

GOLDEN, J. W. and D. L. RIDDLE, 1982  A pheromone influences larval development in the nematode Caenorhabditis elegans.. Science 218:578-580[Abstract/Free Full Text].

GOLDEN, J. W. and D. L. RIDDLE, 1984a  The Caenorhabditis elegans dauer larva: developmental effects of pheromone, food, and temperature. Dev. Biol. 102:368-378[Medline].

GOLDEN, J. W. and D. L. RIDDLE, 1984b  A Caenorhabditis elegans dauer-inducing pheromone and an antagonistic component of the food supply. J. Chem. Ecol. 10:1265-1280.

GOTTLIEB, S. and G. RUVKUN, 1994  daf-2, daf-16 and daf-23: genetically interacting genes controlling dauer formation in Caenorhabditis elegans.. Genetics 137:107-120[Abstract].

GOY, M. F., 1991  cGMP: the wayward child of the cyclic nucleotide family. Trends Neurosci. 14:293-299[Medline].

GRENERT, J. P., B. D. JOHNSON, and D. O. TOFT, 1999  The importance of ATP binding and hydrolysis by hsp90 in formation and function of protein heterocomplexes. J. Biol. Chem. 274:17525-17533[Abstract/Free Full Text].

HANKS, S. K., A. M. QUINN, and T. HUNTER, 1988  The protein kinase family: conserved features and deduced phylogeny of the catalytic domains. Science 241:42-52[Abstract/Free Full Text].

HORVITZ, H. R., S. BRENNER, J. HODGKIN, and R. K. HERMAN, 1979  A uniform genetic nomenclature for the nematode Caenorhabditis elegans.. Mol. Gen. Genet. 175:129-133[Medline].

HUANG, L. S., P. TZOU, and P. W. STERNBERG, 1994  The lin-15 locus encodes two negative regulators of Caenorhabditis elegans vulval development. Mol. Biol. Cell 5:395-412[Abstract].

HURLEY, J. B., 1987  Molecular properties of the cGMP cascade of vertebrate photoreceptors. Annu. Rev. Physiol. 49:793-812[Medline].

INOUE, T. and J. H. THOMAS, 2000  Targets of TGF-ß signaling in C. elegans dauer formation. Dev. Biol. 217:192-204[Medline].

JAKOB, U., H. LILIE, I. MEYER, and J. BUCHNER, 1995  Transient interaction of Hsp90 with early unfolding intermediates of citrate synthase. Implications for heat shock in vivo. J. Biol. Chem. 270:7288-7294[Abstract/Free Full Text].

KIMURA, Y., S. MATSUMOTO, and I. YAHARA, 1994  Temperature-sensitive mutants of hsp82 of the budding yeast Saccharomyces cerevisiae.. Mol. Gen. Genet. 242:517-527[Medline].

KOMATSU, H., I. MORI, J. S. RHEE, N. AKAIKE, and Y. OHSHIMA, 1996  Mutations in a cyclic nucleotide-gated channel lead to abnormal thermosensation and chemosensation in C. elegans.. Neuron 17:707-718[Medline].

KOUTALOS, Y. and K. W. YAU, 1993  A rich complexity emerges in phototransduction. Curr. Opin. Neurobiol. 3:513-519[Medline].

LIU, D. W. C. and J. H. THOMAS, 1994  Regulation of a periodic motor program in C. elegans.. J. Neurosci. 14:1953-1962[Abstract].

LIU, L. X., J. M. SPOERKEM, E. L. MULLIGAN, J. CHEN, and B. REARDON et al., 1999  High-throughput isolation of Caenorhabditis elegans deletion mutants. Genome Res. 9:859-867[Abstract/Free Full Text].

MALONE, E. A., T. INOUE, and J. H. THOMAS, 1996  Genetic analysis of the roles of daf-28 and age-1 in regulating Caenorhabditis elegans dauer formation. Genetics 143:1193-1205[Abstract].

MAYER, M. P. and B. BUKAU, 1999  Molecular chaperones: the busy life of Hsp90. Curr. Biol. 9:R322-R325[Medline].

MAZZARELLA, R., G. PENGUE, J. YOON, J. JONES, and D. SCHLESSINGER, 1997  Differential expression of XAP5, a candidate disease gene. Genomics 45:216-219[Medline].

