| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Corresponding author: Lucas Sánchez, Centro de Investigaciones Biológicas, Velázquez, 144, 28006 Madrid, Spain., lsanchez{at}cib.csic.es (E-mail)
Communicating editor: T. SCHÜPBACH
 | ABSTRACT |
|---|
 TOP ABSTRACT MATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
The Drosophila gene female-lethal(2)d [fl(2)d] interacts genetically with the master regulatory gene for sex determination, Sex-lethal. Both genes are required for the activation of female-specific patterns of alternative splicing on transformer and Sex-lethal pre-mRNAs. We have used P-element-mediated mutagenesis to identify the fl(2)d gene. The fl(2)d transcription unit generates two alternatively spliced mRNAs that can encode two protein isoforms differing at their amino terminus. The larger isoform contains a domain rich in histidine and glutamine but has no significant homology to proteins in databases. Several lines of evidence indicate that this protein is responsible for fl(2)d function. First, the P-element insertion that inactivates fl(2)d interrupts this ORF. Second, amino acid changes within this ORF have been identified in fl(2)d mutants, and the nature of the changes correlates with the severity of the mutations. Third, all of the phenotypes associated with fl(2)d mutations can be rescued by expression of this cDNA in transgenic flies. Fl(2)d protein can be detected in extracts from Drosophila cell lines, embryos, larvae, and adult animals, without apparent differences between sexes, as well as in adult ovaries. Consistent with a possible function in posttranscriptional regulation, Fl(2)d protein has nuclear localization and is enriched in nuclear extracts.
IN Drosophila melanogaster, the gene Sex-lethal (Sxl) controls the processes of sex determination, sexual behavior, and dosage compensation (the products of the X-linked genes are present in equal amounts in males and females). The control of Sxl expression throughout development occurs by sex-specific splicing of its transcripts. The male transcripts are similar to their female counterparts, except for the presence of an additional internal exon (exon 3), which contains a translation stop codon. Consequently, the male late transcripts give rise to presumably inactive truncated proteins. In females, this exon is spliced out and functional Sxl protein is produced (
The gene Sxl encodes an RNA binding protein that regulates its own RNA splicing by binding to poly-U stretches in introns 2 and 3 (
Sxl controls sex determination and sexual behavior by inducing the use of a female-specific 3' splice site in the first intron of transformer (tra) pre-mRNA. Use of the alternative, non-sex-specific 3' splice site results in a transcript that encodes a nonfunctional truncated protein, while use of the female-specific site allows the synthesis of full-length functional Tra polypeptide (
Activation of Sxl is also required for normal female germ cell development (
EMS-induced mutations in fl(2)d have revealed that the gene has a dual function. fl(2)d1 is a recessive temperature-sensitive mutation that has stronger effects in females than in males: no homozygous females survive at 28°, and those that survive at 18° are sterile; homozygous males are fertile at both temperatures. This female-specific function of fl(2)d is related to its requirement for female-specific splicing of the Sxl and tra pre-mRNAs, because fl(2)d homozygous female larvae express the set of Sxl transcripts characteristic of males (
| MATERIALS AND METHODS |
|---|
| TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
Fly strains:
Flies were cultured on standard food at 25° or 18°. For a description of the chromosomes and mutations see
Induction and genetic mapping of fl(2)dP mutation:
The fl(2)dP mutation was induced following standard genetic procedures by transposition of the pLAC92 element in flies that carry in addition the pP[ry+(
2-3)] element, which provides the transposase activity (
In situ hybridization to polytene chromosomes:
This was performed as described by
P-element-mediated germline transformation:
The fl(2)d cDNA coming from clone LD19472 (Berkeley Drosophila Genome Project, BDGP) was inserted into the P-element transformation vector pCaSpeR 4 containing a ß-tubulin promoter. Germline transformants were obtained by standard procedures (
Construction of genomic libraries, screening and analysis of positive clones, and accession numbers:
Total genomic DNA from flies was isolated according to
DNA sequencing:
Sequencing was performed using an automatic ABI377 DNA sequencer from Applied Biosystems (Foster City, CA).
