- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Hallsson, J. H.
- Articles by Steingrímsson, E.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Hallsson, J. H.
- Articles by Steingrímsson, E.
Genomic, Transcriptional and Mutational Analysis of the Mouse microphthalmia Locus
Jón H. Hallssona, Jack Favorb, Colin Hodgkinsonc, Tom Glaserc, M. Lynn Lamoreuxd, Rannveig Magnúsdóttira, Gunnar J. Gunnarssona, Hope O. Sweete, Neal G. Copelandf, Nancy A. Jenkinsf, and Eiríkur Steingrímssonaa Department of Biochemistry and Molecular Biology, School of Medicine, University of Iceland, 101 Reykjavík, Iceland,
b GSF-Institute of Mammalian Genetics, D-85764 Neuherberg, Germany,
c Howard Hughes Medical Institute, University of Michigan, Ann Arbor, Michigan 48109,
d Department of Veterinary Pathobiology, College of Veterinary Medicine, Texas A&M University, College Station, Texas 77843,
e The Jackson Laboratory, Bar Harbor, Maine 04609
f Mouse Cancer Genetics Program, National Cancer Institute, Frederick Cancer Research and Development Center, Frederick, Maryland 21702
Corresponding author: Eiríkur Steingrímsson, Department of Biochemistry and Molecular Biology, School of Medicine, University of Iceland, Vatnsmyrarvegur 16, 101 Reykjavík, Iceland., eirikurs{at}hi.is (E-mail)
Communicating editor: C. KOZAK
| ABSTRACT |
|---|
Mouse microphthalmia transcription factor (Mitf) mutations affect the development of four cell types: melanocytes, mast cells, osteoclasts, and pigmented epithelial cells of the eye. The mutations are phenotypically diverse and can be arranged in an allelic series. In humans, MITF mutations cause Waardenburg syndrome type 2A (WS2A) and Tietz syndrome, autosomal dominant disorders resulting in deafness and hypopigmentation. Mitf mice thus represent an important model system for the study of human disease. Here we report the complete exon/intron structure of the mouse Mitf gene and show it to be similar to the human gene. We also found that the mouse gene is transcriptionally complex and is capable of generating at least 13 different Mitf isoforms. Some of these isoforms are missing important functional domains of the protein, suggesting that they might play an inhibitory role in Mitf function and signal transduction. In addition, we determined the molecular basis for six microphthalmia mutations. Two of the mutations are reported for the first time here (Mitfmi-enu198 and Mitfmi-x39), while the others (Mitfmi-ws, Mitfmi-bws, Mitfmi-ew, and Mitfmi-di) have been described but the molecular basis for the mutation not determined. When analyzed in terms of the genomic and transcriptional data presented here, it is apparent that these mutations result from RNA processing or transcriptional defects. Interestingly, three of the mutations (Mitfmi-x39, Mitfmi-bws, and Mitfmi-ws) produce proteins that are missing important functional domains of the protein identified in in vitro studies, further confirming a biological role for these domains in the whole animal.
THE development of several cell types is affected by microphthalmia transcription factor (Mitf) mutations. Common to all the mutations are defects in neural-crest-derived melanocytes, manifested by a lack of pigment in the coat, eye, and inner ear. Most mutations also produce mast cell defects in addition to defects in pigmented epithelial cells, which results in abnormal eye development. A few of the mutations also induce osteoclast defects. Approximately half of the mutations are semidominantly inherited and show white spotting and/or coat color dilution when heterozygous with wild type. The remaining mutations are classified as recessive since they only exhibit a coat color phenotype in the homozygous condition or, like the Mitfmi-sp mutation, only in combination with another mutation at the locus (reviewed by ![]()
Mitf is a member of the Tfe3, Tfeb and Tfec basic-helix-loop-helix-leucine zipper (bHLH-Zip) transcription factor subfamily (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
The molecular and biochemical defects associated with many different Mitf alleles have been described (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Here we describe the genomic structure and transcriptional profile of the mouse Mitf gene as well as the molecular defects associated with six mutations at the locus. These studies have uncovered the existence of a number of previously unrecognized Mitf isoforms and helped to confirm the in vivo importance of functional domains of the protein identified by in vitro experiments. We also show that the Mitfmi-di mutation and the previously characterized Mitfmi-ce mutation (![]()
| MATERIALS AND METHODS |
|---|
Mice:
The Mitfmi-enu198 mutation was recovered in the offspring of a (102 x C3H) F1 mouse exposed to 250 mg ethylnitrosourea (ENU)/kg body weight. Mitfmi-x39 was found in the offspring of (102 x C3H) F1 females exposed to 2 + 2 Gy gamma irradiation. Both mutations were shown to be allelic to Mitf by mating to previously characterized Mitf mutations [Mitfmi-enu122 (![]()
![]()
![]()
![]()
Northern and RNA RT-PCR analysis:
All RNA RT-PCR and sequence analysis was performed on poly(A)+ RNA isolated from heart. Total RNA was prepared from hearts of mutant and wild-type control mice using the RNAzol method (Tel-Test, Inc., Friendswood, TX). RNA was poly(A) selected once using the Pharmacia (Piscataway, NJ) mRNA purification kit. For Northern analysis, the RNA was electrophoresed and transferred to Zetabind membrane (Cuno, Meriden, CT) by standard methods. Hybridization and washes were performed as described (![]()
Primers used for the amplification of suspected splice region mutations were the following. For the Mitfmi-ew and Mitfmi-enu198 mutations, primers 5' CCTGTGAAATTGCTGGAATCACC 3' and 5' GGCTCAAGTCTCTGGGATCTGATG 3' were used. For the Mitfmi-bws mutation, primers 1-40, 5' GCTAGAATACAGTCACTACCAG 3', and 1-44, 5' CAGCAAGCTCAGAGGCACCAG 3', were used. For Mitfmi-ce, DBA/2N, or Mitfmi-di, primers 5' TCTGCACAATGTCTCCACCTTATG 3' and 5' TTGGGCAAAGAGCTGCAAGC 3' were used to amplify a 602-bp fragment from each genotype, which was then sequenced directly. Products containing exons 1a and 6a were amplified using primers kid3Arev, 5' CAAAAGTCAACCTCTGAAGAGC 3', and 1-23, 5' GGACAATCACAACTTGATTGAACGAAG 3'. Products containing exons 1h and 6a were amplified using primers 1-26, 5' GATGGAGGCGCTTAGATTTTGAG 3', and 1-28, 5' CGAAGAAGAAGATTTAACATAAAC 3'.
Genomic structure analysis:
To analyze the genomic structure of the Mitf locus, the ~100-kb BAC clone 369C11, which contains most of the Mitf gene (E. STEINGRÍMSSON, unpublished results), was sequenced using primers designed to span through exon-intron boundaries. Since the most 5' exons are not contained within this BAC clone, genome walking was used to generate fragments containing these exon-intron junctions. Briefly, mouse genomic DNA was digested with BstYI and then ligated to adaptors R12/R24, which can be ligated to the BstYI overhang. PCR was then performed using exon-specific primers against a primer specific for the adaptor. The resulting products were sequenced directly. For Southern analysis, genomic DNAs were isolated from the spleens of wild-type and mutant mice and the DNA analyzed by restriction enzyme digestion, gel electrophoresis, and Southern transfer as described (![]()
![]()
![]()
| RESULTS |
|---|
Mitf genomic structure:
The exon/intron organization of the mouse Mitf gene was determined largely by sequencing across exon/intron junctions of BAC clone 369C11. To determine the structure of the 5' end of the Mitf gene, which is missing from the BAC clone, genomic walking and sequencing of genomic DNA was used (Fig 1A). Exon/intron junction sequences are listed in Table 1. The exon/intron organization of the mouse gene is very similar to the human gene and the exons are numbered accordingly (![]()
|
|
The mouse Mitf gene is large and covers over 50 kb. Exon 9 contains the last coding nucleotides of Mitf. The published Mitf cDNA sequence is <2 kb long while the two major transcripts are 5.5 and 5.7 kb in size, as determined by Northern analysis (![]()
![]()
![]()
Most of the exon/intron junctions conform to the consensus splice sequence (![]()
Mitfmi-rw deletional analysis positions exon 1h downstream of exon 1a:
Due to the large intronic distances in the 5' end of the Mitf gene, it was not possible to orient exons 1a and 1h relative to each other. However, this was achieved through deletional analysis of the Mitfmi-rw mutation. Southern analysis has shown that Mitfmi-rw results from a genomic deletion, which begins ~6 kb upstream of exon 1m and includes exons 1b and 1h (Fig 1A) (![]()
![]()
![]()
Alternative Mitf splice products:
Several alternate Mitf splice products have been described and characterized (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
A number of alternatively used 5' exons have also been identified: exon 1m, which is melanocyte specific, and exons 1a and 1h, which are more widely expressed (![]()
![]()
RNA RT-PCR amplification, cloning, and sequencing of Mitf cDNAs from heart, using upstream PCR primers from exons 1a or 1h and downstream primers from exon 7, identified several additional rare alternative Mitf splice products (Fig 1C). Among the splice products are clones containing exon 1a or 1h, but lacking exon 1b, showing that this exon is alternatively spliced. We also isolated clones that were missing all of exon 2 as well as clones missing only the last 168 nucleotides of exon 2 (exon 2b, Fig 1C). Since the genomic sequence is not interrupted in this region, the shorter product must be due to the use of an alternative splice donor site. The sequence in this region, 221AG/GTAAA227 (numbering according to ![]()
