- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Marsh, T. C.
- Articles by Romero, D. P.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Marsh, T. C.
- Articles by Romero, D. P.
RAD51 Is Required for Propagation of the Germinal Nucleus in Tetrahymena thermophila
Thomas C. Marsha, Eric S. Coleb, Kathleen R. Stuartb, Colin Campbella, and Daniel P. Romeroaa Department of Pharmacology, Medical School, University of Minnesota, Minneapolis, Minnesota 55455
b Department of Biology, St. Olaf College, Northfield, Minnesota 55057
Corresponding author: Daniel P. Romero, Department of Pharmacology, Medical School, University of Minnesota, 6-120 Jackson Hall, 321 Church St. S.E., Minneapolis, MN 55455., romero{at}lenti.med.umn.edu (E-mail)
Communicating editor: S. L. ALLEN
| ABSTRACT |
|---|
RAD51, the eukaryote homolog of the Escherichia coli recA recombinase, participates in homologous recombination during mitosis, meiosis, and in the repair of double-stranded DNA breaks. The Tetrahymena thermophila RAD51 gene was recently cloned, and the in vitro activities and induction of Rad51p following DNA damage were shown to be similar to that of RAD51 from other species. This study describes the pattern of Tetrahymena RAD51 expression during both the cell cycle and conjugation. Tetrahymena RAD51 mRNA abundance is elevated during macronuclear S phase during vegetative cell growth and with both meiotic prophase and new macronuclear development during conjugation. Gene disruption of the macronuclear RAD51 locus leads to severe abnormalities during both vegetative growth and conjugation. rad51 nulls divide slowly and incur rapid deterioration of their micronuclear chromosomes. Conjugation of two rad51 nulls leads to an arrest early during prezygotic development (meiosis I). We discuss the potential usefulness of the ciliates' characteristic nuclear duality for further analyses of the potentially unique roles of Tetrahymena RAD51.
THE exchange of information between DNA molecules fulfills two seemingly conflicting roles. Homologous recombination during meiosis generates genetic diversity within a species by mediating exchange between homologous chromosomes, whereas the same mechanism helps to maintain genetic stability by promoting exchange between sister chromatids, thereby effecting DNA repair (![]()
It has been known for years that the RAD51 gene from the budding yeast Saccharomyces cerevisiae plays an essential role in genetic recombination and DNA repair (![]()
![]()
![]()
![]()
![]()
RAD51 genes have been cloned from Schizosaccharomyces pombe, Caenorhabditis elegans, Drosophila melanogaster, and a number of vertebrate and mammalian species, including Homo sapiens (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Given the apparent high degree of Rad51 conservation from yeast to mammals, it was surprising to discover that inactivation of this gene in both chicken and murine somatic cells is lethal (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Unfortunately, the inability to culture rad51 null mammalian cells poses a significant barrier to gaining greater insight into this protein's function in these cells. The recent cloning of a RAD51 from Tetrahymena thermophila suggests a possible means to overcome this difficulty (![]()
![]()
![]()
![]()
The nuclear dualism of T. thermophila provides a unique environment for the investigation of genes involved in the maintenance of genome stability. The highly regulated and sequence-specific genomic rearrangements that occur during ciliate development have prompted our investigation of trans-acting factors that mediate these processes. In this study, we have explored the pattern of Tetrahymena RAD51 expression during both the cell cycle and conjugation, as well as the consequences of RAD51 gene replacement on both mitotic division and conjugation.