MCNEIL, L., M. CHINKERS, and M. FORTE, 1995  Identification, characterization, and developmental regulation of a receptor guanylyl cyclase expressed during early stages of Drosophila development. J. Biol. Chem. 270:7189-7196[Abstract/Free Full Text].

MELLO, C. C., J. M. KRAMER, D. STINCHCOMB, and V. AMBROS, 1991  Efficient gene transfer in C. elegans: extrachromosomal maintenance and integration of transforming sequences. EMBO J. 10:3959-3970[Medline].

MENG, X., J. DEVIN, W. P. SULLIVAN, D. TOFT, and E. E. BAULIEU et al., 1996  Mutational analysis of Hsp90 alpha dimerization and subcellular localization: dimer disruption does not impede "in vivo" interaction with estrogen receptor. J. Cell Sci. 109:1677-1687[Abstract].

MIKI, N., J. M. BARABAN, J. J. KEIRNS, J. J. BOYCE, and M. W. BITENSKY, 1975  Purification and properties of the light-activated cyclic nucleotide phosphodiesterase of rod outer segments. J. Biol. Chem. 250:6320-6327[Abstract/Free Full Text].

MILLER, L. M., J. D. PLENEFISCH, L. P. CASSON, and B. J. MEYER, 1988  xol-1: a gene that controls the male modes of sex determination and X chromosome dosage compensation in C. elegans.. Cell 55:167-183[Medline].

MORRIS, J. Z., H. A. TISSENBAUM, and G. RUVKUN, 1996  A phosphatidylinositol-3-OH kinase family member regulating longevity and diapause in Caenorhabditis elegans. Nature 382:536-539[Medline].

NATHAN, D. F., M. H. VOS, and S. LINDQUIST, 1997  In vivo functions of the Saccharomyces cerevisiae Hsp90 chaperone. Proc. Natl. Acad. Sci. USA 94:12949-12956[Abstract/Free Full Text].

NEMOTO, T. and N. SATO, 1998  Oligomeric forms of the 90-kDa heat shock protein. Biochem. J. 330:989-995.

NEMOTO, T., Y. OHARA-NEMOTO, M. OTA, T. TAKAGI, and K. YOKOYAMA, 1995  Mechanism of dimer formation of the 90-kDa heat-shock protein. Eur. J. Biochem. 233:1-8[Medline].

OBERMANN, W. M., H. SONDERMANN, A. A. RUSSO, N. P. PAVLETICH, and F. U. HARTL, 1998  In vivo function of Hsp90 is dependent on ATP binding and ATP hydrolysis. J. Cell Biol. 143:901-910[Abstract/Free Full Text].

PARKINSON, S. J., S. L. CARRITHERS, and S. A. WALDMAN, 1994  Opposing adenine nucleotide-dependent pathways regulate guanylyl cyclase C in rat intestine. J. Biol. Chem. 269:22683-22690[Abstract/Free Full Text].

PICARD, D., B. KHURSHEED, M. J. GARABEDIAN, M. G. FORTIN, and S. LINDQUIST et al., 1990  Reduced levels of hsp90 compromise steroid receptor action in vivo.. Nature 348:166-168[Medline].

PRODROMOU, C., S. M. ROEM, P. W. PIPER, and L. H. PEARL, 1997a  A molecular clamp in the crystal structure of the N-terminal domain of the yeast Hsp90 chaperone. Nat. Struct. Biol. 4:477-482[Medline].

PRODROMOU, C., S. M. ROE, R. O'BRIEN, J. E. LADBURY, and P. W. PIPER et al., 1997b  Identification and structural characterization of the ATP/ADP-binding site in the Hsp90 molecular chaperone. Cell 90:65-75[Medline].

REN, P., C. S. LIM, R. JOHNSEN, P. S. ALBERT, and D. PILGRIM et al., 1996  Control of C. elegans larval development by neuronal expression of a TGF-ß homolog. Science 274:1389-1391[Abstract/Free Full Text].

RIDDLE, D. L., and P. S. ALBERT, 1997 Genetic and environmental regulation of dauer larva development, pp. 739–768 in C. elegans II, edited by D. L. RIDDLE, T. BLUMENTHAL, J. MEYER and J. R. PRIESS. Cold Spring Harbor Laboratory Press, Plainview, NY.

