| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Corresponding author: Alexander D. Johnson, Department of Microbiology, S-410, University of California, 513 Parnassus Ave., San Francisco, CA 94143-0414., ajohnson{at}socrates.ucsf.edu (E-mail)
Communicating editor: A. P. MITCHELL
| ABSTRACT |
|---|
The common fungal pathogen, Candida albicans, can grow either as single cells or as filaments (hyphae), depending on environmental conditions. Several transcriptional regulators have been identified as having key roles in controlling filamentous growth, including the products of the TUP1, CPH1, and EFG1 genes. We show, through a set of single, double, and triple mutants, that these genes act in an additive fashion to control filamentous growth, suggesting that each gene represents a separate pathway of control. We also show that environmentally induced filamentous growth can occur even in the absence of all three of these genes, providing evidence for a fourth regulatory pathway. Expression of a collection of structural genes associated with filamentous growth, including HYR1, ECE1, HWP1, ALS1, and CHS2, was monitored in strains lacking each combination of TUP1, EFG1, and CPH1. Different patterns of expression were observed among these target genes, supporting the hypothesis that these three regulatory proteins engage in a network of individual connections to downstream genes and arguing against a model whereby the target genes are regulated through a central filamentous growth pathway. The results suggest the existence of several distinct types of filamentous forms of C. albicans, each dependent on a particular set of environmental conditions and each expressing a unique set of surface proteins.
CANDIDA albicans causes common mucosal infections of varying severity in both normal and immunocompromised patients, as well as life-threatening systemic infections in immunocompromised patients (![]()
![]()
![]()
![]()
![]()
![]()
![]()
The recent advent of molecular genetics in C. albicans has allowed several genes to be identified that specifically influence filamentous growth. These genes include EFG1 (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Conversely, EFG1 and CPH1 appear to be transcriptional activators of filamentous growth, as deletion of either one causes decreased filamentous growth. CPH1, a homeodomain protein, is known to be downstream of a MAP kinase cascade in C. albicans (![]()
![]()
![]()
mutant of C. albicans shows delayed initiation of filamentous growth on Spider plates, relative to wild-type cells, but shows wild-type levels of filamentous growth in response to liquid serum treatment (![]()
mutant cells are strongly attenuated in responding to serum, showing no germ tubes or hyphae within 2 hr of being introduced to 20% serum in YPD at 37° (![]()
![]()
![]()
![]()
and efg1
mutants prompted Lo et al. to make a double mutant. They found that filamentous growth was abolished and suggested that EFG1 and CPH1 together account for the pathways that activate filamentous growth in C. albicans (![]()
Since deletion of TUP1 caused constitutive filamentous growth while deletion of CPH1 and EFG1 abolished filamentous growth, we combined deletions in all three genes to determine their epistatic relationships. In this article we describe this set of mutant strains and assay their phenotypes in terms of colony morphology, cell morphology, and expression of a battery of filament-specific genes. The experiments delineate the relative roles of each regulatory gene in filamentous growth and suggest the existence of an additional pathway of filamentous growth induction. In addition, the results demonstrate that downstream genes respond differently to the different regulatory pathways.
| MATERIALS AND METHODS |
|---|
Strains and culture conditions:
The strains used are listed in Table 1. cph1
strain JKC19 was generously provided by G. Fink and colleagues (![]()
![]()
![]()
![]()
|
Routine growth was on YPD plates and liquid at 30°, and selections for URA3 prototrophy were performed on minimal SD plates (![]()
![]()
![]()
Plasmids and strain construction:
We followed the technique of ![]()
![]()
![]()
![]()
![]()
Transformants were checked by PCR, using the following primers that anneal to regions of the EFG1 locus outside the cloned flanking regions: BBo242, 5'catatttgtaccttccgcattaga; BBo243, 5'attcattaccaggcgtgttttatta; and two primers that anneal to the hisG repeats flanking the URA3 cassette, URA 3KO-2 and URA 3KO-4 (![]()
RNA expression analysis:
Appropriate primer pairs to generate unique DNA probes were made using information from the literature, gene databases, or our own sequencing for the RBT and WAP1 genes. The identification of the RBT series of genes, which were isolated in a molecular screen for TUP1-repressed genes, will be reported elsewhere. PCR was performed on SC5314 genomic DNA, the resulting product (from 500 bp to 1 kb long) purified with a QIAquick column (QIAGEN, Chatsworth, CA), and a 32P probe made using a random priming kit from Amersham Pharmacia (Arlington Heights, IL). C. albicans strains were grown as specified above and their whole RNA was isolated using hot phenol (![]()
![]()
Photography:
Colony micrographs were taken on a Leica (Deerfield, IL) M420 microscope with unidirectional illumination at zoom settings 5.6 (Spider plates) and 11.5 (SD plates). Cell micrographs were taken on a Leica DM RD microscope with x100 objective and differential interference contrast optics.