RNA preparation and Northern analysis:
RNA preparation, electrophoretical fractionation, blotting to nylon membranes, prehybridization, and hybridization were performed as previously described (
RT-PCR analyses:
Total RNA (20 µg) was used for cDNA synthesis using Expand Reverse Transcriptase (Hoffmann-La Roche, Nutley, NJ) following the manufacturer's instructions. A total of 20% of the cDNA was used for 25–30 cycles of PCR amplification using 1 µl of Amplitaq (Perkin Elmer, Norwalk, CT) in a 50-µl reaction. The conditions of amplification were as follows: 94° for 1 min, 53° for 1 min, and 72° for 30 sec, followed by a final extension at 72° for 10 min. A total of 10 µl of the PCR product was loaded on a 2% agarose gel. The following sets of primers were used in reverse transcriptase (RT)-PCR reactions. Sense primer 1B (AGCAGCAAACGAGAAATCAG) and antisense primer 2B (GCATCCCGTCGTCAATCT) were used to detect the short transcript. Primers 1 (CCATCATCACCATCAGGAG)-sense and 2 (ACCTGTTCCAGCTTGAGATT)-antisense were used to detect the long transcript. Detection of both products was achieved using primers 1B and 2. The quantitative nature of the amplification reactions was assessed by comparing the products obtained from increasing concentrations of internal standards.
Transient transfections:
Transient transfections were performed using Effectene (QIAGEN, Chatsworth, CA) according to the manufacturer's instructions. Schneider SL3 cells were usually transfected with 3 µg of plasmid DNA. Expression was induced by heat shock for 2–3 hr. Plasmid pBSHS-Fl(2)d was obtained by PCR cloning the long fl(2)d open reading frame (ORF) fused at the 5' end to a sequence encoding an influenza virus hemagglutinine (HA) epitope (
Production of antibodies:
A Fl(2)d carboxy-terminal (last 55 aa)-GST fusion and Fl(2)d amino-terminal (first 55 aa)-GST fusion were generated by cloning a PCR product from the LD19472 clone into the pGEXCS expression vector. The proteins were purified by their affinity to glutathione beads (Sigma, St. Louis) as described (
Protein preparation and Western analysis:
Protein extracts were prepared from Drosophila Schneider cells, embryos, brains, and imaginal discs of larvae, and adult heads and ovaries, by homogenization in a buffer containing 20 mM Tris, pH 8.0, 80 mM NaCl, 20 mM EDTA, 1 mM DTT, 1% NP40, and 0.1 mM PMSF. Embryo nuclear extracts were prepared according to
Immunofluorescence assays:
Schneider cells were seeded onto cover slips and after 24 hr the cells were transfected with plasmid pBSHS-Fl(2)d. At 24 hr after transfection the cells were fixed with methanol and kept at -20° until use. Fixed cells were permeabilized with 0.2% Triton X-100 in PBS for 10 min, blocked with 1% BSA in PBS for 30 min, and then incubated with primary antibodies, anti-HA (F-7) monoclonal IgG2a antibody (Santa Cruz Biotechnology) or anti-FL(2)D antiserum, at a 1:500 dilution in PBS 1% BSA for 30 min. Cells were washed with PBS 1% BSA and incubated with the appropriate FITC-conjugated secondary antibodies (Amersham) at a 1:50 dilution in the dark for 30 min. The preparations were observed under a Zeiss (Thornwood, NY) Axioplan fluorescence microscope with a standard FITC filter.
Computer analysis:
The DNA and protein databases (Swiss-prot, BDGP, GenBank, and EBI) were searched for homologies using BLAST and Fasta programs. Search of the ESTs databases (protein query against DNA database) was performed with eframe p2n (EMBL Bioccelerator). Similarities with known protein domains were analyzed using the Pfam and Prosite programs. All of these searches were performed using the EMBL Bioccelerator. Analysis of possible coiled coil regions was performed using the programs COILS (EMBnet) and BCM Search Launcher.
| RESULTS |
|---|
| TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
The gene fl(2)d and its products:
To identify the molecular nature of fl(2)d gene, a P-induced fl(2)d mutation, fl(2)dP, was produced. Males and females homozygous for this mutation are lethal. Several lines of evidence indicate that the fl(2)d gene was inactivated in fl(2)dP. First, fl(2)dP was unable to complement the previous EMS-induced mutations fl(2)d1 and fl(2)d2. Second, genetic mapping was consistent with fl(2)dP being a new fl(2)d allele rather than a mutation in a different gene that synergistically interacts with fl(2)d. Third, in situ hybridization to polytene chromosomes of larvae fl(2)dP/+ with a probe corresponding to the lacZ gene present in the P element of fl(2)dP showed a single hybridization signal in the 50C cytogenetic region of one of the two chromosomes 2 (data not shown), precisely the region described as the fl(2)d locus (
Genomic DNA from flies heterozygous for fl(2)dP was used to generate a genomic library cloned in phage 
EMBL4 (see MATERIALS AND METHODS). This library was subsequently screened with two probes: the P-element p
25.1 (pr1.1, was identified whose DNA hybridized with both probes. Restriction mapping and Southern blot hybridization experiments indicated that the genomic DNA inserted in this clone contains a fragment of the rosy gene as well as a piece of genomic sequence presumably adjacent to the site of P-element insertion (Fig 1). The precise site of insertion was determined by direct sequencing (see Fig 4A).