| MATERIALS AND METHODS |
|---|
General methods:
T. thermophila cultures were maintained in 12% PPYS (proteose peptone, yeast extract, and sequestrene) at 30°, as previously described (![]()
![]()
![]()
![]()
Synchronization of Tetrahymena:
The methodology is as described (![]()
PCR primers and products:
PCR primers are indicated below. P1(+/-) was designed to amplify a neomycin resistance cassette (![]()
![]()
- P1(+)CATCGATGAAACATCTCCGG
- P1(-)GGAATTCTTTTGTTCCCTTT
- P2(+)AGATCTTTAGTTGAATG
- P2(-)ATCTAGATAACGATTTG
- P3(+)GACGAATTCGGTATTGC
- P3(-)TCACTCGTTGAAGTC
- P4(+)GCCTGCCTTCATCGG
- P4(-)GCACTTTCTGTGGAC
RAD51 macronuclear gene replacement:
A 4.4-kb XbaI-KpnI fragment from the T. thermophila RAD51 genomic clone (![]()
![]()
The paromomycin resistance cassette was cloned at ClaI (-185) and EcoRI (+2068) sites of pTtRd51XK to create a sequence suitable for Tetrahymena RAD51 gene replacement (designated pTtRd51KO). Targeting to the RAD51 locus is provided by 937 bp upstream (from -1122 to -185) and 1203 bp downstream (from +2068 to +3272) of the RAD51 gene (![]()
Transformation of Tetrahymena:
Tetrahymena cultures expressing different mating types were grown in 200 ml of 2% PPYS to a density of 2.5 x 105 cells/ml. The cells were washed and starved in 200 ml of 10 mM Tris HCl (pH 7.5) for 18 hr. The starved cells were mixed together in equal numbers and monitored for pairing efficiency at 3 hr (>90%). Cultures were centrifuged 10.5 hr after mixing, washed once in 10 mM HEPES (pH 7.5), and resuspended in 2 ml 10 mM HEPES (pH 7.5) to a density of ~2 x 107 cells/ml. Approximately 5 x 106 cells (250 µl) were mixed with 50 µg pTtRd51KO (digested with XbaI and KpnI), and the cells were transformed with a BTX BCM600 electroporator (Gentronics, San Diego), as described (![]()
Northern blot analysis:
T. thermophila cultures (10 ml) were lysed in guanidinium isothiocyanate, and polyadenylated RNA [poly(A) RNA] was prepared with the MicroPoly(A)Pure kit (Ambion). RNA concentrations were determined by absorbance at 260 nM, and equivalent amounts for each poly(A) RNA sample (0.7 µg) were electrophoresed in 2.2 M formaldehyde1% agarose gels and transferred to Nytran filters by capillary action (![]()
![]()
Cytology:
Cells were fixed in three sequential washes of 50% methanol, 70% methanol, and 70% methanol:15% acetic acid prior to air drying at 37° on microscope slides. Fixed cells were stained with 4', 6-diamidino-2-phenylindole (DAPI) and viewed with an Olympus B-Max fluorescence microscope at x320 magnification using a x40 oil-immersion objective lens, a 1.6 optivar setting, and a x5 ocular lens. Micrographs were recorded either photographically with an Olympus PM-30 camera and Kodak Tech-Pan film or digitally using a SPOT camera and imaging software.
| RESULTS |
|---|
RAD51 expression during the cell cycle:
RAD51 expression in S. cerevisiae is regulated through the cell cycle, with a peak occurring from late G1 to early S phase in a pattern coincident with the expression of DNA replication enzymes (![]()
![]()
To examine Tetrahymena RAD51 expression through the cell cycle, a synchronous population was obtained by centrifugal elutriation. Daughter cells that had recently undergone cytokinesis were effectively size selected, cultured, and carefully monitored every 20 min thereafter for their progression through the cell cycle. Four characteristic cytological stages with distinct micro- and macronuclear morphologies were tabulated for the synchronous culture over 4 hr. A very high degree of synchrony (82% "dividers" at 120 min) was obtained by this method (Fig 1A).