![]()
While the biochemical nature of these products has not been characterized, nor their presence in other tissues verified, the existence of these alternative splice products suggests that Mitf proteins are expressed in the cells that lack both the activation domain and serine73 phosphorylation site implicated in mitogen-activated protein kinase activation. Most interestingly, our studies also suggest the existence of a rare Mitf protein missing the basic region, in addition to the activation and serine73 phosphorylation domain. This form of Mitf is reminiscent of Id, a HLH protein lacking a basic domain and acting as a negative regulator of bHLH proteins (![]()
Most of the alternative Mitf transcripts listed in Fig 1C, regardless of whether they were initiated in exon 1a or 1h, were isolated in two forms: one that contained exon 6a and one that did not. This is in contrast to a previous report by ![]()
Two new Mitf alleles:
The importance of Mitf functional domains identified in vitro to Mitf biological activity in vivo was further addressed by determining the molecular basis of six Mitf alleles. The molecular basis of these six mutations has not been previously reported. These results were correlated with the genomic and transcriptional data presented here as well as the phenotypic data available for each mutation. Two of the six Mitf alleles, Mitfmi-enu198 and Mitfmi-x39, are recent mutations and have not previously been reported. The phenotypes of these mutations, as well as the other Mitf mutations discussed in this article, are summarized in Table 2. The Mitfmi-enu198 and Mitfmi-x39 mutations were recovered in the offspring of mice exposed to ENU or
-irradiation, respectively. Heterozygotes for both mutations have slightly reduced retinal pigmentation as measured by slit-lamp biomicroscopy (data not shown). In addition, Mitfmi-x39 heterozygotes express a white belly spot. In the homozygous condition, the phenotypes also differ: Mitfmi-enu198 homozygotes have a white coat and minor microphthalmia, while Mitfmi-x39 homozygotes have a white coat with pigmented patches and near normal-sized eyes (Fig 2 and Table 2). The Mitfmi-x39 mutation is classified as a semidominant mutation with respect to coat color while Mitfmi-enu198 is recessive. This suggests that Mitfmi-x39 encodes a dominant-negative protein, at least in melanocytes.
|
|
RT-PCR experiments generated two different-sized bands from Mitfmi-x39 RNA. One band was 96 nucleotides shorter than the band amplified from wild-type RNA while the other was 180 nucleotides shorter (Fig 3A). Sequencing studies showed that the larger transcript is missing exon 4, while the shorter transcript is missing exons 3 and 4 of the Mitf message. Both are in-frame deletions and both encode proteins lacking a transactivation domain (Fig 1A) (![]()
|
RT-PCR experiments also generated two different-sized bands from Mitfmi-enu198 RNA. One band was the same size as the wild-type band while the other was 75 bp shorter (Fig 3A). Sequencing studies showed that the wild-type-sized band contained an A-to-G transition at position 749 of the cDNA. This alteration is located 15 nucleotides upstream from the exon 6/exon 7 splice junction and results in an Asp207Gly substitution in the DNA-binding domain of the protein (Fig 3B). The shorter transcript is lacking the basic domain altogether. No alterations were found in the exon 6/exon7 splice sites in Mitfmi-enu198 genomic DNA (data not shown), suggesting that the A-to-G transition is responsible for exon skipping. A number of examples of exon skipping caused by mutations in exon sequences have been reported (![]()
The effects of the Asp207Gly substitution on Mitf function are difficult to predict. This position is not well conserved among bHLH-Zip proteins, although most proteins have charged residues at this position. Like Mitf, the Tfe3, Tfec, and Tfeb proteins all have aspartate at this position, suggesting a functional importance in this subfamily. In the crystal structures of MAX and upstream stimulatory factor (USF), the corresponding amino acid alanine faces away from the DNA and into solution (![]()
![]()
The Mitfmi-ew mutation affects splicing of exon 6:
Previous studies have shown that Mitfmi-ew mice express normal levels of an Mitf message that is missing exon 6, just like the Mitfmi-enu198 deletion (Fig 3A) (![]()
![]()
The Mitfmi-x39 and Mitfmi-ws deletions overlap:
Southern analysis has shown that the Mitfmi-ws mutation results from a genomic deletion that removes exons 2, 3, and 4 (![]()
Mitfmi-bws mice also carry an exon 2 deletion:
Northern analysis failed to identify any Mitf expression differences between Mitfmi-bws and wild-type mice (data not shown). However, RT-PCR amplification showed that Mitfmi-bws mice express two different-sized Mitf transcripts: One is wild type in size while the other is 168 bp shorter (Fig 3A). Sequencing of the shorter transcript showed that it is missing exon 2b. A transition of G to A, not found in the strain of origin, was identified 12 nucleotides upstream of the exon 2a splice acceptor site (Fig 3C). Upstream mutations that result in partial exon skipping have been reported previously, including in the human autosomal dominant disorder congenital contractural arachnodactyly (![]()
The Mitfmi-di mutation is identical to the previously reported Mitfmi-ce mutation:
The Mitfmi-di mutation arose in a cross between a PT female and an ENU-treated C3H/HeH male (![]()
![]()
Northern analysis showed that Mitfmi-di mice express normal levels of Mitf message (data not shown). However, RT-PCR amplification and sequencing studies showed that this message carries a C-to-T transition in exon 8 at position 916 of the cDNA, which introduces a premature stop codon between the HLH and leucine zipper domains. Surprisingly, this mutation is identical to the mutation reported previously for Mitfmi-ce (![]()
![]()
The similarity in molecular defect is consistent with the similar phenotypes described for these two mutations. Like Mitfmi-di homozygotes, Mitfmi-ce homozygotes are white with reduced eye size and no eye pigment (![]()
![]()
![]()
| DISCUSSION |
|---|
Mitf mutant mice serve as an important model system for the study of two human deafness and hypopigmentation disorders, WS2A and Tietz syndrome (![]()
![]()
![]()
![]()
The genomic structure of Mitf is quite different from that reported for other bHLH-Zip genes. For example, while the bHLH-Zip domain of Mitf is interrupted by three introns, the bHLH-Zip domain of Myc is encoded by a single exon while the bHLH-Zip domains of Max and Usf1 are disrupted by one and two introns, respectively (![]()
![]()
![]()
![]()
![]()
While many functional domains of the Mitf protein have been identified by sequencing or in vitro studies, the biological function of a number of these domains has not been verified in vivo. Toward this goal, we have identified the functional domains affected by six mutations at the Mitf locus and then attempted to correlate these results with the phenotype of the mutations as well as the genomic and transcriptional data presented here.
Three of the mutations, Mitfmi-x39, Mitfmi-bws, and Mitfmi-ws, produce protein deletions that reveal important information about the functional domains of the protein. The Mitfmi-x39 mutation deletes the amphipathic helix located in exon 4, which is thought to be important for transcriptional activation by Mitf. The Mitfmi-bws mutant protein is missing the domain containing serine 73, which is phosphorylated in response to Mgf-signaling and leads to increased transcriptional activation of the Mitf protein. The Mitfmi-ws mutation deletes both the amphipathic helix and the serine 73 phosphorylation site. The heterozygous phenotypes of Mitfmi-x39 and Mitfmi-ws mice are similar in that both have white belly spots. Both mutations therefore appear to be acting as dominant-negative mutations as would be predicted from the nature of the two mutations. However, Mitfmi-ws mice also have white tails and toes (![]()
In contrast to the Mitfmi-x39 and Mitfmi-ws mutations, Mitfmi-bws animals do not show a phenotype in the heterozygous condition, indicating that the serine 73 deletion found in Mitfmi-bws mice does not produce a dominant-negative protein. While Mitfmi-bws mice have a coat color phenotype in the homozygous condition, consistent with a role for serine 73 phosphorylation in Mitf function in neural crest-derived skin melanocytes, eye development is more or less normal. Therefore, like the activation domain, serine 73 does not seem to be essential for Mitf function in the eye. These results are also consistent with other mutational studies, which suggest that the requirement for Mitf is considerably higher in neural crest-derived melanocytes than in the retinal pigment epithelium (![]()
Recently, ![]()
In vitro studies have shown that the Mitfmi-ew protein cannot bind DNA, yet can dimerize with wild-type Mitf protein or with other family members (![]()
![]()
A major difference between mouse and human MITF mutations is that loss-of-function mutations in the mouse are recessively inherited while loss-of-function mutations in humans are dominantly inherited (![]()
![]()
![]()
![]()
![]()
![]()
| ACKNOWLEDGMENTS |
|---|
We thank Joann Dietz, Fran Dorsey, and Steinunn G. Ástrádsdóttir for expert technical assistance and Scott Wilson for help with isolating the BAC clone. We also thank Hans G. Thormar and Jon J. Jonsson for the R12/R24 adaptors. This work was supported by the National Cancer Institute, Department of Health and Human Services, by the Icelandic Research Council, by Adstodarmannasjodur (J.H.H.) and partially by National Institutes of Health grant EY-10223 to M.L.L.