|
|
|
|
A 5.8-kb EcoRI-EcoRI fragment of phage pr1.1 (Fig 1) was used as a probe to screen a EMBL4 Canton-S genomic library (see MATERIALS AND METHODS). A phage, R4A, was isolated. Restriction mapping and Southern blot hybridization indicated that it overlaps with pr1.1 (data not shown; Fig 1). In situ hybridization of clone R4A to salivary gland polytene chromosomes showed a single hybridization signal to the 50C cytogenetic band, consistent with this phage containing sequences of the fl(2)d locus (data not shown).
To identify transcriptional units, a 5.9-kb genomic fragment containing the region of P-element insertion was sequenced (Fig 1). This sequence was then used to search the EST database of the BDGP. Among several clones found, two (LD19472 and GH08722) were sequenced. Comparison of these sequences and the genomic sequence indicated that these cDNAs correspond to two alternatively spliced transcripts generated by the use of two alternative 5' splice sites (ss) in exon 1 (Fig 2A). Use of the upstream 5' ss results in inclusion of exon 2B. This exon is skipped when the downstream 5' ss is used.
Northern analysis of total RNA from male and female larvae, hybridized with a probe corresponding to cDNA LD19472, identified a 2.5-kb transcript of similar abundance in both sexes (Fig 3). The size of this RNA is compatible with that expected for the longer product of fl(2)d transcription. Using this type of approach we failed to detect the short transcript. Analysis of the fl(2)d EST clones present in the database suggests that this transcript could be less abundant. Among the 21 described clones, only one corresponds to this particular form. Quantitative RT-PCR was used to analyze the presence of these transcripts in embryos, larvae, and both male and female adult flies. The assignment of the amplification products was confirmed by sequencing. Consistent with the results of Northern analysis (Fig 3) and with the relative representation of the alternatively spliced mRNAs in libraries, the short transcript was found to be less abundant than the long one (Fig 2B). The levels of both transcripts did not vary significantly during development or between sexes (Fig 2C and Fig D).
Conceptual translation of the alternatively spliced transcripts resulted in a single long ORF (Fig 4A). The transcript using the downstream 5' ss (clone LD19472; Fig 2A) has the capacity to encode a protein of 539 amino acids, with a predicted molecular mass of 59,916 kD, whose most conspicuous feature is the presence of long stretches of histidine (H) and glutamine (Q) residues at the amino-terminal region (between residues 56 and 96). A schematic representation of Fl(2)d protein is shown in Fig 4B. The initiation codon of this ORF is skipped in the transcript that uses the upstream 5' ss (clone GH08722; Fig 2A). This transcript could be translated in the same reading frame if a downstream AUG codon was used, thus generating a smaller polypeptide lacking the amino-terminal 127 residues that include the HQ-rich region. This initiation codon, however, is not in a good sequence context for initiation of translation in Drosophila (
Evidence that the transcriptional unit identified corresponds to fl(2)d:
Several lines of evidence indicate that the transcriptional unit described above corresponds to fl(2)d. First, the site of P-element insertion in the fl(2)dP mutant disrupts the longer Fl(2)d ORF (Fig 2A and Fig 4A). Second, sequence analysis of genomic DNA from fl(2)d1 flies, a recessive temperature-sensitive mutant of fl(2)d, revealed a single G to A nucleotide change at nucleotide position 939. This results in an amino acid change from aspartic acid to asparagine at position 180 of the longer version of Fl(2)d ORF (Fig 4A and Fig B). Third, sequence analysis of genomic DNA from fl(2)d2/+ heterozygous flies also revealed DNA alterations that are consistent with the stronger, non-sex-specific phenotype associated with this mutation (
Finally, and most importantly, all of the phenotypic effects associated with fl(2)d mutations were rescued in transgenic flies transformed with a cDNA corresponding to the longer transcript under the control of a constitutive ß-tubulin promoter. Table 1 summarizes the results of viability analysis of the progeny of crosses set up to generate males and females homozygous for fl(2)d2 (cross A), or fl(2)d1 (cross B), which carry the P[fl(2)d cDNA] transgene inserted in the third chromosome. A single copy of the P[fl(2)d cDNA] transgene was sufficient to recover the viability of males and females homozygous for fl(2)d2, or homozygous for fl(2)d1 raised at the restrictive temperature. Moreover, both females and males were fertile in both genetic backgrounds. These results demonstrate that the transgenic Fl(2)d protein supplies fl(2)d+ activity for both the female-specific and the non-sex-specific functions of fl(2)d in the soma, as well as the activity of this gene in the development of the female germline.