|
RNA samples were prepared every 20 min and RAD51 mRNA levels monitored by Northern blot analysis. A cell cycle dependent pattern of RAD51 expression was observed, with a peak of expression during the 40-min interval immediately following cytokinesis (Fig 1B). Maximal levels of RAD51 mRNA coincide with the period of DNA replication in the macronucleus (![]()
![]()
RAD51 expression during development:
Two mature, wild-type T. thermophila strains expressing different mating types (CU428.2 and CU438.1; Table 1) were starved and mixed to initiate conjugation, with >95% pairing efficiency. RNA samples were prepared at 1- to 2-hr intervals from the mated cells and RAD51 mRNA levels monitored. A bimodal pattern of RAD51 expression is apparent, with maxima at 34 hr and 1214 hr after mixing (Fig 2). The two peaks of expression coincide with both meiotic prophase and exconjugant macronuclear development (![]()
|
|
RAD51 gene disruption:
The RAD51 macronuclear locus was disrupted with a selectable marker by homologous recombination as has been described for other Tetrahymena loci (![]()
![]()
![]()
![]()
![]()
![]()
![]()
|
Only partial replacement of the endogenous 45 copies of the RAD51 gene present in each developing macronucleus is achieved immediately following transformation. However, because multiple copies of macronuclear genes segregate randomly as the macronuclei divide amitotically, it is possible for one allele to be lost and the other to predominate over the course of multiple fissions (![]()
Total RAD51 gene replacement was achieved by the incremental increase of paromomycin from 120 µg/ml to 960 µg/ml over the course of 6080 fissions. Despite these rigorous selection conditions, a small percentage of cells under paromomycin selection tended to retain some copies of the RAD51 allele. This phenomenon is likely due to the severe growth disadvantage for cells entirely lacking Rad51p (see below). To ensure complete RAD51 gene replacement, single cell clonal lines were periodically isolated under increasing drug selection. In addition to Southern blot analysis (Fig 3B), putative knockout clones were evaluated by reverse transcriptase PCR of RNA isolated from candidate clones 2 hr after UV irradiation. Because RAD51 expression is induced after exposure to UV (![]()
rad51 null vegetative phenotypes:
rad51 nulls exhibit severe vegetative growth phenotypes (Fig 4A). The generation time for the rad51 clones was ~25% longer than that for the btu1 control cells (a 4-hr doubling time for the rad51 null during logarithmic phase growth vs. 3.25 hr for the btu1 null control). rad51 cells were also more sensitive to the DNA damaging agent methylmethane sulfonate (MMS). Approximately 75% of either wild-type or btu1 nulls survive a 30-min exposure to 20 mM MMS. In contrast, only 31% of rad51 nulls survived under identical conditions (Fig 4B).
|
An examination of rad51 nulls revealed profound defects in nuclear division, compared to wild-type and btu1 nulls. Examples of dividing btu1 and rad51 cells fixed and stained with the DNA-specific dye DAPI are shown in Fig 5. There is an abnormal persistence of micronuclear mitotic spindles, even to the point where macronuclear elongation, division, and cytokinesis proceed before duplication of the micronuclei is complete. This defect in micronuclear division leads to rad51 nulls that become hypodiploid, with an eventual subpopulation (~25%) of severely aneuploid cells (data not shown). There is also a higher-than-normal percentage of chromatin exclusion bodies (CEBs) evident in the rad51 nulls (Fig 5). The elimination of CEBs is a mechanism to maintain the level of macronuclear ploidy (![]()
|
The effect of RAD51 macronuclear gene replacement on conjugation:
Assessing the effect somatic rad51 nulls have on conjugation is problematic because a consequence of total RAD51 gene replacement is the eventual loss of micronuclear DNA. To evaluate a rad51 x rad51 cross, it was necessary to first reintroduce diploid, wild-type micronuclei into these cells. This is possible in Tetrahymena due to a special type of abortive mating called round I genomic exclusion. This process occurs when wild-type cells are crossed with so-called star strains that have defective, diminutive micronuclei. Star strains can form conjugal pairs with wild-type cells but fail to contribute a migratory gametic micronucleus to the wild-type partner at the fertilization stage of conjugation. As a result, a single haploid micronucleus is contributed by the wild-type partner to the star partner, where it is endoreplicated, leading to a homozygous, diploid micronucleus in each conjugant. At this point, conjugation is aborted prematurely, and there are no postzygotic nuclear divisions. Both cells continue to express their parental phenotypes, including mating-type expression and sexual maturity, because parental macronuclei are retained by exconjugants in a star mating. Round I genomic exclusion is shown schematically in Fig 6 and described in detail elsewhere (![]()
![]()
|
We have found that hypodiploid rad51 knockout clones behaved exactly like star strains when mated to a wild-type partner. The resultant rad51 knockout synclones complete round I genomic exclusion and retain their old macronucleus (paromomycin resistance). Paromomycin-resistant exconjugants acquire a diploid micronucleus, which can be detected cytologically after staining with the DNA-specific dye DAPI (data not shown).