| RESULTS |
|---|
Various combinations of cph1
, efg1
, and tup1
were constructed and their colony and cellular morphologies on both filament-inducing and noninducing media were observed (Fig 1). In our hands, the cph1
strain had a less dramatic impairment of filamentous growth on Spider agar than has been described previously (Fig 1I and Fig J; ![]()
|
Cells carrying deletions of EFG1 behaved as described (![]()
![]()
strain also showed reduced filamentous growth on most but not all solid media (Fig 1K and data not shown). This mixture of defects and enhancements with regard to filamentous growth has been noted previously for efg1
cells (![]()
with cph1
yielded a reduction in filamentous growth compared to the wild-type strain, as described (![]()
![]()
cph1
cells.
The role of EFG1 in the morphology of the tup1 mutant:
Deletion of EFG1 in the tup1
background led to a marked reduction in both constitutive and induced filamentous growth (Fig 1G and Fig O vs. E and M). Without environmental induction, a substantial proportion of the efg1
tup1
cells were nonfilamentous, as shown in the high-magnification micrograph and by the shiny (though wrinkled) surface of the colonies on SD plates (Fig 1G). This was in strong contrast to tup1
cells, which always grew as filaments (Fig 1E). On SD plates, the tup1
deletion strain consisted of highly elongated, strongly attached cells growing in a tangled mass with a seemingly infinite chain length despite the lack of hyphae projecting into the medium. In comparison, cells in colonies of the efg1
tup1
deletion strain were much shorter than the corresponding tup1
cells, and the strength of their cell-cell attachment appeared much weaker. Upon dispersion of the colony for microscopy, only about half of the cells were observed to be in chains. We have found a rough correlation between these aspects of filamentous growth and the degree of wrinkling of colonies, making colony morphology a convenient integrated assay of filamentous growth (![]()
![]()
![]()
After induction of filamentous growth on Spider plates for a week at 30°, colonies of efg1
tup1
cells had a small, smooth central area of nonfilamentous cells, surrounded by a wide fringe of agar-invading filaments (Fig 1O). This fringe was distinctly smaller than that of either wild-type or tup1
colonies (Fig 1I and Fig M). These results indicate that the pathway represented by EFG1 is required for much of the filamentous growth seen in tup1
cells under inducing environmental conditions and most of the filamentous growth seen under noninducing conditions. efg1
tup1
cells also showed no germ tube formation when transferred from YPD medium at 30° to YPD + 10% serum at 37° (not shown). In contrast, wild-type cells show uniform and rapid induction of germ tubes under these conditions. Since neither efg1
nor tup1
cells show any visible response under these conditions (![]()
![]()
In previous work, we described a cph1
tup1
strain and noted that its morphology appeared identical to that of cells carrying the tup1
mutation alone (![]()
tup1
mutant cells (Fig 1H). Colonies of cph1
efg1
tup1
cells grown on inducing (Spider) media had a large central patch of nonfilamentous cells surrounded by a small fringe of filamentous cells invading the agar. This fringe was much smaller than that of either wild-type, tup1
, cph1
tup1
, or efg1
tup1
colonies (Fig 1, compare MP). This reduction in filamentation is consistent with previous work indicating that CPH1 represents an environmentally responsive activating pathway that contributes to filamentous growth on Spider medium and that is independent of EFG1 (![]()
![]()
Even in the absence of environmental signals (on the noninducing SD medium), deletion of CPH1 caused an additional reduction in hyphal growth, as indicated by the lower degree of wrinkling of the cph1
efg1
tup1
colonies compared with the efg1
tup1
colonies (Fig 1G and Fig H). This result was not simply due to differences in colony size, since the finding was consistent over other areas of these plates that had colonies in various sizes and densities and is consistent with the idea that the CPH1, EFG1, and TUP1 pathways make additive contributions to filamentous growth.