|
Taken together, the genetic and molecular data demonstrate that the gene fl(2)d has been cloned.
The gene fl(2)d encodes a nuclear protein:
To verify whether the putative polypeptides encoded by the fl(2)d transcripts are indeed expressed, polyclonal antisera were obtained from rabbits immunized with purified recombinant proteins corresponding to either the amino-terminal 55 amino acids, or the 55 carboxy-terminal residues, of Fl(2)d fused to glutathione-S-transferase (GST). Two different antisera were obtained for each antigen. The four antisera, but not preimmune sera, detected a single major polypeptide of ~80 kD in extracts from Drosophila Schneider cells (Fig 5A and Fig B), total and nuclear extracts from embryos (Fig 5C), larvae (Fig 5D), adult flies (Fig 5E), and ovaries (Fig 5F). The protein was also detected with antibodies affinity-purified using the Fl(2)d portion of the antigen (data not shown). Although the apparent mobility of the polypeptide recognized by the different antisera is substantially different from the size predicted by conceptual translation of the long fl(2)d ORF, three lines of evidence indicate that the protein recognized by the antisera corresponds to the predicted Fl(2)d product. First, Schneider cells transfected with a plasmid containing a fl(2)d ORF fused to an influenza hemagglutinin epitope (HA) expressed a protein product of ~80 kD, as detected using anti-HA antibodies (Fig 5A, lanes 8 and 9), that was not detected in nontransfected cells (lane 7). Second, overexpression of fl(2)d resulted in an increase in the signal detected with the anti-Fl(2)d antisera, compared to the signal from untransfected cells (Fig 5A, compare lane 4 with lanes 5 and 6). Third, in vitro translation of fl(2)d ORF in reticulocyte extracts resulted in the synthesis of a protein product of ~80 kD (data not shown). We conclude that the different antisera recognize Fl(2)d protein and that the protein has an anomalous mobility in SDS-polyacrylamide gels, perhaps related to the long stretches of histidine and glutamine residues.
|
The band marked with an asterisk in Fig 5A and Fig C, is unlikely to correspond to the product of translation of the short fl(2)d transcript, or to a degradation product of the complete Fl(2)d protein, because, first, it is detected with antibodies against both the amino and the carboxy terminus of the protein and, second, it is not detected with affinity-purified anti-Fl(2)d antibodies. It may correspond to cross-reaction of antibodies directed against the GST part of the antigen. Although we have not found evidence for expression of the Fl(2)d isoform encoded by the shorter fl(2)d transcript, we cannot rule out that this isoform is expressed in small amounts or only in particular cells or tissues.
To test whether differences in fl(2)d expression could be detected between male and female flies, Western blots of protein extracts from male and female heads were probed with antibodies against the carboxy terminus of Fl(2)d and ß-tubulin. Two different amounts of total protein were loaded to verify the linear response of the signal detected. The results of Fig 5E indicate that equivalent amounts of Fl(2)d were present in both sexes. Similar results were obtained with antibodies against the amino terminus of Fl(2)d (data not shown).