Two rad51 null clonal lines expressing different mating types that had reacquired micronuclei through a star mating with a wild-type strain were expanded for ~20 fissions, starved, and mixed in equal numbers to initiate conjugation. As a control, two btu1 knockout clones were mated in a parallel experiment. Whereas conjugating btu1 knockout strains followed the nuclear developmental processes that have been well established for wild-type conjugants (![]()
![]()
|
|
| DISCUSSION |
|---|
RAD51 expression and DNA replication:
A clear delineation of the ciliate cell cycle is complicated by the unusual nuclear dimorphism that has evolved for these protozoans. For example, it has been shown for Tetrahymena that the periods of micro- and macronuclear DNA synthesis do not overlap (![]()
![]()
We have shown that Tetrahymena RAD51 mRNA levels peak during the cell cycle period of maximum macronuclear DNA synthesis (Fig 1). The expression of DNA replication enzymes in Tetrahymena is presumably coincident with that of RAD51, as has been shown for S. cerevisiae and humans (![]()
![]()
There is indirect support for a connection between DNA replication and homologous recombination repair in Tetrahymena, based upon the apparent subcellular localization of Rad51 protein after cells sustain DNA damage. Exposure to MMS results in a pronounced RAD51 induction, with Rad51 protein localized primarily in macronuclei actively replicating their DNA, while it is apparently excluded from micronuclei that have already completed DNA replication (![]()
![]()
RAD51 and nuclear division:
A role for RAD51-mediated DNA repair in the micronucleus is clearly demonstrated by the severe defects suffered by rad51 knockouts during mitosis (Fig 5). Similar defects in micronuclear division have been recently reported for two other Tetrahymena mutants. Gene replacement of a cytoplasmic dynein heavy chain gene results in failure of micronuclear chromosomes to segregate during mitosis, implicating this protein in attachment of chromosomes to the kinetochore microtubules (![]()
![]()
A previously described phenotype for Tetrahymena transformants expressing a mutated telomerase RNA template is in direct contrast with those of the his3 and rad51 null strains. When mutant G4T4 repeats (instead of wild-type G4T2 repeats) cap the ends of micronuclear chromosomes, there is a failure of replicated chromosomes to disassociate during anaphase (![]()
![]()
RAD51 and conjugation:
Homologous recombination factors, including Rad51p and its meiosis-specific homolog Dmc1p, play critical roles in generating genetic diversity by mediating strand exchange during meiosis in yeast (![]()
![]()
![]()
![]()
![]()
RAD51 mRNA levels at 4 hr relative to those prior to mixing are ~5.51, whereas a similar comparison of RAD51 mRNA at 14 hr is 1.51 (Fig 2). However, it should be noted that the macronuclear gene copy number is 45C at 4 hr for the parental macronuclei and 8C at 14 hr during development (![]()
![]()
Despite their star-like behavior in completing round I genomic exclusion when crossed to wild-type cells, rad51 nulls are not true star cells. When two star strains are mated to each other, the cells frequently complete meiosis I and II and successfully condense their chromosomes, despite severe aneuploidy (data not shown). Conversely, when two rad51 null strains are mated, the pairs arrest at meiotic prophase I prior to chromosome condensation, rarely progressing to anaphase I (Fig 8). Furthermore, star cells express RAD51 to wild-type levels when DNA damage is induced by UV irradiation (T. MARSH, unpublished results).
Homologous recombination plays a role in mediating some, if not all, of the extensive genomic rearrangements that occur during exconjugant development. For example, there is an intragenic recombination event between two nonsense mutations (separated by 726 bp) in the SERH1 gene that restores wild-type expression of the SerH1 surface protein, which occurs in the macronuclear anlagen (![]()
![]()
| ACKNOWLEDGMENTS |
|---|
This work was supported by research grants from the National Institutes of Health (CA-61906, C.C.; GM-50861, D.P.R.), the American Heart Association (96010390, C.C.), the ACS (DHP-171, C.C.), the National Science Foundation (MCB 9807555, E.S.C.), and the MN Medical Foundation (CRF-185-98, D.P.R.).