Evidence for a fourth filamentous growth pathway:
Triple mutant cells lacking the CPH1, EFG1, and TUP1 regulators still exhibited a small amount of filamentous growth (Fig 1P). This filamentous growth was environmentally responsive (Fig 1, compare H and P), indicating that one or more signaling pathways that activate filamentous growth remained intact in the triple mutant. The slight filamentous growth seen under noninducing conditions (Fig 1H) could be due to an unregulated (basal) activity that has been uncovered by removal of TUP1 repression.
Expression analysis of filament-specific genes:
Since TUP1, EFG1, and CPH1 each regulate filamentous growth, it seemed likely that their deletion should have corresponding effects on the expression patterns of filament-specific genes. Two types of models for these effects can be envisioned (Fig 3). In the first, "central processor" model, the regulatory pathways feed into a central pathway that monitors the strength of various inducing signals, integrates the signals, and expresses all the filament-specific genes accordingly. By this model, downstream genes should all behave in a parallel fashion in response to various inducing signals and should closely track the morphology of the cells. The second, or "network" model, proposes a diverse set of individual connections between the regulatory pathways and their filament-specific downstream target genes. This model predicts that a given downstream gene may respond to some, but not necessarily all, upstream pathways, and that their levels of expression may not necessarily coincide with the morphological state of the cell. This model also supposes that filamentous growth can arise from the expression of different sets of target genes.
|
|
To investigate these models, we tested the expression of a variety of hyphal-specific genes in the mutant strains described above. Several cell wall proteins have been found to be specifically expressed upon induction of hyphal growth, including HWP1, ALS1, ECE1, CHS2, and HYR1 (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Fig 2 displays Northern blots of RNA from our mutant C. albicans strains, as noted across the top, hybridized to probes derived from the various genes mentioned above. Each strain was subjected to three growth conditions: uninduced (YPD at 30°) and two conditions of filamentous growth induction: YPD + 10% serum for 60 min at 37° after prior growth in YPD at 30° and liquid Spider medium at 37° for 120 min after prior growth in YPD at 30°. The two inducing conditions caused the majority of wild-type cells to grow germ tubes (nascent hyphae) up to three times the length of the cell body by the time of harvesting (not shown). Both the ethidium-stained gel and the actin-probed blot (Fig 2, bottom) show that there were roughly equal amounts of RNA in the preparations that were used to load each well.
The first three lanes of each blot show the response of wild-type cells to each growth condition. Since the time of incubation was 2 hr in Spider medium and only 1 hr in YPD + serum, the differences that are seen for some genes in amount of induction between the two conditions (lanes b and c) may derive from this time difference as well as the difference in media. Liquid growth conditions have not yet been described that can simulate the slow starvation on solid media produced by Spider agar, which reveals the lack of filamentous growth in the cph1
mutant. The induction conditions used in Fig 2 were therefore not designed to accentuate the cph1
phenotype, and none of the gene expression profiles show significant dependence on CPH1. Overall, most of the genes depended on EFG1 for activation and on TUP1 for repression, as was true of the filamentous cell morphology itself. However, there were significant exceptions to this rule, and even among the genes regulated by TUP1 and EFG1, there was surprising variation in the degree of response to deletions of these regulators, described in the next sections.
Dependence on TUP1:
Deletion of TUP1 caused derepression of most of the genes assayed. Since deletion of TUP1 causes hyphal growth, it was not surprising that many hyphal-specific genes were turned on in the mutant strain; however, the degree of derepression varied considerably from gene to gene. RBT4, for instance, was induced by filament-inducing growth conditions in wild-type cells, but this regulation was lost in strains carrying a deletion of TUP1 and the gene was fully expressed under all growth conditions. In contrast, HYR1 was only mildly derepressed in the tup1 deletion strain when grown on YPD and retained substantial induction in response to Spider and serum media.
A different type of profile was observed for the ECE1, ALS1, and HWP1 genes. Deletion of TUP1 caused constitutive expression of these genes and abolished their environmental induction yet also reduced, sometimes severely, their final level of expression. This behavior probably indicates more complex regulatory control on filamentous growth than the simple direct action of the gene regulatory proteins discussed here. The intermediate expression level of these genes may be connected to the fact that the filamentous growth exhibited by tup1
cells in YPD is not as fully elongated and straight (i.e., "hyphal") as is possible in wild-type cells. Correspondingly, the hyphal-specific genes in these cells may not be fully induced. In addition, TUP1 may regulate more than one pathway that impinges on filamentous growth.
