- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Macpherson, N.
- Articles by Andrews, B.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Macpherson, N.
- Articles by Andrews, B.
A Yeast taf17 Mutant Requires the Swi6 Transcriptional Activator for Viability and Shows Defects in Cell Cycle-Regulated Transcription
Neil Macphersona, Vivien Measday1,a, Lynda Moorea, and Brenda Andrewsaa Department of Molecular and Medical Genetics, University of Toronto, Toronto, Ontario M55 1A8, Canada
Corresponding author: Brenda Andrews, Department of Molecular and Medical Genetics, University of Toronto, Rm. 4285, Medical Sciences Bldg., 1 King's College Circle, Toronto, Ontario M5S 1A8, Canada., brenda.andrews{at}utoronto.ca (E-mail)
Communicating editor: A. P. MITCHELL
| ABSTRACT |
|---|
In Saccharomyces cerevisiae, the Swi6 protein is a component of two transcription factors, SBF and MBF, that promote expression of a large group of genes in the late G1 phase of the cell cycle. Although SBF is required for cell viability, SWI6 is not an essential gene. We performed a synthetic lethal screen to identify genes required for viability in the absence of SWI6 and identified 10 complementation groups of swi6-dependent lethal mutants, designated SLM1 through SLM10. We were most interested in mutants showing a cell cycle arrest phenotype; both slm7-1 swi6
and slm8-1 swi6
double mutants accumulated as large, unbudded cells with increased 1N DNA content and showed a temperature-sensitive growth arrest in the presence of Swi6. Analysis of the transcript levels of cell cycle-regulated genes in slm7-1 SWI6 mutant strains at the permissive temperature revealed defects in regulation of a subset of cyclin-encoding genes. Complementation and allelism tests showed that SLM7 is allelic with the TAF17 gene, which encodes a histone-like component of the general transcription factor TFIID and the SAGA histone acetyltransferase complex. Sequencing showed that the slm7-1 allele of TAF17 is predicted to encode a version of Taf17 that is truncated within a highly conserved region. The cell cycle and transcriptional defects caused by taf17slm7-1 are consistent with the role of TAFIIs as modulators of transcriptional activation and may reflect a role for TAF17 in regulating activation by SBF and MBF.
IN the budding yeast Saccharomyces cerevisiae, irreversible commitment to mitosis occurs late in the G1 phase of the cell cycle. Passage through the commitment phase, or START, depends on activation of the cyclin dependent kinase (Cdk) Cdc28 by association with the G1 cyclins Cln1, Cln2, and Cln3 (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
The Swi6 protein also interacts with a second DNA-binding protein, Mbp1, to form a distinct transcription factor, MBF (MCB-binding factor, also known as DSC1; ![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Although neither SWI4 nor SWI6 is an essential gene, their importance is demonstrated by the fact that a cell deleted for both SWI4 and SWI6 arrests at START (![]()
swi6
strain (![]()
![]()
mbp1
cell is alive (![]()
![]()
mbp1
cell dies prior to DNA synthesis (![]()
One implication of these observations is that there must be substantial cross talk between the SBF and MBF pathways in vivo. Indeed, MBF complex formation can be specifically competed by SCB oligomers in vitro, indicating that MBF may also bind to SCBs (![]()
![]()
![]()
or swi6
strains (![]()
![]()
A great deal of evidence suggests the existence of proteins that are functionally redundant or interact with Swi6. For example, transcription of the SWI4 gene itself is cell cycle-regulated with peak expression occurring slightly before that of HO (![]()
![]()
strains. Thus, an alternative pathway for expression of SBF- and MBF-driven genes is important for cell viability in the absence of Swi6. We reasoned that if either the redundant pathway were nonfunctional or SWI4 were turned off, cells lacking SWI6 would die. To identify factors that maintain cell viabilility in the absence of SWI6, we have performed a genetic screen for mutations that create a requirement for Swi6.
| MATERIALS AND METHODS |
|---|
Yeast strains, media, and genetic methods:
Yeast strains used in these experiments are described in Table 1. Synthetic minimal media containing glucose or galactose (SD or SG) and rich media containing glucose or galactose (YEPD or YEPG) were prepared as described (![]()
![]()
![]()
|
NY7 (MATa slm6-1), NY11 (MATa slm7-1), NY15 (MATa slm8-1), and NY34 (MAT
slm7-1) were recovered as meiotic segregants from diploids formed by mating each of NYS6 (swi6 slm6-1 [pNM1]), NYS7 (swi6 slm7-1 [pNM1]), and NYS8 (swi6 slm8-1 [pNM1]) to a wild-type strain (BY109). Segregants were tested for growth on medium lacking histidine and for death at 37° on YEPD. For construction of strain NY36 (TAF17::LEU2), plasmid pNM11, which contains a genomic fragment carrying the TAF17 gene in an integrating vector (see description below), was cleaved within the insert to direct homologous integration and transformed into a wild-type strain (JO34). As a result, the site of integration in the TAF17 gene was marked by the plasmid-borne LEU2 gene.
Plasmids:
To construct plasmid pNM1, a XhoI-BglII fragment containing the SWI6 gene (![]()
![]()
![]()
![]()
Mutagenesis:
Strain NY3 was mutagenized by exposure to ethyl methanesulfonate (EMS; Sigma Chemical Co., St. Louis). Twelve cultures of NY3 from individual colonies were grown overnight in 2 ml of YEPG. The cultures were washed, resuspended in 1.5 ml of 0.1 M sodium phosphate buffer pH 7.0, and sonicated for 10 sec to separate clumpy cells. An aliquot (200 µl) was removed to serve as an untreated control and 20 µl of EMS was added to the remaining culture. The cells were incubated with aeration at 30° for 70 min and washed in 1.5 ml of 5% sodium thiosulfate to inactivate the EMS. The cells were then washed twice in 1.5 ml of water, resuspended in 1 ml of YEPG, and plated onto YEPG plates (100 µl/plate). This treatment resulted in ~50% cell survival.