Consistent with the requirement of fl(2)d function for the development of the female germline (
Next we analyzed the subcellular localization of the Fl(2)d polypeptide. Fig 6A shows an immunofluorescence analysis of Schneider cells transfected with an expression vector containing fl(2)d-cDNA fused to an HA epitope. The anti-HA antibody revealed fluorescent signal in the nucleus. The anti-Fl(2)d antibodies did not allow detection of the endogenous Fl(2)d protein by immunofluorescence in Schneider cells. Nuclear fluorescent signal identical to that detected with the anti-HA antibody, however, could be detected with anti-Fl(2)d antibodies in cells overexpressing fl(2)d (Fig 6B). The nuclear localization of Fl(2)d is in agreement with the enrichment of the protein in nuclear extracts (Fig 5C, compare lanes 1–3) and is consistent with the possibility that Fl(2)d is involved in assisting Sxl in posttranscriptional regulation of gene expression. A putative nuclear localization signal is present between residues 434 and 437 (KKSK;
|
| DISCUSSION |
|---|
| TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
In this report we present the molecular identification of the gene fl(2)d. The transcriptional unit identified can generate two alternatively spliced transcripts detectable at all developmental stages. Nevertheless, only the protein encoded by the long transcript could be detected in extracts from Schneider cells, embryos, larvae, and heads and ovaries of adult animals. This suggests that the short fl(2)d transcript is not translated. We cannot rule out, however, that the levels of the short protein may be low and restricted to a few cells. The fact that all the phenotypic effects associated with fl(2)d mutations could be reversed by expression of a cDNA corresponding to the long transcript in transgenic flies further challenges the physiological significance of the short fl(2)d transcripts. Expression of fl(2)d throughout development is also consistent with the observation that the fl(2)d1 mutation shows its thermosensitive phenotype at all stages of development (
The long fl(2)d ORF can encode a polypeptide of 539 amino acids. The most apparent features of the primary sequence are two stretches of five and six histidines separated by prolines (residues 56–69) and two adjacent stretches of 10 glutamines (residues 72–95), followed by a glutamine-rich region. Glutamine repeats can dimerize or oligomerize by forming ß-sheets that in antiparallel configuration can establish multiple hydrogen bonds and form a polar zipper (
A second feature of Fl(2)d sequence suggests that protein-protein interactions can be important for its function. Secondary structure prediction analyses suggest three regions with potential to form coiled coils (around residues 100–125, 190–210, and 290–320). Coiled coils facilitate homo- and heterodimerization of multiple families of proteins, including transcription factors with classical leucine zippers like GCN4 or Fos/Jun, as well as factors with other arrangements of residues like the serum response factor Srf (
-helix could be packed against the rest of the protein fold, without being involved in dimerization through the formation of a coiled coil.
Therefore, two structural features often combined in transcription factors, a glutamine-rich region and a putative dimerization domain, are present in Fl(2)d. The absence of recognizable DNA binding domains and the fact that fl(2)d mutations result in post-transcriptional, rather than transcriptional, deregulation of its two known target genes (Sxl and tra) make the possibility that Fl(2)d is a transcription factor less likely. We cannot exclude, however, that Fl(2)d is important for transcription of a yet unidentified factor involved in the processing of Sxl and tra RNAs.
fl(2)d has two functions that can be separated genetically by mutations that are either female-lethal or both male- and female-lethal. In addition, the gene fl(2)d is also needed for proper expression of Sxl in the female germline (
The female-specific function of fl(2)d is related to its requirement for proper splicing regulation of the Sxl and tra RNAs by the protein Sxl (
The non-sex-specific function of fl(2)d remains to be identified. Because Sxl activity is not required for male development (
We hope that the molecular characterization of novel fl(2)d mutations generated by mobilization of the P element of fl(2)dP mutation, or the P element inserted at the 5' UTR of a new mutant fl(2)d allele present in the Drosophila genome project P-element collection, as well as biochemical analyses of the properties of the Fl(2)d protein will provide insights into the molecular mechanism underlying fl(2)d function.
| FOOTNOTES |
|---|
\|[sect ]\| Juán Valcárcel, Gene Expression Programme, European Molecular Biology Laboratory, Meyerhofstrasse, 1, D-69117 Heidelberg, Germany. E-mail: juan.valcarcel@embl-Heidelberg.de 
| ACKNOWLEDGMENTS |
|---|
We thank D. Mateos and R. de Andrés for their technical assistance. This work was supported by grant PB95-1236 from Dirección General de Investigación Científica y Técnica to L.S. L.O.F.P. was supported by a European Molecular Biology Organization postdoctoral fellowship.
Manuscript received September 14, 1999; Accepted for publication January 11, 2000.
| LITERATURE CITED |
|---|
| TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
ALKHATIB, G. and D. J. BRIEDIS, 1986 The predicted primary structure of the measles virus hemagglutinin. Virology 150:479-490[Medline].
ASHBURNER, M., 1989 Drosophila: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
BECKER, P. B. and C. WU, 1992 Cell-free system for assembly of transcriptionally repressed chromatin from Drosophila embryos. Mol. Cell. Biol. 12:2241-2249
BELL, L. R., E. M. MAINE, P. SCHEDL, and T. W. CLINE, 1988 Sex-lethal, a Drosophila sex determination switch gene, exhibits sex-specific RNA splicing and sequence similar to RNA binding proteins. Cell 55:1037-1046[Medline].