Dependence on EFG1:
Many of the tested genes (HYR1, ALS1, ECE1, HWP1, RBT1, and RBT4) were heavily dependent on EFG1 for their full expression. This observation agrees with the phenotypic behavior of the efg1
cells, which showed no morphological response to either of these serum or Spider treatments (not shown; see ![]()
![]()
strain was due principally to activation through EFG1.
CHT2 is turned off, instead of on, in filamentous cells (Fig 2, compare lanes a, b, and c; ![]()
Unique induction behaviors of RBT5 and WAP1:
RBT5 and WAP1 are examples of genes whose serum- and Spider-induced expression is almost entirely independent of EFG1, as deletion of EFG1 or both EFG1 and CPH1 had only minor effects on their induction. These results indicate that even though the cph1
efg1
cells are morphologically unresponsive to serum and Spider induction under these conditions, at least one regulatory pathway remained intact. For RBT5, TUP1 may represent that pathway, since deletion of TUP1 caused both high expression and loss of most environmental responses. This result also implies the existence of a transcriptional activator of RBT5 that is distinct from CPH1 and EFG1. This activator may not be regulated, since TUP1 may represent the major pathway controlling induction of RBT5 expression.
WAP1 is affected in complex ways by the deletion of CPH1, EFG1, and TUP1, yet shows robust induction in the absence of all three genes (Fig 2, compare lanes ac with vx), indicating that WAP1 is induced by a pathway separate from EFG1, CPH1, and TUP1. This pathway may correlate with the fourth induction pathway deduced above from morphological criteria.
| DISCUSSION |
|---|
C. albicans cells deleted for the TUP1 transcriptional repressor show constitutive filamentous growth, and in this article we show that this filamentous growth depends on at least three separate activating pathways. Two of these pathways are represented by the CPH1 and EFG1 transcriptional activators, and the other appears to be novel. We also demonstrate that a group of hyphal-specific genes do not respond in unison to defects in these activating pathways, but rather the genes show diverse individual responses. Taken together with previous work, these results suggest a network of regulatory pathways through which different environmental signals induce filamentous growth by activating different combinations of downstream genes.
EFG1 appears to represent the major activating pathway that drives filamentous growth in a tup1
strain of C. albicans. CPH1 plays a lesser role in activating filamentous growth, as does a fourth pathway whose existence was suggested when the known pathways represented by EFG1, TUP1, and CPH1 were all deleted and the cells still exhibited filamentous growth. Since this fourth pathway was arrived at by deduction, it may represent one or more distinct pathways. Several new genes involved in regulating filamentous growth were described while our work was in progress. These genes, including INT1 (![]()
![]()
![]()
![]()
Insights into TUP1 regulation:
One question addressed by this work concerns whether TUP1 repression is regulated as part of normal filamentous growth control or whether TUP1 happens to repress filament-specific genes for other reasons. Several lines of argument suggest that TUP1 directly regulates filamentous growth. We show that a number of diverse genes correlated with filamentous growth appeared to be repressed by TUP1, and their regulation was consistent with a model where TUP1 repression of hyphal-specific genes is lifted in response to environmental conditions. However, the pattern of RBT5 expression argues most strongly for hyphal-specific repression by TUP1, since its induction was normal in the efg1
, cph1
background, yet most induction was lost when TUP1 was deleted (Fig 2, lanes sx). The simplest model for this behavior is that RBT5 is regulated through the specific lifting of TUP1 repression (as opposed to activation by EFG1 or CPH1), and therefore TUP1 repression appears at least in some cases to be regulated by the environmental conditions that induce filamentous growth. By analogy with the situation in S. cerevisiae, we imagine that the local lifting of repression is due to the inactivation (or some other form of regulation) of the DNA-binding protein that brings Tup1p-containing repression complex to the RBT5 upstream regulatory region.