RIDDLE, D. L., M. M. SWANSON, and P. S. ALBERT, 1981  Interacting genes in nematode dauer formation. Nature 270:668-671.

SCHACKWITZ, W. S., T. INOUE, and J. H. THOMAS, 1996  Chemosensory neurons function in parallel to mediate a pheromone response in C. elegans.. Neuron 17:719-728[Medline].

SCHEIBEL, T. and J. BUCHNER, 1998  The Hsp90 complex—a super-chaperone machine as a novel drug target. Biochem. Pharmacol. 56:675-682[Medline].

SCHEIBEL, T., T. WEIKL, and J. BUCHNER, 1998  Two chaperone sites in Hsp90 differing in substrate specificity and ATP dependence. Proc. Natl. Acad. Sci. USA 95:1495-1499[Abstract/Free Full Text].

SCHEIBEL, T., H. I. SIEGMUND, R. JAENICKE, P. GANZ, and H. LILIE et al., 1999  The charged region of Hsp90 modulates the function of the N-terminal domain. Proc. Natl. Acad. Sci. USA 96:1297-1302[Abstract/Free Full Text].

SCHUMACHER, R. J., W. J. HANSEN, B. C. FREEMAN, E. ALNEMRI, and G. LITWACK et al., 1996  Cooperative action of Hsp70, Hsp90, and DnaJ proteins in protein renaturation. Biochemistry 35:14889-14898[Medline].

SINGH, S., D. G. LOWE, D. S. THORPE, H. RODRIGUEZ, and W. J. KUANG et al., 1988  Membrane guanylate cyclase is a cell-surface receptor with homology to protein kinases. Nature 334:708-712[Medline].

SONG, H. Y., J. D. DUNBAR, Y. X. ZHANG, D. GUO, and D. B. DONNER, 1996  Identification of a protein with homology to hsp90 that binds the type 1 tumor necrosis factor receptor. J. Biol. Chem. 24:3574-3581.

STEBBINS, C. E., A. A. RUSSO, C. SCHNEIDER, N. ROSEN, and F. U. HARTL et al., 1997  Crystal structure of an Hsp90-geldanamycin complex: targeting of a protein chaperone by an antitumor agent. Cell 89:239-250[Medline].

THOMAS, J. H., D. A. BIRNBY, and J. J. VOWELS, 1993  Evidence for parallel processing of sensory information controlling dauer formation in Caenorhabditis elegans.. Genetics 134:1105-1117[Abstract].

TROEMEL, E. R., J. H. CHOU, N. D. DWYER, H. A. COLBERT, and C. I. BARGMANN, 1995  Divergent seven transmembrane receptors are candidate chemosensory receptors in C. elegans.. Cell 83:207-218[Medline].

TROEMEL, E. R., B. E. KIMMEL, and C. I. BARGMANN, 1997  Preprogramming chemotaxis responses: sensory neurons define olfactory preferences in C. elegans.. Cell 91:161-169[Medline].

VAANDRAGER, A. B., E. VAN DER WIEL, and H. R. DE JONGE, 1993a  Heat-stable enterotoxin activation of immunopurified guanylyl cyclase C: modulation by adenine nucleotides. J. Biol. Chem. 268:19598-19603[Abstract/Free Full Text].

VAANDRAGER, A. B., S. SCHULZ, H. R. DE JONGE, and D. L. GARBERS, 1993b  Guanylyl cyclase C is an N-linked glycoprotein receptor that accounts for multiple heat-stable enterotoxin-binding proteins in the intestine. J. Biol. Chem. 268:2174-2179[Abstract/Free Full Text].

VAN DER KEYL, H., H. KIM, R. ESPEY, C. V. OKE, and M. K. EDWARDS, 1994  Caenorhabditis elegans sqt-3 mutants have mutations in the col-1 collagen gene. Dev. Dyn. 201:86-94[Medline].

VAN DER STRATEN, A., C. ROMMEL, B. DICKSON, and E. HAFEN, 1997  The heat shock protein 83 (Hsp83) is required for Raf-mediated signalling in Drosophila. EMBO J. 16:1961-1969[Medline].

VOWELS, J. J., 1994 Genes mediating chemosensory responses in Caenorhabditis elegans. Ph.D. Thesis, University of Washington, Seattle.