BOGGS, R. T., P. GREGOR, S. IDRISS, J. M. BELOTE, and M. MCKEOWN, 1987 Regulation of sexual differentiation in Drosophila melanogaster via alternative splicing of RNA from the transformer gene. Cell 50:739-747[Medline].
BOPP, D., L. R. BELL, T. W. CLINE, and P. SCHEDL, 1991 Developmental distribution of female-specific Sex-lethal proteins in Drosophila melanogaster.. Genes Dev. 5:403-415
BURNETTE, J. M., A. R. HATTON, and A. J. LÓPEZ, 1999 Trans-acting factors required for inclusion of regulated exons in the Ultrabithorax mRNAs of Drosophila melanogaster.. Genetics 151:1517-1529
CAVENER, D., 1987 Comparison of the consensus sequence flanking translational start sites in Drosophila and vertebrates. Nucleic Acids Res. 15:1353-1361
CHELSKY, D., R. RALPH, and G. JONAK, 1989 Sequence requirements for synthetic peptide-mediated translocation to the nucleus. Mol. Cell. Biol. 9:2487-2492
CLINE, T. W., 1983 Functioning of the genes daughterless (da) and Sex-lethal (Sxl) in Drosophila germ cells. Genetics 104:16-17.
CLINE, T. W., 1984 Autoregulatory functioning of a Drosophila gene product that establishes and maintains the sexually determined state. Genetics 107:231-277
COWARD, P., K. NAGAI, D. CHEN, H. D. THOMAS, and C. M. NAGAMINE et al., 1994 Polymorphism of a CAG trinucleotide repeat within Sry correaltes with B6.YDom sex reversal. Nat. Genet. 6:245-250[Medline].
FLICKINGER, T. W. and H. K. SALZ, 1994 The Drosophila sex determination gene snf encodes a nuclear protein with sequences and functional similarity to the mammalian U1A snRNP protein. Genes Dev. 8:914-925
GIESE, K., J. COX, and R. GROSSCHEDL, 1992 The HMG domain of lymphoid enhancer factor 1 bends DNA and facilitates assembly of functional nucleoprotein structures. Cell 69:185-195[Medline].
GOODFELLOW, P. N. and R. LOVELL-BADGE, 1993 SRY and sex determination in mammals. Annu. Rev. Genet. 27:71-92[Medline].
GRANADINO, B., S. CAMPUZANO, and L. SÁNCHEZ, 1990 The Drosophila melanogaster fl(2)d gene is needed for the female-specific splicing of Sex-lethal RNA. EMBO J. 9:2597-2602[Medline].
GRANADINO, B., A. B. SAN JUÁN, and L. SÁNCHEZ, 1991 The gene fl(2)d is required for various Sxl-controlled processes in Drosophila females. Roux's Arch. Dev. Biol. 200:172-176.
GRANADINO, B., A. B. SAN JUÁN, P. SANTAMARÍA, and L. SÁNCHEZ, 1992 Evidence of a dual function in fl(2)d: a gene needed for Sex-lethal expression in Drosophila melanogaster.. Genetics 130:597-612[Abstract].
GRANADINO, B., L. O. F. PENALVA, and L. SÁNCHEZ, 1996 The gene fl(2)d is needed for the sex-specific splicing of transformer pre-mRNA but not for double-sex pre-mRNA in Drosophila melanogaster.. Mol. Gen. Genet. 253:26-31[Medline].
GUBBAY, J., N. VIVIAN, A. ECONOMOU, D. JACKSON, and P. GOODFELLOW et al., 1992 Inverted repeat structure of the Sry locus in mice. Proc. Natl. Acad. Sci. USA 89:7953-7957
HAGER, J. H. and T. W. CLINE, 1997 Induction of female Sex-lethal RNA splicing in male germ cells: implications for Drosophila germline sex determination. Development 124:5033-5048[Abstract].
HILFIKER, A., H. AMREIN, A. DÜBENDORFER, and R. NÖTHIGER, 1995 The gene virilizer is required for female-specific splicing controlled by Sxl, the master gene for sexual development in Drosophila. Development 121:4017-4026[Abstract].
HORABIN, J. I. and P. SCHEDL, 1993 Regulated splicing of the Drosophila Sex-lethal male exon involves a blockage mechanism. Mol. Cell. Biol. 13:1408-1414
INOUE, K., K. HOSHIJIMA, H. SAKAMOTO, and Y. SHIMURA, 1990 Binding of the Drosophila Sex-lethal gene product to the alternative splice site of transformer primary transcript. Nature 344:461-463[Medline].