The work in this article also shows that TUP1 is not used exclusively to regulate filamentous growth in C. albicans. RBT2 is strongly repressed by TUP1, but not induced during filamentous growth. Indeed the fact that RBT2 remained repressed during filamentous growth serves to show that TUP1 itself is not inactivated to regulate the transition to filamentous growth. Work on the closely related S. cerevisiae TUP1 gene has shown that several entirely separate regulatory pathways use Tup1p to repress their target genes (![]()
![]()
![]()
![]()
![]()
Epistasis:
EFG1, CPH1, and TUP1 each had independent effects on filamentous growth, regardless of the state of the other genes. The simplest explanation for this observation and the inference of an additional (fourth) pathway activating filamentous growth is that at least four different regulatory inputs contribute to filamentous growth in C. albicans (also see ![]()
![]()
![]()
![]()
Central vs. network control:
Finally, our results shed some light on how these regulatory pathways may control filamentous growth. In Fig 3 we diagram two models, termed central control and network control, for the regulation of genes induced during filamentous growth. The central control model posits a master regulator that integrates signals from upstream pathways and provides a single output that controls filamentous growth. Binary regulatory decisions such as IME1-activated sporulation in S. cerevisiae (![]()
(cI; ![]()
![]()
The network model, on the other hand, proposes no distinct integrating step but rather a network of connections between regulatory pathways and downstream genes. The decisions made are not binary but are qualitatively varied (i.e., which downstream genes are expressed) and quantitatively calibrated (i.e., what are their levels of expression?) in response to the nature of the stimulation. Regulation of catabolic gene expression in yeast and other organisms is an example of this form of regulation. Many different signaling inputs indicate the available nutrients, and interrelated sets of circuits determine the amount and type of resources the cell devotes to food uptake (![]()
![]()
![]()
The results described in this article show that genes turned on during filamentous growth do not respond to a central regulator. Rather, they respond individually to various pathways (at least four) that regulate filamentous growth, suggesting strongly that a network of signaling pathways and transcriptional regulators extends down to target genes without an intervening central level of regulation. Two recent reviews of C. albicans morphology have taken a similar view (![]()
![]()
The fact that EFG1, CPH1, and TUP1 all encode transcription regulators also supports a model of direct regulatory control. We think it likely that dissection of the upstream regions of these target genes will reveal distinct DNA binding sites related to each of these pathways, thereby explaining much of the observed regulatory behavior.
| ACKNOWLEDGMENTS |
|---|
We thank G. Fink and colleagues (MIT) for providing the cph1 strain and the Reichardt and O'Farrell laboratories (UCSF) for microscope facilities. This work was supported by a postdoctoral fellowship from the California division of the American Cancer Society (to B.R.B.) and grant GM-37049 from the National Institutes of Health (to A.D.J.).
Manuscript received June 24, 1999; Accepted for publication January 20, 2000.
| LITERATURE CITED |
|---|
AUSUBEL, F. M., R. BRENT, R. E. KINGSTON, D. D. MOORE, J. G. SEIDMAN et al. (Editors), 1992 Current Protocols in Molecular Biology. Greene Publishing Associates and Wiley-Interscience, New York.
BAILEY, D. A., P. J. FELDMANN, M. BOVEY, N. A. GOW, and A. J. BROWN, 1996 The Candida albicans HYR1 gene, which is activated in response to hyphal development, belongs to a gene family encoding yeast cell wall proteins. J. Bacteriol. 178:5353-5360
BIRSE, C. E., M. Y. IRWIN, W. A. FONZI, and P. S. SYPHERD, 1993 Cloning and characterization of ECE1, a gene expressed in association with cell elongation of the dimorphic pathogen Candida albicans. Infect. Immun. 61:3648-3655
BRAUN, B. R. and A. D. JOHNSON, 1997 Control of filament formation in Candida albicans by the transcriptional repressor TUP1. Science 277:105-109. [see comments]
BROACH, J. R., J. R. PRINGLE and E. W. JONES, 1991 The Molecular and Cellular Biology of the Yeast Saccharomyces cerevisiae. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
BROWN, A. J. and N. A. GOW, 1999 Regulatory networks controlling Candida albicans morphogenesis. Trends Microbiol. 7:333-338[Medline].
CHURCH, G. M. and W. GILBERT, 1984 Genomic sequencing. Proc. Natl. Acad. Sci. USA 81:1991-1995
CLINE, T. W. and B. J. MEYER, 1996 Vive la difference: males vs females in flies vs worms. Annu. Rev. Genet. 30:637-702[Medline].