VOWELS, J. J. and J. H. THOMAS, 1992  Genetic analysis of chemosensory control of dauer formation in Caenorhabditis elegans.. Genetics 130:105-123[Abstract].

VOWELS, J. J. and J. H. THOMAS, 1994  Multiple chemosensory defects in daf-11 and daf-21 mutants of Caenorhabditis elegans.. Genetics 138:303-316[Abstract].

WARD, S., 1973  Chemotaxis by the nematode Caenorhabditis elegans: identification of attractants and analysis of the response by use of mutants. Proc. Natl. Acad. Sci. USA 70:817-821[Abstract/Free Full Text].

WATERSTON, R., C. MARTIN, M. CRAXTON, C. HUYNH, and A. COULSON et al., 1992  A survey of expressed genes in C. elegans.. Nat. Genet. 1:114-123[Medline].

WATERSTON, R. H., J. E. SULSTON and A. R. COULSON, 1997 The genome, pp. 23–45 in C. elegans II, edited by D. L. RIDDLE, T. BLUMENTHAL, B. J. MEYER and J. R. PRIESS. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

WEICH, H., J. BUCHNER, R. ZIMMERMAN, and U. JAKOB, 1992  Hsp90 chaperones protein folding in vitro.. Nature 358:169-170[Medline].

WELCH, W. J. and J. R. FERAMISCO, 1982  Purification of the major mammalian heat shock proteins. J. Biol. Chem. 257:14949-14959[Abstract/Free Full Text].

WHITE, J. G., E. SOUTHGATE, J. N. THOMSON, and S. BRENNER, 1986  The structure of the nervous system of the nematode Caenorhabditis elegans.. Philos. Trans. R. Soc. Lond. B 314:1-340.

WOOD, W. B. (Editor), 1988 The Nematode Caenorhabditis elegans. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

XU, Y. and S. LINDQUIST, 1993  Heat-shock protein hsp90 governs the activity of pp60v-src kinase. Proc. Natl. Acad. Sci. USA 90:7074-7078[Abstract/Free Full Text].

XU, Y., M. A. SINGER, and S. LINDQUIST, 1999  Maturation of the tyrosine kinase c-src as a kinase and as a substrate depends on the molecular chaperone Hsp90. Proc. Natl. Acad. Sci. USA 96:109-114[Abstract/Free Full Text].

YOUNG, J. C., C. SCHNEIDER, and F. U. HARTL, 1997  In vitro evidence that hsp90 contains two independent chaperone sites. FEBS Lett. 418:139-143[Medline].

YU, S., L. AVERY, E. BAUDE, and D. L. GARBERS, 1997  Guanylyl cyclase expression in specific sensory neurons: a new family of chemosensory receptors. Proc. Natl. Acad. Sci. USA 94:3384-3387[Abstract/Free Full Text].

YUEN, P. S. T. and D. L. GARBERS, 1992  Guanylyl cyclase-linked receptors. Annu. Rev. Neurosci. 15:193-225[Medline].

ZWAAL, R. R., A. BROEKS, J. VAN MEURS, J. T. GROENEN, and R. H. PLASTERK, 1993  Target-selected gene inactivation in Caenorhabditis elegans by using a frozen transposon insertion mutant bank. Proc. Natl. Acad. Sci. USA 90:7431-7435[Abstract/Free Full Text].

ZWAAL, R. R., J. E. MENDEL, P. W. STERNBERG, and R. H. A. PLASTERK, 1997  Two neuronal G proteins are involved in chemosensation of the C. elegans dauer inducing pheromone. Genetics 145:715-727[Abstract].




This article has been cited by other articles:


Home page
J. Neurosci.Home page
M. M. Gaglia and C. Kenyon
Stimulation of Movement in a Quiescent, Hibernation-Like Form of Caenorhabditis elegans by Dopamine Signaling
J. Neurosci., June 3, 2009; 29(22): 7302 - 7314.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
M. Moussaif and J. Y. Sze
Intraflagellar Transport/Hedgehog-Related Signaling Components Couple Sensory Cilium Morphology and Serotonin Biosynthesis in Caenorhabditis elegans
J. Neurosci., April 1, 2009; 29(13): 4065 - 4075.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
B. J. Lesch, A. R. Gehrke, M. L. Bulyk, and C. I. Bargmann
Transcriptional regulation and stabilization of left-right neuronal identity in C. elegans
Genes & Dev., February 1, 2009; 23(3): 345 - 358.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
A. M. van der Linden, S. Wiener, Y.-j. You, K. Kim, L. Avery, and P. Sengupta
The EGL-4 PKG Acts With KIN-29 Salt-Inducible Kinase and Protein Kinase A to Regulate Chemoreceptor Gene Expression and Sensory Behaviors in Caenorhabditis elegans
Genetics, November 1, 2008; 180(3): 1475 - 1491.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
R. A. Butcher, J. R. Ragains, E. Kim, and J. Clardy
A potent dauer pheromone component in Caenorhabditis elegans that acts synergistically with other components
PNAS, September 23, 2008; 105(38): 14288 - 14292.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
N. Fielenbach and A. Antebi
C. elegans dauer formation and the molecular basis of plasticity
Genes & Dev., August 15, 2008; 22(16): 2149 - 2165.
[Abstract] [Full Text] [PDF]


Home page
Journals of Gerontology Series A: Biological Sciences and Medical SciencesHome page
K. L. Banfield, T. A. Gomez, W. Lee, S. Clarke, and P. L. Larsen
Protein-Repair and Hormone-Signaling Pathways Specify Dauer and Adult Longevity and Dauer Development in Caenorhabditis elegans
J. Gerontol. A Biol. Sci. Med. Sci., August 1, 2008; 63(8): 798 - 808.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
J. Ouellet, S. Li, and R. Roy
Notch signalling is required for both dauer maintenance and recovery in C. elegans
Development, August 1, 2008; 135(15): 2583 - 2592.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
E. A. Hallem and P. W. Sternberg
Acute carbon dioxide avoidance in Caenorhabditis elegans
PNAS, June 10, 2008; 105(23): 8038 - 8043.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Leskovar, H. Wegele, N. D. Werbeck, J. Buchner, and J. Reinstein
The ATPase Cycle of the Mitochondrial Hsp90 Analog Trap1
J. Biol. Chem., April 25, 2008; 283(17): 11677 - 11688.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
M. A. Alaamery and C. S. Hoffman
Schizosaccharomyces pombe Hsp90/Git10 Is Required for Glucose/cAMP Signaling
Genetics, April 1, 2008; 178(4): 1927 - 1936.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Wayne and D. N. Bolon
Dimerization of Hsp90 Is Required for in Vivo Function: DESIGN AND ANALYSIS OF MONOMERS AND DIMERS
J. Biol. Chem., November 30, 2007; 282(48): 35386 - 35395.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
T. Inoue, M. Ailion, S. Poon, H. K. Kim, J. H. Thomas, and P. W. Sternberg
Genetic Analysis of Dauer Formation in Caenorhabditis briggsae
Genetics, October 1, 2007; 177(2): 809 - 818.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
V. L. Jensen, P. S. Albert, and D. L. Riddle
Caenorhabditis elegans SDF-9 Enhances Insulin/Insulin-Like Signaling Through Interaction With DAF-2
Genetics, September 1, 2007; 177(1): 661 - 666.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
K. Yook and J. Hodgkin
Mos1 Mutagenesis Reveals a Diversity of Mechanisms Affecting Response of Caenorhabditis elegans to the Bacterial Pathogen Microbacterium nematophilum
Genetics, February 1, 2007; 175(2): 681 - 697.
[Abstract] [Full Text] [PDF]