Manuscript received November 7, 1999; Accepted for publication December 28, 1999.
| LITERATURE CITED |
|---|
ADL, S. M. and J. D. BERGER, 1996 Commitment to division in ciliate cell cycles. J. Eukaryot. Microbiol. 43:77-86[Medline].
AKABOSHI, E., Y. INOUE, and H. RYO, 1994 Cloning of the cDNA and genomic DNA that correspond to the recA-like gene of Drosophila melanogaster.. Jpn. J. Genet. 69:663-670[Medline].
ALLEN, S. L., 1967 Cytogenetics of genomic exclusion in Tetrahymena.. Genetics 55:797-822
ALLIS, C. D., M. COLAVITO-SHEPANSKI, and M. A. GOROVSKY, 1987 Scheduled and unscheduled DNA synthesis during development in conjugating Tetrahymena.. Dev. Biol. (Orlando) 124:469-480[Medline].
BASILE, G., M. AKER, and R. K. MORTIMER, 1992 Nucleotide sequence and transcriptional regulation of the yeast recombinational repair gene RAD51.. Mol. Cell. Biol. 12:3235-3246
BAUMANN, P., F. E. BENSON, and S. C. WEST, 1996 Human Rad51 protein promotes ATP-dependent homologous pairing and strand transfer reactions in vitro.. Cell 87:757-766[Medline].
BODENBENDER, J., A. PROHASKA, F. JAUKER, H. HIPKE, and G. CLEFFMANN, 1992 DNA elimination and its relation to quantities in the macronucleus of Tetrahymena.. Dev. Genet. 13:103-110[Medline].
BUTLER, D. K., L. E. YASUDA, and M.-C. YAO, 1995 An intramolecular recombination mechanism for the formation of the rRNA gene palindrome of Tetrahymena thermophila.. Mol. Cell. Biol. 15:7117-7126[Abstract].
CAMPBELL, C. and D. P. ROMERO, 1998 Identification and characterization of the RAD51 gene from the ciliate Tetrahymena thermophila.. Nucleic Acids Res. 26:3165-3172
CASSIDY-HANLEY, D., J. BOWEN, J. H. LEE, E. COLE, and L. A. VERPLANK et al., 1997 Germline and somatic transformation of mating Tetrahymena thermophila by particle bombardment. Genetics 146:135-147[Abstract].
CHEN, J., D. P. SILVER, D. WALPITA, S. B. CANTOR, and A. F. GAZDAR et al., 1998 Stable interaction between the products of the BRCA1 and BRCA2 tumor suppressor genes in mitotic and meiotic cells. Mol. Cell 2:317-328[Medline].
COLE, E. S. and T. A. SOELTER, 1997 A mutational analysis of conjugation in Tetrahymena thermophila. 2. Phenotypes affecting middle and late development: third prezygotic nuclear division, pronuclear exchange, pronuclear fusion and postzygotic development. Dev. Biol. (Orlando) 189:233-245[Medline].
COLE, E. S., D. CASSIDY-HANLEY, J. HEMISH, J. TUAN, and P. J. BRUNS, 1997 A mutational analysis of conjugation in Tetrahymena thermophila. 1. Phenotypes affecting early developmentmeiosis to nuclear selection. Dev. Biol. (Orlando) 189:215-232[Medline].
COYNE, R. S., D. L. CHALKER, and M.-C. YAO, 1996 Genome downsizing during ciliate developmentnuclear division of labor through chromosome restructuring. Annu. Rev. Genet. 30:557-578[Medline].
DEAK, J. C. and F. P. DOERDER, 1998 High frequency intragenic recombination during macronuclear development in Tetrahymena thermophila restores the wild-type SerH1 gene. Genetics 148:1109-1115
DOERDER, F. P. and L. E. DEBAULT, 1975 Cytofluorimetric analysis of nuclear DNA during meiosis, fertilization and macronuclear development in the ciliate Tetrahymena pyriformis, syngen 1. J. Cell Sci. 17:471-493[Abstract].