CONNOLLY, L., A. DE LAS PENAS, B. M. ALBA, and C. A. GROSS, 1997 The response to extracytoplasmic stress in Escherichia coli is controlled by partially overlapping pathways. Genes Dev. 11:2012-2021
CSANK, C., C. MAKRIS, S. MELOCHE, K. SCHRÖPPEL, and M. RÖLLINGHOFF et al., 1997 Derepressed hyphal growth and reduced virulence in a VH1 family-related protein phosphatase mutant of the human pathogen Candida albicans. Mol. Biol. Cell 8:2539-2551
CSANK, C., K. SCHROPPEL, E. LEBERER, D. HARCUS, and O. MOHAMED et al., 1998 Roles of the Candida albicans mitogen-activated protein kinase homolog, Cek1p, in hyphal development and systemic candidiasis. Infect. Immun. 66:2713-2721
DECKERT, J., R. PERINI, B. BALASUBRAMANIAN, and R. ZITOMER, 1995 Multiple elements and auto-repression regulate Rox1, a repressor of hypoxic genes in Saccharomyces cerevisiae. Genetics 139:1149-1158[Abstract].
DUTTON, S. and C. W. PENN, 1989 Biological attributes of colony-type variants of Candida albicans. J. Gen. Microbiol. 135:3363-3372[Medline].
FENG, Q., E. SUMMERS, B. GUO, and G. FINK, 1999 Ras signaling is required for serum-induced hyphal differentiation in Candida albicans. J. Bacteriol. 181:6339-6346
FIDEL, P. L. J. and J. D. SOBEL, 1996 Immunopathogenesis of recurrent vulvovaginal candidiasis. Clin. Microbiol. Rev. 9:335-348[Abstract].
FONZI, W. A. and M. Y. IRWIN, 1993 Isogenic strain construction and gene mapping in Candida albicans. Genetics 134:717-728[Abstract].
FRIESEN, H., S. R. HEPWORTH, and J. SEGALL, 1997 An Ssn6-Tup1-dependent negative regulatory element controls sporulation-specific expression of DIT1 and DIT2 in Saccharomyces cerevisiae. Mol. Cell. Biol. 17:123-134[Abstract].
GALE, C. A., C. M. BENDEL, M. MCCLELLAN, M. HAUSER, and J. M. BECKER et al., 1998 Linkage of adhesion, filamentous growth, and virulence in Candida albicans to a single gene, INT1. Science 279:1355-1358
GANCEDO, J. M., 1998 Yeast carbon catabolite repression. Microbiol. Mol. Biol. Rev. 62:334-361
GIETZ, R. D., R. H. SCHIESTL, A. R. WILLEMS, and R. A. WOODS, 1995 Studies on the transformation of intact yeast cells by the LiAc/SS-DNA/PEG procedure. Yeast 11:355-360[Medline].
GOW, N. A., 1997 Germ tube growth of Candida albicans. Curr. Top. Med. Mycol. 8:43-55[Medline].
GUTHRIE, C., and G. R. FINK, 1991 Guide to Yeast Genetics and Molecular Biology. Academic Press, San Diego.
HOYER, L. L., S. SCHERER, A. R. SHATZMAN, and G. P. LIVI, 1995 Candida albicans ALS1: domains related to a Saccharomyces cerevisiae sexual agglutinin separated by a repeating motif. Mol. Microbiol. 15:39-54[Medline].
HUANG, M., Z. ZHOU, and S. J. ELLEDGE, 1998 The DNA replication and damage checkpoint pathways induce transcription by inhibition of the Crt1 repressor. Cell 94:595-605[Medline].
ISHII, N., M. YAMAMOTO, F. YOSHIHARA, M. ARISAWA, and Y. AOKI, 1997 Biochemical and genetic characterization of Rbf1p, a putative transcription factor of Candida albicans. Microbiology 143:429-435[Abstract].
KELEHER, C. A., M. J. REDD, J. SCHULTZ, M. CARLSON, and A. D. JOHNSON, 1992 Ssn6-Tup1 is a general repressor of transcription in yeast. Cell 68:709-719[Medline].
KOBAYASHI, S. D. and J. E. CUTLER, 1998 Candida albicans hyphal formation and virulence: is there a clearly defined role? Trends Microbiol. 6:92-94[Medline].