Home page
Integr. Comp. Biol.Home page
M. E. Baker
Evolution of metamorphosis: role of environment on expression of mutant nuclear receptors and other signal-transduction proteins
Integr. Comp. Biol., December 1, 2006; 46(6): 808 - 814.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
H. Lans and G. Jansen
Noncell- and Cell-Autonomous G-Protein-Signaling Converges With Ca2+/Mitogen-Activated Protein Kinase Signaling to Regulate str-2 Receptor Gene Expression in Caenorhabditis elegans
Genetics, July 1, 2006; 173(3): 1287 - 1299.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. Shinozaki, M. Minami, T. Chiba, M. Suzuki, K. Yoshimatsu, Y. Ichikawa, K. Terasawa, Y. Emori, K. Matsumoto, T. Kurosaki, et al.
Depletion of Hsp90beta Induces Multiple Defects in B Cell Receptor Signaling
J. Biol. Chem., June 16, 2006; 281(24): 16361 - 16369.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
C. O. Ortiz, J. F. Etchberger, S. L. Posy, C. Frokjaer-Jensen, S. Lockery, B. Honig, and O. Hobert
Searching for Neuronal Left/Right Asymmetry: Genomewide Analysis of Nematode Receptor-Type Guanylyl Cyclases
Genetics, May 1, 2006; 173(1): 131 - 149.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
H. Inada, H. Ito, J. Satterlee, P. Sengupta, K. Matsumoto, and I. Mori
Identification of Guanylyl Cyclases That Function in Thermosensory Neurons of Caenorhabditis elegans
Genetics, April 1, 2006; 172(4): 2239 - 2252.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
J. Li, G. Brown, M. Ailion, S. Lee, and J. H. Thomas
NCR-1 and NCR-2, the C. elegans homologs of the human Niemann-Pick type C1 disease protein, function upstream of DAF-9 in the dauer formation pathways
Development, November 15, 2004; 131(22): 5741 - 5752.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
P. Syntichaki and N. Tavernarakis
Genetic Models of Mechanotransduction: The Nematode Caenorhabditis elegans
Physiol Rev, October 1, 2004; 84(4): 1097 - 1153.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. V. Gunther and D. L. Riddle
Alternative Polyadenylation Results in a Truncated daf-4 BMP Receptor That Antagonizes DAF-7-mediated Development in Caenorhabditis elegans
J. Biol. Chem., September 17, 2004; 279(38): 39555 - 39564.
[Abstract] [Full Text] [PDF]


Home page
GENES CELLSHome page
Y. Nakano, Y. Nagamatsu, and Y. Ohshima
cGMP and a germ-line signal control body size in C. elegans through cGMP-dependent protein kinase EGL-4
Genes Cells, September 1, 2004; 9(9): 773 - 779.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
H. Lans, S. Rademakers, and G. Jansen
A Network of Stimulatory and Inhibitory G{alpha}-Subunits Regulates Olfaction in Caenorhabditis elegans
Genetics, August 1, 2004; 167(4): 1677 - 1687.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Biol.Home page
K. K. Langlais, J. A. Stewart, and D. B. Morton
Preliminary characterization of two atypical soluble guanylyl cyclases in the central and peripheral nervous system of Drosophila melanogaster
J. Exp. Biol., June 1, 2004; 207(13): 2323 - 2338.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
O. Hainzl, H. Wegele, K. Richter, and J. Buchner
Cns1 Is an Activator of the Ssa1 ATPase Activity
J. Biol. Chem., May 28, 2004; 279(22): 23267 - 23273.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
B. Gerisch and A. Antebi
Hormonal signals produced by DAF-9/cytochrome P450 regulate C. elegans dauer diapause in response to environmental cues
Development, April 15, 2004; 131(8): 1765 - 1776.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
H. Y. Mak and G. Ruvkun
Intercellular signaling of reproductive development by the C. elegans DAF-9 cytochrome P450
Development, April 15, 2004; 131(8): 1777 - 1786.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
T. Cai, T. Fukushige, A. L. Notkins, and M. Krause
Insulinoma-Associated Protein IA-2, a Vesicle Transmembrane Protein, Genetically Interacts with UNC-31/CAPS and Affects Neurosecretion in Caenorhabditis elegans
J. Neurosci., March 24, 2004; 24(12): 3115 - 3124.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
X. Huang, J. A. Powell-Coffman, and Y. Jin
The AHR-1 aryl hydrocarbon receptor and its co-factor the AHA-1 aryl hydrocarbon receptor nuclear translocator specify GABAergic neuron cell fate in C. elegans
Development, February 15, 2004; 131(4): 819 - 828.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
J. F. Morley and R. I. Morimoto
Regulation of Longevity in Caenorhabditis elegans by Heat Shock Factor and Molecular Chaperones
Mol. Biol. Cell, February 1, 2004; 15(2): 657 - 664.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
M. Ailion and J. H. Thomas
Isolation and Characterization of High-Temperature-Induced Dauer Formation Mutants in Caenorhabditis elegans
Genetics, September 1, 2003; 165(1): 127 - 144.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
K. Ohkura, N. Suzuki, T. Ishihara, and I. Katsura
SDF-9, a protein tyrosine phosphatase-like molecule, regulates the L3/dauer developmental decision through hormonal signaling in C. elegans
Development, July 15, 2003; 130(14): 3237 - 3248.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
J. Wang and S. K. Kim
Global analysis of dauer gene expression in Caenorhabditis elegans
Development, April 15, 2003; 130(8): 1621 - 1634.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
O. Uchida, H. Nakano, M. Koga, and Y. Ohshima
The C. elegans che-1 gene encodes a zinc finger transcription factor required for specification of the ASE chemosensory neurons
Development, April 1, 2003; 130(7): 1215 - 1224.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
W. Li, S. G. Kennedy, and G. Ruvkun
daf-28 encodes a C. elegans insulin superfamily member that is regulated by environmental cues and acts in the DAF-2 signaling pathway
Genes & Dev., April 1, 2003; 17(7): 844 - 858.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
B. van Swinderen, L. B. Metz, L. D. Shebester, and C. M. Crowder
A Caenorhabditis elegans Pheromone Antagonizes Volatile Anesthetic Action Through a Go-Coupled Pathway
Genetics, May 1, 2002; 161(1): 109 - 119.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
A. H. Hutagalung, M. L. Landsverk, M. G. Price, and H. F. Epstein
The UCS family of myosin chaperones
J. Cell Sci., January 11, 2002; 115(21): 3983 - 3990.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
K. Jia, P. S. Albert, and D. L. Riddle
DAF-9, a cytochrome P450 regulating C. elegans larval development and adult longevity
Development, January 1, 2002; 129(1): 221 - 231.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J.-C. Labbé, J. Burgess, L. A. Rokeach, and S. Hekimi
ROP-1, an RNA quality-control pathway component, affects Caenorhabditis elegans dauer formation
PNAS, November 2, 2000; (2000) 230284297.
[Abstract] [Full Text]