DOERDER, F. P. and S. K. SHABATURA, 1980 Genomic exclusion in Tetrahymena thermophila: a cytogenetic and cytofluorometric study. Dev. Genet. 1:205-218.
DRESSER, M. E., D. J. EWING, M. N. CONRAD, A. M. DOMINGUEZ, and R. BARSTEAD et al., 1997 DMC1 functions in a Saccharomyces cerevisiae meiotic pathway that is largely independent of the RAD51 pathway. Genetics 147:533-544[Abstract].
GAERTIG, J. and M. A. GOROVSKY, 1992 Efficient mass transformation of Tetrahymena thermophila by electroporation of conjugants. Proc. Natl. Acad. Sci. USA 89:9196-9200
GAERTIG, J., L. GU, B. HAI, and M. A. GOROVSKY, 1994a High frequency vector-mediated transformation and gene replacement in Tetrahymena.. Nucleic Acids Res. 22:5391-5398
GAERTIG, J., T. H. THATCHER, L. GU, and M. A. GOROVSKY, 1994b Electroporation-mediated replacement of a positively and negatively selectable ß-tubulin gene in Tetrahymena thermophila.. Proc. Natl. Acad. Sci. USA 91:4549-4553
GAME, J. C., 1983 Radiation-sensitive mutants and repair in yeast, pp. 109137 in Yeast Genetics: Fundamental and Applied Aspects, edited by J. F. T. SPENCER, D. H. SPENCER and A. R. W. SMITH. Springer-Verlag, New York.
GAVIN, R. H., 1965 The effects of heat and cold on cellular development in synchronized Tetrahymena pyriformis WH-6. J. Protozool. 12:307-318[Medline].
HAI, B. and M. A. GOROVSKY, 1997 Germ-line knockout heterokaryons of an essential
-tubulin gene enable high-frequency gene replacement and a test of gene transfer from somatic to germ-line nuclei in Tetrahymena thermophila. Proc. Natl. Acad. Sci. USA 94:1310-1315
KIRK, K. E., B. P. HARMON, I. K. REICHARDT, J. W. SEDAT, and E. H. BLACKBURN, 1997 Block in anaphase chromosome separation caused by a telomerase template mutation. Science 275:1478-1481
LEE, S., J. C. WISNIEWSKI, W. L. DENTLER, and D. J. ASAI, 1999 Gene knockouts reveal separate functions for two cytoplasmic dyneins in Tetrahymena thermophila. Mol. Biol. Cell 10:771-784
MCCORMICK-GRAHAM, M. and D. P. ROMERO, 1996 A single telomerase RNA is sufficient for the synthesis of variable telomeric DNA repeats in ciliates of the genus Paramecium.. Mol. Cell. Biol. 16:1871-1879[Abstract].
MURIS, D. F., K. VREEKEN, A. M. CARR, B. C. BROUGHTON, and A. R. LEHMANN et al., 1993 Cloning the RAD51 homologue of Schizosaccharomyces pombe.. Nucleic Acids Res. 21:4586-4591
OGAWA, T., X. YU, A. SHINOHARA, and E. H. EGELMAN, 1993 Similarity of the yeast Rad51 filament to the bacterial RecA filament. Science 259:1896-1899
ORIAS, E. and M. FLACKS, 1975 Macronuclear genetics of Tetrahymena. I. Random distribution of macronuclear gene copies in T. pyriformis, syngen 1. Genetics 79:187-206
PRESCOTT, D. M., 1994 The DNA of ciliated protozoa. Microbiol. Rev. 58:233-267
RINALDO, C., S. EDERLE, V. ROCCO, and A. LA VOLPE, 1998 The Caenorhabditis elegans RAD51 homolog is transcribed into two alternative mRNAs potentially encoding proteins of different sizes. Mol. Gen. Genet. 260:289-294[Medline].