KÖHLER, J. R. and G. R. FINK, 1996 Candida albicans strains heterozygous and homozygous for mutations in mitogen-activated protein kinase signaling components have defects in hyphal development. Proc. Natl. Acad. Sci. USA 93:13223-13228
KOMACHI, K., M. J. REDD, and A. D. JOHNSON, 1994 The WD repeats of Tup1 interact with the homeo domain protein alpha 2. Genes Dev. 8:2857-2867
KUPIEC, M., B. BYERS, R. E. ESPOSITO and A. P. MITCHELL, 1997 Meiosis and sporulation in Saccharomyces cerevisiae, pp. 8891036 in The Molecular and Cellular Biology of the Yeast Saccharomyces cerevisiae, Vol. 3, edited by J. R. BROACH, J. R. PRINGLE and E. W. JONES. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
LEBERER, E., D. HARCUS, I. D. BROADBENT, K. L. CLARK, and D. DIGNARD et al., 1996 Signal transduction through homologues of the Ste20p and Ste7p protein kinases can trigger hyphal formation in the pathogenic fungus Candida albicans.. Proc. Natl. Acad. Sci. USA 93:13217-13222
LIU, H., J. KOHLER, and G. R. FINK, 1994 Suppression of hyphal formation in Candida albicans by mutation of a STE12 homolog. Science 266:1723-1726
LO, H. J., J. R. KOHLER, B. DIDOMENICO, D. LOEBENBERG, and A. CACCIAPUOTI et al., 1997 Nonfilamentous C. albicans mutants are avirulent. Cell 90:939-949[Medline].
LOEB, J. D., M. SEPULVEDA-BECERRA, I. HAZAN, and H. LIU, 1999 A G1 cyclin is necessary for maintenance of filamentous growth in Candida albicans. Mol. Cell. Biol. 19:4019-4027
LOSBERGER, C. and J. F. ERNST, 1989 Sequence of the Candida albicans gene encoding actin. Nucleic Acids Res. 17:9488
MADHANI, H. D. and G. R. FINK, 1998 The control of filamentous differentiation and virulence in fungi. Trends Cell Biol. 8:348-353, a [in process citation][Medline].
MADHANI, H. D. and G. R. FINK, 1998b The riddle of MAP kinase signaling specificity. Trends Genet. 14:151-155[Medline].
MCCREATH, K. J., C. A. SPECHT, and P. W. ROBBINS, 1995 Molecular cloning and characterization of chitinase genes from Candida albicans. Proc. Natl. Acad. Sci. USA 92:2544-2548
MITCHELL, A. P., 1998 Dimorphism and virulence in Candida albicans. Curr. Opin. Microbiol. 1:687-692[Medline].
ODDS, F. C., 1988 Candida and Candidosis. Baillière Tindall, London.
ODDS, F. C., 1994 Candida species and virulence. ASM News 60:313-318.
PEREZ-MARTIN, J., J. A. URIA, and A. D. JOHNSON, 1999 Phenotypic switching in Candida albicans is controlled by a SIR2 gene. EMBO J. 18:2580-2592[Medline].
PESTI, M., M. SIPICZKI, and Y. PINTER, 1999 Scanning electron microscopy characterisation of colonies of Candida albicans morphological mutants. J. Med. Microbiol. 48:167-172[Abstract].
PROFT, M. and R. SERRANO, 1999 Repressors and upstream repressing sequences of the stress-regulated ENA1 gene in saccharomyces cerevisiae: bZIP protein sko1p confers HOG-dependent osmotic regulation. Mol. Cell. Biol. 19:537-546. [in process citation]
PTASHNE, M., 1992 A Genetic Switch: Phage [Lambda] and Higher Organisms. Cell Press/Blackwell Scientific Publications, Cambridge, MA.
RIGGLE, P. J., K. A. ANDRUTIS, X. CHEN, S. R. TZIPORI, and C. A. KUMAMOTO, 1999 Invasive lesions containing filamentous forms produced by a Candida albicans mutant that is defective in filamentous growth in culture. Infect. Immun. 67:3649-3652
RUIS, H. and C. SCHULLER, 1995 Stress signaling in yeast. Bioessays 17:959-965[Medline].