Home page
GeneticsHome page
T. Inoue and J. H. Thomas
Suppressors of Transforming Growth Factor-{beta} Pathway Mutants in the Caenorhabditis elegans Dauer Formation Pathway
Genetics, November 1, 2000; 156(3): 1035 - 1046.
[Abstract] [Full Text]


Home page
GeneticsHome page
M. Ailion and J. H. Thomas
Dauer Formation Induced by High Temperatures in Caenorhabditis elegans
Genetics, November 1, 2000; 156(3): 1047 - 1067.
[Abstract] [Full Text]


Home page
GeneticsHome page
S. A. Daniels, M. Ailion, J. H. Thomas, and P. Sengupta
egl-4 Acts Through a Transforming Growth Factor-{beta}/SMAD Pathway in Caenorhabditis elegans to Regulate Multiple Neuronal Circuits in Response to Sensory Cues
Genetics, September 1, 2000; 156(1): 123 - 141.
[Abstract] [Full Text]


Home page
JCBHome page
T. M. Rogalski, G. P. Mullen, M. M. Gilbert, B. D. Williams, and D. G. Moerman
The UNC-112 Gene in Caenorhabditis elegans Encodes a Novel Component of Cell-Matrix Adhesion Structures Required for Integrin Localization in the Muscle Cell Membrane
J. Cell Biol., July 11, 2000; 150(1): 253 - 264.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. Kumar, N. Grammatikakis, and M. Chinkers
Regulation of the Atrial Natriuretic Peptide Receptor by Heat Shock Protein 90 Complexes
J. Biol. Chem., March 30, 2001; 276(14): 11371 - 11375.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J.-C. Labbe, J. Burgess, L. A. Rokeach, and S. Hekimi
ROP-1, an RNA quality-control pathway component, affects Caenorhabditis elegans dauer formation
PNAS, November 21, 2000; 97(24): 13233 - 13238.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
S. J.M. Jones, D. L. Riddle, A. T. Pouzyrev, V. E. Velculescu, L. Hillier, S. R. Eddy, S. L. Stricklin, D. L. Baillie, R. Waterston, and M. A. Marra
Changes in Gene Expression Associated with Developmental Arrest and Longevity in Caenorhabditis elegans
Genome Res., August 1, 2001; 11(8): 1346 - 1352.
[Abstract] [Full Text] [PDF]