KOOPMAN, P., J. GUBBAY, N. VIVIAN, P. GOODFELLOW, and R. LOVELL-BADGE, 1991 Male development of chromosomally female mice transgenic for Sry. Nature 351:117-121[Medline].
LINDSLEY, D. L., and G. ZIMM, 1992 The Genome of Drosophila Melanogaster. Academic Press, San Diego.
LUPAS, A., 1996 Coiled coils: new structures and new functions. Trends Biochem. Sci. 21:375-382[Medline].
MANIATIS, T., E. F. FRITSCH and J. SAMBROOK, 1982 Molecular Cloning. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
MCKEOWN, M., J. M. BELOTE, and R. T. BOGGS, 1988 Ectopic expression of the female transformer gene product leads to female differentiation of chromosomally male Drosophila. Cell 53:887-895[Medline].
NAGASE, T., N. SEKI, A. TANAKA, K. ISHIKAWA, and N. NOMURA, 1995 Prediction of the coding sequences of unidentified human genes. IV. The coding sequences of 40 new genes (KIAA0121-KIAA0160) deduced by analysis of cDNA clones from human cell line KG-1. DNA Res. 2:167-174[Abstract].
NASRIN, N., C. BUGGS, X. F. KONG, J. CARNAZZA, and M. GOEBL et al., 1991 DNA-binding properties of the product of the testis-determining gene and a related protein. Nature 354:317-320[Medline].
NÖTHIGER, R., M. JONGLEZ, M. LEUTHOLD, P. MEIER-GERSCHWILLER, and T. WEBER, 1989 Sex determination in the germline of Drosophila depends on genetic signals and inductive somatic factors. Development 107:505-518[Abstract].
O'HARE, K. and G. M. RUBIN, 1983 Structures of P transposable elements and their sites of insertion and excision in the Drosophila melanogaster genome. Cell 34:25-35[Medline].
OLIVER, B., N. PERRIMON, and A. P. MAHOWALD, 1988 Genetic evidence that the sans-fille locus is involved in Drosophila sex determination. Genetics 120:159-171
PATHAK, D. and P. B. SIEGER, 1992 Updating structure-function relationships in the bZip family of transcription factors. Curr. Opin. Struct. Biol. 2:116-123.
PENALVA, L. O. F., H. SAKAMOTO, A. NAVARRO-SABATE, E. SAKASHITA, and B. A. GRANADINO et al., 1996 Regulation of the gene Sex-lethal: a comparative analysis of Drosophila melanogaster and Drosophila subobscura.. Genetics 144:1653-1664[Abstract].
PERUTZ, M. F., 1999 Glutamine repeats and neurodegenerative diseases: molecular aspects. Trends Biochem. Sci. 24:58-63[Medline].
PERUTZ, M. F., R. STADEN, I. MOENS, and I. DEBAERE, 1993 Pollar zippers. Curr. Biol. 3:249-253[Medline].
PIRROTTA, V., 1986 Cloning Drosophila Genes. IRL Press, Oxford.
PTASHNE, M. and A. GANN, 1997 Transcriptional activation by recruitment. Nature 386:569-577[Medline].
PUIG, O., A. GOTTSCHALK, P. FABRIZIO, and B. SERAPHIN, 1999 Interaction of the U1 snRNP with nonconserved intronic sequences affects 5' splice site selection. Genes Dev. 13:569-580
SAKAMOTO, H., K. INOUE, I. HIGUCHI, Y. ONO, and Y. SHIMURA, 1992 Control of Drosophila Sex-lethal pre-mRNA splicing by its own female-specific product. Nucleic Acids Res. 20:5533-5540
SALZ, H. K., 1992 The genetic analysis of snf: a Drosophila sex determination gene required for activation of Sex-lethal in both the germline and the soma. Genetics 130:547-554[Abstract].
SALZ, H. K., T. W. CLINE, and P. SCHEDL, 1987 Functional changes associated with structural alterations induced by mobilization of a P element inserted in the Sex-lethal gene of Drosophila. Genetics 117:221-231
SALZ, H. K., E. M. MAINE, L. N. KEYES, M. E. SAMUELS, and T. W. CLINE et al., 1989 The Drosophila female-specific sex-determination gene, Sex-lethal, has stage-, tissue-, and sex-specific RNAs suggesting multiple modes of regulation. Genes Dev. 3:708-719
SÁNCHEZ, L. and R. NÖTHIGER, 1982 Clonal analysis of Sex-lethal, a gene needed for female sexual development in Drosophila melanogaster.. Roux's Arch. Dev. Biol. 191:211-214.