Manuscript received November 3, 1999; Accepted for publication January 12, 2000.
| LITERATURE CITED |
|---|
AMAE, S., N. FUSE, K. YASUMOTO, S. SATO, and I. YAJIMA et al., 1998 Identification of a novel isoform of microphthalmia-associated transcription factor that is enriched in retinal pigment epithelium. Biochem. Biophys. Res. Commun. 247:710-715[Medline].
AMIEL, J., P. M. WATKIN, M. TASSABEHJI, A. P. READ, and R. M. WINTER, 1998 Mutation of the MITF gene in albinism-deafness syndrome (Tietz syndrome). Clin. Dysmorphol. 7:17-20[Medline].
ATCHLEY, W. R. and W. M. FITCH, 1997 A natural classification of the basic helix-loop-helix class of transcription factors. Proc. Natl. Acad. Sci. USA 94:5172-5176
BENEZRA, R., R. L. DAVIS, D. LOCKSHON, D. L. TURNER, and H. WEINTRAUB, 1990 The protein Id: a negative regulator of helix-loop-helix DNA binding proteins. Cell 61:49-59[Medline].
BENTLEY, N. J., T. EISEN, and C. R. GODING, 1994 Melanocyte-specific expression of the human tyrosinase promoter: activation by the microphthalmia gene product and role of the initiator. Mol. Cell. Biol. 14:7996-8006
BOUSSET, K., M. HENRIKSSON, J. M. LÜSCHER-FIRZLAFF, D. W. LITCHFIELD, and B. LÜSCHER, 1993 Identification of casein kinase II phosphorylation sites in Max: effects on DNA-binding kinetics of Max homo- and Myc/Max heterodimers. Oncogene 8:3211-3220[Medline].
CHURCH, G. M. and W. GILBERT, 1984 Genomic sequencing. Proc. Natl. Acad. Sci. USA 81:1991-1995
DEL GATTO, F., M. C. GESNEL, and R. BREATHNACH, 1996 The exon sequence TAGG can inhibit splicing. Nucleic Acids Res. 24:2017-2021
FERRÉ-D'AMARÉ, A. R., G. C. PRENDERGAST, E. B. ZIFF, and S. K. BURLEY, 1993 Recognition by Max of its cognate DNA through a dimeric b/HLH/Z domain. Nature 363:38-45[Medline].
FERRÉ-D'AMARÉ, A. R., P. POGNONEC, R. G. ROEDER, and S. K. BURLEY, 1994 Structure and function of the b/HLH/Z domain of USF. EMBO J. 13:180-189[Medline].
HEMESATH, T. J., E. STEINGRÍMSSON, G. MCGILL, M. J. HANSEN, and J. VAUGHT et al., 1994 microphthalmia, a critical factor in melanocyte development, defines a discrete transcription factor family. Genes Dev. 8:2770-2780
HEMESATH, T. J., E. R. PRICE, C. TAKEMOTO, T. BADALIAN, and D. E. FISHER, 1998 MAP kinase links the transcription factor Microphthalmia to c-Kit signalling in melanocytes. Nature 391:298-301[Medline].
HENRION, A. A., S. VAULONT, M. RAYMONDJEAN, and A. KAHN, 1996 Mouse USF1 gene cloning: comparative organization within the c-myc gene family. Mamm. Genome 7:803-809[Medline].
HODGKINSON, C. A., K. J. MOORE, A. NAKAYAMA, E. STEINGRÍMSSON, and N. G. COPELAND et al., 1993 Mutations at the mouse microphthalmia locus are associated with defects in a gene encoding a novel basic-helix-loop-helix-zipper protein. Cell 74:395-404[Medline].