SAMBROOK, J., E. F. FRITSCH and T. MANIATIS, 1989 Molecular Cloning: A Laboratory Manual, Ed. 2, Vols. 13, edited by C. NOLAN, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
SCULLY, R., J. CHEN, A. PLUG, Y. XIAO, and D. WEAVER et al., 1997 Association of BRCA1 with Rad51 in mitotic and meiotic cells. Cell 88:265-275[Medline].
SHINOHARA, A., H. OGAWA, and T. OGAWA, 1992 Rad51 protein involved in repair and recombination in S. cerevisiae is a RecA-like protein. Cell 69:457-470[Medline].
SHINOHARA, A., H. OGAWA, Y. MATSUDA, N. USHIO, and K. IKEO et al., 1993 Cloning of human, mouse and fission yeast recombination genes homologous to RAD51 and recA. Nat. Genet. 4:239-243[Medline].
SONODA, E., M. S. SASAKI, J. M. BUERSTEDDE, O. BEZZUBOVA, and A. SHINOHARA et al., 1998 Rad51-deficient vertebrate cells accumulate chromosomal breaks prior to cell death. EMBO J. 17:598-608[Medline].
STURZBECHER, H. W., B. DONZELMANN, W. HENNING, U. KNIPPSCHILD, and S. BUCHHOP, 1996 p53 is linked directly to homologous recombination processes via Rad51/RecA protein interaction. EMBO J. 15:1992-2002[Medline].
SUNG, P., 1994 Catalysis of ATP-dependent homologous DNA pairing and strand exchange by yeast Rad51 protein. Science 265:1241-1243
TAKI, T., T. OHNISHI, A. YAMAMOTO, S. HIRAGA, and N. ARITA et al., 1996 Antisense inhibition of the RAD51 enhances radiosensitivity. Biochem. Biophys. Res. Commun. 223:434-438[Medline].
THOMPSON, L. H. and D. SCHILD, 1999 The contribution of homologous recombination in preserving genome integrity in mammalian cells. Biochimie 81:87-105[Medline].
TSUZUKI, T., Y. FUJII, K. SAKUMI, Y. TOMINAGA, and K. NAKAO et al., 1996 Targeted disruption of the Rad51 gene leads to lethality in embryonic mice. Proc. Natl. Acad. Sci. USA 93:6236-6240
VISPE, S., C. CAZAUX, C. LESCA, and M. DEFAIS, 1998 Overexpression of Rad51 protein stimulates homologous recombination and increases resistance of mammalian cells to ionizing radiation. Nucleic Acids Res. 26:2859-2864
WEI, Y., L. L. YU, J. BOWEN, M. A. GOROVSKY, and C. D. ALLIS, 1999 Phosphorylation of histone H3 is required for proper chromosome condensation and segregation. Cell 97:99-109[Medline].
WU, M., C. D. ALLIS, and M. A. GOROVSKY, 1988 Cell-cycle regulation as a mechanism for targeting proteins to specific DNA sequences in Tetrahymena thermophila.. Proc. Natl. Acad. Sci. USA 85:2205-2209
XIA, S. J., M. A. SHAMMAS, and R. J. SHMOOKLER REIS, 1997 Elevated recombination in immortal human cells is mediated by HsRAD51 recombinase. Mol. Cell. Biol. 17:7151-7158[Abstract].