SCHULZ, G. E., and R. H. SCHIRMER, 1979 Principles of Protein Structure. Springer-Verlag, New York.
SCHÜPBACH, T., 1985 Normal female germ cell differentiation requires the female X chromosome to autosome ratio and expression of Sex-lethal in Drosophila melanogaster.. Genetics 109:529-548
SCHUTT, C., A. HILFIKER, and R. NOTHIGER, 1998 Virilizer regulates Sex-lethal in the germline of Drosophila melanogaster.. Development 125:1501-1507[Abstract].
SEGARRA, C. and M. AGUADÉ, 1993 Nucleotide divergence of the rp49 gene region between Drosophila melanogaster and two species of the obscura group of Drosophila. J. Mol. Evol. 36:243-248[Medline].
SMITH, D. B., L. C. BERGER, and A. G. WILDEMAN, 1993 Modified glutathione S-transferase fusion proteins for simplified analysis of protein-protein interactions. Nucleic Acids Res. 21:359-360
SPRADLING, A. C., 1986 P-element-mediated transformation, pp. 175–198 in Drosophila: A Practical Approach, edited by D. B. ROBERTS. IRL Press, Oxford.
STEINMANN-ZWICKY, M., 1988 Sex determination in Drosophila: the X chromosomal gene liz is required for Sxl activity. EMBO J. 7:3889-3898[Medline].
STEINMANN-ZWICKY, M., H. SCHMID, and R. NÖTHIGER, 1989 Cell-autonomous and inductive signals can determine the sex of the germline of Drosophila by regulating the gene Sxl.. Cell 57:157-166[Medline].
STITZINGER, S. M., A. PELLICENA-PALLE, E. B. ALBRECHT, K. M. GAJEWSKI, and K. M. BECKINGHAM et al., 1999 Mutations in the predicted aspartyl tRNA synthetase of Drosophila are lethal and function as dosage-sensitive maternal modifiers of the sex determination gene Sex-lethal.. Mol. Gen. Genet. 261:142-151[Medline].
ZHANG, J., P. COWARD, M. XIAN, and Y.-F. C. LAU, 1999 In vitro binding and expression studies demonstrate a role for the mouse Sry Q-rich domain in sex determination. Int. J. Dev. Biol. 43:219-227[Medline].
This article has been cited by other articles:
 |
|
 |
|
  J. K. M. Penn, P. Graham, G. Deshpande, G. Calhoun, A. S. Chaouki, H. K. Salz, and P. Schedl Functioning of the Drosophila Wilms'-Tumor-1-Associated Protein Homolog, Fl(2)d, in Sex-Lethal-Dependent Alternative Splicing Genetics, February 1, 2008; 178(2): 737 - 748. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. W. Small, Z. Bolender, C. Bueno, C. O'Neil, Z. Nong, W. Rushlow, N. Rajakumar, C. Kandel, J. Strong, J. Madrenas, et al. Wilms' Tumor 1-Associating Protein Regulates the Proliferation of Vascular Smooth Muscle Cells Circ. Res., December 8, 2006; 99(12): 1338 - 1346. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Vespa, G. Vachon, F. Berger, D. Perazza, J.-D. Faure, and M. Herzog The Immunophilin-Interacting Protein AtFIP37 from Arabidopsis Is Essential for Plant Development and Is Involved in Trichome Endoreduplication Plant Physiology, April 1, 2004; 134(4): 1283 - 1292. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Niksic, J. Slight, J. R. Sanford, J. F. Caceres, and N. D. Hastie The Wilms' tumour protein (WT1) shuttles between nucleus and cytoplasm and is present in functional polysomes Hum. Mol. Genet., February 15, 2004; 13(4): 463 - 471. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. O. F. Penalva and L. Sanchez RNA Binding Protein Sex-Lethal (Sxl) and Control of Drosophila Sex Determination and Dosage Compensation Microbiol. Mol. Biol. Rev., September 1, 2003; 67(3): 343 - 359. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Ladomery, J. Sommerville, S. Woolner, J. Slight, and N. Hastie Expression in Xenopus oocytes shows that WT1 binds transcripts in vivo, with a central role for zinc finger one J. Cell Sci., April 15, 2003; 116(8): 1539 - 1549. [Abstract] [Full Text] [PDF]
|
|