HUGHES, M. J., J. B. LINGREL, J. M. KRAKOWSKY, and K. P. ANDERSON, 1993 A helix-loop-helix transcription factor-like gene is located at the mi locus. J. Biol. Chem. 268:20687-20690
JENKINS, N. A., N. G. COPELAND, B. A. TAYLOR, and B. K. LEE, 1982 Organization, distribution and stability of endogenous ecotropic murine leukemia virus DNA sequences in chromosomes of Mus musculus.. J. Virol. 43:26-36
KAYE, F., J. BATTEY, M. NAU, B. BROOKS, and E. SEIFTER et al., 1988 Structure and expression of the human L-myc gene reveal a complex pattern of alternative mRNA processing. Mol. Cell. Biol. 8:186-195
KRETZNER, L., E. M. BLACKWOOD, J. MAC and R. N. EISENMANN, 1993 Transcriptional repression by Max proteins p21 and p22, pp. 7582 in The Negative Regulation of Hematopoiesis, edited by M. GUIGON, F. LEMOINE and N. DAINIAK. Colloque INSERM/John Libbey Eurotext.
MASLEN, C., D. BABCOCK, M. RAGHUMATH, and B. STEINMANN, 1997 A rare branch-point mutation is associated with missplicing of fibrillin-2 in large family with congenital contractural arachnodactyly. Am. J. Hum. Genet. 60:1389-1398[Medline].
MILLER, D. S., 1963 Coat color and behavior mutations in inbred mice under chronic low-level g-irradiation. Radiat. Res. 19:184-185.
MINER, G., 1998 New microphthalmia mutant. Mouse News Lett. 38:25.
MOORE, K. J., 1995 Insight into the microphthalmia gene. Trends Genet. 11:442-448[Medline].
NEUHAUSER-KLAUS, A., A. SCHAFFER, and W. PRETSCH, 1987 Characterization of a newly recovered Mi mutation. Mouse News Letter 78:64.
OHSHIMA, Y. and Y. GOTOH, 1987 Signals for the selection of a splice site in pre-mRNA. Computer analysis of splice junction sequences and like sequences. J. Mol. Biol. 195:247-259[Medline].
READ, A. P. and V. E. NEWTON, 1997 Waardenburg Syndrome. J. Med. Genet. 34:656-665
ROMAN, C., L. COHN, and K. CALAME, 1991 A dominant negative form of transcription activator mTFE3 created by differential splicing. Science 254:94-97
STEINGRÍMSSON, E., K. J. MOORE, M. L. LAMOREUX, A. R. FERRÉ-D'AMARÉ, and S. K. BURLEY et al., 1994 Molecular basis of mouse microphthalmia (mi) mutations helps explain their developmental and phenotypic consequences. Nat. Genet. 8:256-263[Medline].
STEINGRÍMSSON, E., A. NII, D. E. FISHER, A. R. FERRÉ-D'AMARÉ, and R. J. MCCORMICK et al., 1996 The semidominant Mi-b mutation identifies a role for the HLH domain in DNA binding in addition to its role in protein dimerization. EMBO J. 15:6280-6289[Medline].
STEINGRÍMSSON, E., J. FAVOR, A. F. FERRÉ-D'AMARÉ, N. G. COPELAND, and N. A. JENKINS, 1998 Mitf mi-enu122 is a missense mutation in the HLH dimerization domain. Mamm. Genome 9:250-252[Medline].
TAKEBAYASHI, K., K. CHIDA, I. TSUKUMOTO, E. MORII, and H. MUNAKATA et al., 1996 The recessive phenotype displayed by a dominant negative mirophthalmia-associated transcription factor mutant is a result of impaired nuclear localization potential. Mol. Cell. Biol. 16:1203-1211[Abstract].
TASSABEHJI, M., V. E. NEWTON, and A. P. READ, 1994 Waardenburg syndrome type 2 caused by mutations in the human microphthalmia (MITF) gene. Nat. Genet. 8:251-255[Medline].
TASSABEHJI, M., V. E. NEWTON, X.-Z. LIU, A. BRADY, and D. DONNAI et al., 1995 The mutational spectrum in Waardenburg Syndrome. Hum. Mol. Genet. 4:2131-2137
VASTRIK, I., P. J. KOSKINEN, R. ALITALO, and T. P. MAKELA, 1993 Alternative mRNA forms and open reading frames of the max gene. Oncogene 8:503-507[Medline].