XU, L., B. M. WEINER, and N. KLECKNER, 1997 Meiotic cells monitor the status of the interhomolog recombination complex. Genes Dev. 11:106-118
YU, G.-L. and E. H. BLACKBURN, 1990 Amplification of tandemly repeated origin control sequences confers a replication advantage on rDNA replicons in Tetrahymena thermophila.. Mol. Cell. Biol. 10:2070-2080
YUAN, Z. M., Y. HUANG, T. ISHIKO, S. NAKADA, and T. UTSUGISAWA et al., 1998 Regulation of Rad51 function by c-Abl in response to DNA damage. J. Biol. Chem. 273:3799-3802
This article has been cited by other articles:
![]() |
E. Zweifel, J. Smith, D. Romero, T. H. Giddings Jr., M. Winey, J. Honts, J. Dahlseid, B. Schneider, and E. S. Cole Nested Genes CDA12 and CDA13 Encode Proteins Associated with Membrane Trafficking in the Ciliate Tetrahymena thermophila Eukaryot. Cell, June 1, 2009; 8(6): 899 - 912. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. E. Kirk, C. Christ, J. M. McGuire, A. G. Paul, M. Vahedi, K. R. Stuart, and E. S. Cole Abnormal Micronuclear Telomeres Lead to an Unusual Cell Cycle Checkpoint and Defects in Tetrahymena Oral Morphogenesis Eukaryot. Cell, October 1, 2008; 7(10): 1712 - 1723. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Smith, S. E. Torigoe, J. Maxson, L. C. Fish, and E. A. Wiley A Class II Histone Deacetylase Acts on Newly Synthesized Histones in Tetrahymena Eukaryot. Cell, March 1, 2008; 7(3): 471 - 482. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Cui, Y. Liu, and M. A. Gorovsky Deposition and Function of Histone H3 Variants in Tetrahymena thermophila Mol. Cell. Biol., October 15, 2006; 26(20): 7719 - 7730. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. Cervantes, R. S. Coyne, X. Xi, and M.-C. Yao The Condensin Complex Is Essential for Amitotic Segregation of Bulk Chromosomes, but Not Nucleoli, in the Ciliate Tetrahymena thermophila Mol. Cell. Biol., June 15, 2006; 26(12): 4690 - 4700. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. L. Morrison, J. S. Yakisich, D. Cassidy-Hanley, and G. M. Kapler TIF1 Represses rDNA Replication Initiation, but Promotes Normal S Phase Progression and Chromosome Transmission in Tetrahymena Mol. Biol. Cell, June 1, 2005; 16(6): 2624 - 2635. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Loidl and H. Scherthan Organization and pairing of meiotic chromosomes in the ciliate Tetrahymena thermophila J. Cell Sci., November 15, 2004; 117(24): 5791 - 5801. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Smith, J. S. Yakisich, G. M. Kapler, E. S. Cole, and D. P. Romero A {beta}-Tubulin Mutation Selectively Uncouples Nuclear Division and Cytokinesis in Tetrahymena thermophila Eukaryot. Cell, October 1, 2004; 3(5): 1217 - 1226. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Smith, E. S. Cole, and D. P. Romero Transcriptional control of RAD51 expression in the ciliate Tetrahymena thermophila Nucleic Acids Res., August 10, 2004; 32(14): 4313 - 4321. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Li, C. Chen, U. Markmann-Mulisch, L. Timofejeva, E. Schmelzer, H. Ma, and B. Reiss The Arabidopsis AtRAD51 gene is dispensable for vegetative development but required for meiosis PNAS, July 20, 2004; 101(29): 10596 - 10601. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-i. Mizuno, T. Hasemi, T. Ubukata, T. Yamada, E. Lehmann, J. Kohli, Y. Watanabe, Y. Iino, M. Yamamoto, M. E. Fox, et al. Counteracting Regulation of Chromatin Remodeling at a Fission Yeast cAMP Responsive Element-Related Recombination Hotspot by Stress-Activated Protein Kinase, cAMP-Dependent Kinase and Meiosis Regulators Genetics, December 1, 2001; 159(4): 1467 - 1478. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. J. Kim, H. Lee, E. J. Park, J. K. Park, and S. D. Park Gain- and loss-of-function of Rhp51, a Rad51 homolog in fission yeast, reveals dissimilarities in chromosome integrity Nucleic Acids Res., April 15, 2001; 29(8): 1724 - 1732. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. C. Marsh, E. S. Cole, and D. P. Romero The Transition From Conjugal Development to the First Vegetative Cell Division Is Dependent on RAD51 Expression in the Ciliate Tetrahymena thermophila Genetics, April 1, 2001; 157(4): 1591 - 1598. [Abstract] [Full Text] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Marsh, T. C.
- Articles by Romero, D. P.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Marsh, T. C.
- Articles by Romero, D. P.