SENTANDREU, M., M. V. ELORZA, R. SENTANDREU, and W. A. FONZI, 1998 Cloning and characterization of PRA1, a gene encoding a novel pH-regulated antigen of Candida albicans. J. Bacteriol. 180:282-289
SHARKEY, L. L., M. D. MCNEMAR, S. M. SAPORITO-IRWIN, P. S. SYPHERD, and W. A. FONZI, 1999 HWP1 functions in the morphological development of Candida albicans downstream of EFG1, TUP1, and RBF1. J. Bacteriol. 181:5273-5279
SLUTSKY, B., J. BUFFO, and D. R. SOLL, 1985 High-frequency switching of colony morphology in Candida albicans. Science 230:666-669
STAAB, J. F., C. A. FERRER, and P. SUNDSTROM, 1996 Developmental expression of a tandemly repeated, proline-and glutamine- rich amino acid motif on hyphal surfaces on Candida albicans. J. Biol. Chem. 271:6298-6305
STOLDT, V. R., A. SONNEBORN, C. E. LEUKER, and J. F. ERNST, 1997 Efg1p, an essential regulator of morphogenesis of the human pathogen Candida albicans, is a member of a conserved class of bHLH proteins regulating morphogenetic processes in fungi. EMBO J. 16:1982-1991[Medline].
TREITEL, M. A., S. KUCHIN, and M. CARLSON, 1998 Snf1 protein kinase regulates phosphorylation of the mig1 repressor in saccharomyces cerevisiae. Mol. Cell. Biol. 18:6273-6280. [in process citation]
VARANASI, U. S., M. KLIS, P. B. MIKESELL, and R. J. TRUMBLY, 1996 The Cyc8 (Ssn6)-Tup1 corepressor complex is composed of one Cyc8 and four Tup1 subunits. Mol. Cell. Biol. 16:6707-6714[Abstract].
VIVIER, M. A., M. G. LAMBRECHTS, and I. S. PRETORIUS, 1997 Coregulation of starch degradation and dimorphism in the yeast Saccharomyces cerevisiae. Crit. Rev. Biochem. Mol. Biol. 32:405-435[Medline].
This article has been cited by other articles:
![]() |
M. Banerjee, D. S. Thompson, A. Lazzell, P. L. Carlisle, C. Pierce, C. Monteagudo, J. L. Lopez-Ribot, and D. Kadosh UME6, a Novel Filament-specific Regulator of Candida albicans Hyphal Extension and Virulence Mol. Biol. Cell, April 1, 2008; 19(4): 1354 - 1365. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Zhao, R. Mehrabi, and J.-R. Xu Mitogen-Activated Protein Kinase Pathways and Fungal Pathogenesis Eukaryot. Cell, October 1, 2007; 6(10): 1701 - 1714. [Full Text] [PDF] |
||||
![]() |
J. Bauer and J. Wendland Candida albicans Sfl1 Suppresses Flocculation and Filamentation Eukaryot. Cell, October 1, 2007; 6(10): 1736 - 1744. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. R. Borneman, T. A. Gianoulis, Z. D. Zhang, H. Yu, J. Rozowsky, M. R. Seringhaus, L. Y. Wang, M. Gerstein, and M. Snyder Divergence of Transcription Factor Binding Sites Across Related Yeast Species Science, August 10, 2007; 317(5839): 815 - 819. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Biswas, P. Van Dijck, and A. Datta Environmental Sensing and Signal Transduction Pathways Regulating Morphopathogenic Determinants of Candida albicans Microbiol. Mol. Biol. Rev., June 1, 2007; 71(2): 348 - 376. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Argimon, J. A. Wishart, R. Leng, S. Macaskill, A. Mavor, T. Alexandris, S. Nicholls, A. W. Knight, B. Enjalbert, R. Walmsley, et al. Developmental Regulation of an Adhesin Gene during Cellular Morphogenesis in the Fungal Pathogen Candida albicans Eukaryot. Cell, April 1, 2007; 6(4): 682 - 692. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kim, M. J. Wolyniak, J. F. Staab, and P. Sundstrom A 368-Base-Pair cis-Acting HWP1 Promoter Region, HCR, of Candida albicans Confers Hypha-Specific Gene Regulation and Binds Architectural Transcription Factors Nhp6 and Gcf1p Eukaryot. Cell, April 1, 2007; 6(4): 693 - 709. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. P. Saville, A. L. Lazzell, A. P. Bryant, A. Fretzen, A. Monreal, E. O. Solberg, C. Monteagudo, J. L. Lopez-Ribot, and G. T. Milne Inhibition of filamentation can be used to treat disseminated candidiasis. Antimicrob. Agents Chemother., October 1, 2006; 50(10): 3312 - 3316. [Abstract] [Full Text] [PDF] |