WEST, J. D., G. FISHER, J. F. LOUTIT, M. J. MARSHALL, and N. W. NISBET et al., 1985 A new allele of microphthalmia induced in the mouse: microphthalmia-defective iris (mi di). Genet. Res. 46:309-324[Medline].
WOOD, B. C. and G. MINER, 1969 Mutant report. Mouse News Lett. 40:32.
YAJIMA, I., S. SATO, T. KIMURA, K. YASUMOTO, and S. SHIBAHARA et al., 1999 An L1 element intronic insertion in the black-eyed white (Mitfmi-bw) gene: the loss of a single Mitf isoform responsible for the pigmentary defect and inner ear deafness. Hum. Mol. Genet. 8:1431-1441
YASUMOTO, K. and S. SHIBAHARA, 1997 Molecular cloning of a cDNA encoding a human TFEC isoform, a newly identified transcriptional regulator. Biochim. Biophys. Acta 1353:23-31[Medline].
YASUMOTO, K., K. YOKOYAMA, K. SHIBATA, Y. TOMITA, and S. SHIBAHARA, 1994 Microphthalmia-associated transcription factor as a regulator for melanocyte-specific transcription of the human tyrosinase gene. Mol. Cell. Biol. 14:8058-8070
YASUMOTO, K., S. AMAE, T. UDONO, N. FUSE, and K. TAKEDA et al., 1998 A big gene linked to small eyes encodes multiple Mitf isoforms: many promoters make light work. Pigment Cell Res. 11:329-336[Medline].
ZIMRING, D. C., M. L. LAMOREUX, N. J. MILLICHAMP, and L. C. SKOW, 1996 Microphthalmia cloudy-eye (mi(ce)): a new murine allele. J. Hered. 87:334-338
This article has been cited by other articles:
![]() |
O. Puk, J. Loster, C. Dalke, D. Soewarto, H. Fuchs, B. Budde, P. Nurnberg, E. Wolf, M. H. de Angelis, and J. Graw Mutation in a Novel Connexin-like Gene (Gjf1) in the Mouse Affects Early Lens Development and Causes a Variable Small-Eye Phenotype Invest. Ophthalmol. Vis. Sci., April 1, 2008; 49(4): 1525 - 1532. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Bharti, W. Liu, T. Csermely, S. Bertuzzi, and H. Arnheiter Alternative promoter use in eye development: the complex role and regulation of the transcription factor MITF Development, March 15, 2008; 135(6): 1169 - 1178. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Bismuth, S. Skuntz, J. H. Hallsson, E. Pak, A. S. Dutra, E. Steingrimsson, and H. Arnheiter An Unstable Targeted Allele of the Mouse Mitf Gene With a High Somatic and Germline Reversion Rate Genetics, January 1, 2008; 178(1): 259 - 272. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Hu, S. M. Sharma, A. Bronisz, R. Srinivasan, U. Sankar, and M. C. Ostrowski Eos, MITF, and PU.1 Recruit Corepressors to Osteoclast-Specific Genes in Committed Myeloid Progenitors Mol. Cell. Biol., June 1, 2007; 27(11): 4018 - 4027. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Tshori, A. Sonnenblick, N. Yannay-Cohen, G. Kay, H. Nechushtan, and E. Razin Microphthalmia Transcription Factor Isoforms in Mast Cells and the Heart Mol. Cell. Biol., June 1, 2007; 27(11): 3911 - 3919. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Esumi, S. Kachi, P. A. Campochiaro, and D. J. Zack VMD2 Promoter Requires Two Proximal E-box Sites for Its Activity in Vivo and Is Regulated by the MITF-TFE Family J. Biol. Chem., January 19, 2007; 282(3): 1838 - 1850. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Sonnenblick, C. Levy, and E. Razin Immunological Trigger of Mast Cells by Monomeric IgE: Effect on Microphthalmia Transcription Factor, STAT3 Network of Interactions J. Immunol., August 1, 2005; 175(3): 1450 - 1455. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Sonnenblick, C. Levy, and E. Razin Interplay between MITF, PIAS3, and STAT3 in Mast Cells and Melanocytes Mol. Cell. Biol., December 15, 2004; 24(24): 10584 - 10592. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Vetrini, A. Auricchio, J. Du, B. Angeletti, D. E. Fisher, A. Ballabio, and V. Marigo The Microphthalmia Transcription Factor (Mitf) Controls Expression of the Ocular Albinism Type 1 Gene: Link between Melanin Synthesis and Melanosome Biogenesis Mol. Cell. Biol., August 1, 2004; 24(15): 6550 - 6559. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. H. Hallsson, B. S. Haflidadottir, C. Stivers, W. Odenwald, H. Arnheiter, F. Pignoni, and E. Steingrimsson The Basic Helix-Loop-Helix Leucine Zipper Transcription Factor Mitf Is Conserved in Drosophila and Functions in Eye Development Genetics, May 1, 2004; 167(1): 233 - 241. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. P. Kuiper, M. Schepens, J. Thijssen, E. F. P. M. Schoenmakers, and A. G. van Kessel Regulation of the MiTF/TFE bHLH-LZ transcription factors through restricted spatial expression and alternative splicing of functional domains Nucleic Acids Res., April 26, 2004; 32(8): 2315 - 2322. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Levy, A. Sonnenblick, and E. Razin Role Played by Microphthalmia Transcription Factor Phosphorylation and Its Zip Domain in Its Transcriptional Inhibition by PIAS3 Mol. Cell. Biol., December 15, 2003; 23(24): 9073 - 9080. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Saito, K. Takeda, K.-i. Yasumoto, H. Ohtani, K.-i. Watanabe, K. Takahashi, A. Fukuzaki, Y. Arai, H. Yamamoto, and S. Shibahara Germ Cell-Specific Expression of Microphthalmia-Associated Transcription Factor mRNA in Mouse Testis J. Biochem., July 1, 2003; 134(1): 143 - 150. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Baumer, T. Marquardt, A. Stoykova, D. Spieler, D. Treichel, R. Ashery-Padan, and P. Gruss Retinal pigmented epithelium determination requires the redundant activities of Pax2 and Pax6 Development, July 1, 2003; 130(13): 2903 - 2915. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Graw, W. Pretsch, and J. Loster Mutation in Intron 6 of the Hamster Mitf Gene Leads to Skipping of the Subsequent Exon and Creates a Novel Animal Model for the Human Waardenburg Syndrome Type II Genetics, July 1, 2003; 164(3): 1035 - 1041. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Takemoto, Y.-J. Yoon, and D. E. Fisher The Identification and Functional Characterization of a Novel Mast Cell Isoform of the Microphthalmia-associated Transcription Factor J. Biol. Chem., August 9, 2002; 277(33): 30244 - 30252. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Altschmied, J. Delfgaauw, B. Wilde, J. Duschl, L. Bouneau, J.-N. Volff, and M. Schartl Subfunctionalization of Duplicate mitf Genes Associated With Differential Degeneration of Alternative Exons in Fish Genetics, May 1, 2002; 161(1): 259 - 267. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. C. Mansky, K. Marfatia, G. H. Purdom, A. Luchin, D. A. Hume, and M. C. Ostrowski The microphthalmia transcription factor (MITF) contains two N-terminal domains required for transactivation of osteoclast target promoters and rescue of mi mutant osteoclasts J. Leukoc. Biol., February 1, 2002; 71(2): 295 - 303. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. C. Mansky, S. Sulzbacher, G. Purdom, L. Nelsen, D. A. Hume, M. Rehli, and M. C. Ostrowski The microphthalmia transcription factor and the related helix-loop-helix zipper factors TFE-3 and TFE-C collaborate to activate the tartrate-resistant acid phosphatase promoter J. Leukoc. Biol., February 1, 2002; 71(2): 304 - 310. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. R. Goding Mitf from neural crest to melanoma: signal transduction and transcription in the melanocyte lineage Genes & Dev., July 15, 2000; 14(14): 1712 - 1728. [Full Text] |
||||
![]() |
A. Luchin, S. Suchting, T. Merson, T. J. Rosol, D. A. Hume, A. I. Cassady, and M. C. Ostrowski Genetic and Physical Interactions between Microphthalmia Transcription Factor and PU.1 Are Necessary for Osteoclast Gene Expression and Differentiation J. Biol. Chem., September 21, 2001; 276(39): 36703 - 36710. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Levy, H. Nechushtan, and E. Razin A New Role for the STAT3 Inhibitor, PIAS3. A REPRESSOR OF MICROPHTHALMIA TRANSCRIPTION FACTOR J. Biol. Chem., January 11, 2002; 277(3): 1962 - 1966. [Abstract] [Full Text] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Hallsson, J. H.
- Articles by Steingrímsson, E.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Hallsson, J. H.
- Articles by Steingrímsson, E.