Assays of mutant phenotypes:
The colonies derived from survivors of EMS treatment were replica plated onto two 5-FOA-containing plates and two YEPD plates. One set of plates was incubated at 25° and the other at 37° for 3 days. Colonies from each 5-FOA-containing or YEPD plate were then replica plated to YEPD and incubated for 2 days at the same temperature as the previous plates. Colonies that did not grow after treatment with 5-FOA were dead because the cells could not survive without Swi6. Cells that failed to grow on YEPD died because the levels of Swi6 produced were not enough to keep the swi6
slm mutant alive or because the cells could not metabolize glucose. Colonies that did not grow after the second incubation were streak purified from the original YEPG plates and patched onto YEPG at 25°. The resulting patches were tested for growth on 5-FOA plates containing galactose as the carbon source. Mutants that grew on these plates were judged to be defective in glucose metabolism and were not studied further.
Mutants that died on YEPD or 5-FOA-containing medium at 37° were assayed for growth on YEPG at 37°. Mutants that died under these conditions were judged to be temperature sensitive in the presence of high levels of Swi6 and were not studied further. Mutants that died at 25° were not assayed in this manner, since a mutation that is synthetically lethal with swi6
at 25° could result in temperature sensitivity, even in the presence of Swi6. An example of this type of mutation is a null mutation in SWI4, which is synthetically lethal with swi6
at 25°, but which causes mutant cells to die at 37°, even in the presence of wild-type SWI6 (![]()
![]()
Cells that did not contain the pNM1 plasmid, or contained mutations in URA3, may be dying for reasons other than Swi6 levels. Mutant isolates that failed to grow on medium lacking uracil were not studied further. Mutants were also tested for rescue of FOA sensitivity by transformation with a SWI6 plasmid carrying the LEU2 nutritional marker; only those isolates rescued by transformation with the SWI6-LEU2 plasmid were studied.
Complementation and allelism tests:
The original MAT
swi6
slm isolates were mated to BY168, an isogenic MATa swi6
strain (Table 1). The mutation was judged to be dominant if the diploid was dead under nonpermissive conditions. MATa swi6
slm mutant segregants were isolated from these diploids by analyzing meiotic progeny. The MATa swi6
slm isolates were mated to MAT
swi6
strains containing a different slm mutation. The resulting diploids were tested under the most restrictive of the minimal conditions for death of the two mutants (25° on YEPD being least restrictive and 37° on 5-FOA being most restrictive) to assay for complementation of the slm mutant phenotype. If the diploid strain was unable to survive under the restrictive conditions, the slm mutants were judged to be in the same complementation group.
Representatives of each complementation group were backcrossed three times to BY165 (wild type) to obtain swi6
slm strains less likely to carry confounding secondary mutations. The resulting swi6
slm strains transformed with pNM1 are designated NYS1 through NYS10 and contain mutations in slm1 through slm10, respectively (see Table 1). The number of mutant strains in each complementation group was the following: slm1, 6 isolates; slm2, 6 isolates; slm3, 17 isolates; slm4, 2 isolates; slm5, 7 isolates; slm6, 18 isolates; slm7, 27 isolates; slm8, 15 isolates; slm9, 26 isolates; slm10, 4 isolates.
To test allelism of slm mutations with SWI4, NYS4 and NYS6 were mated to strain BY167 (swi4
). The resulting diploid was sporulated and the segregation of lethality in meiotic progeny was assessed. The allelism of TAF17 with slm7 was tested by mating NY34 (MAT
slm7-1) to NY36 (MATa TAF17::LEU2) and monitoring the segregation of leucine auxotrophy and temperature sensitivity (see RESULTS).
Cell cycle analysis:
For time course studies shown in Fig 3A, logarithmically growing cells of NYS6, NYS7, NYS8, or BY147 growing in SG medium at 25° were collected, resuspended to an OD600 of 0.2 in SD medium, and grown at 37°. In Fig 3B, log phase cultures of NY7, NY11, NY15, BY108, and JO34 in SD medium at 30° were diluted to an OD600 of 0.2 and grown in SD medium at 37°. Samples were removed from the cultures every 2 hr, fixed, and prepared for FACS analysis (![]()
|
|
|
Northern analysis:
Logarithmically growing cells of JO34 (wild type) and NY11 (slm7-1) were treated for 165 min with 3 µM
-factor, washed in ice-cold water, and resuspended in YEPD at 25°. Samples were collected at 10-min intervals over 200 min for JO34 and at 15-min intervals over 300 min for NY11, since the doubling time of NY11 is ~1.5x that of wild type. Total RNA was extracted from these samples as previously described (![]()
![]()
Measuring total mRNA in mutant cells:
Wild type (BY109), slm7-1 (NY11), taf145ts (YSW93), and rbp1-1 (Y260) cells were grown to OD600 = 0.2 at 30° and then shifted to 37°. Aliquots were taken at 0, 1, 2, and 4 hr after transfer to 37°. RNA was isolated from these pellets (see above), and 10 µg of RNA from each sample was spotted onto a nylon membrane (Hybond N+, Amersham, Buckinghamshire, UK) using a hybridot manifold (BRL). The blot was washed and then probed with 32P-labeled oligo(dT)20 as described in ![]()
Cloning of SLM7:
A yeast genomic library (![]()
The genomic insert of one of the NY11-complementing clones was sequenced and a fragment containing TAF17 was subcloned. Plasmid pNM10 (pRS315-TAF17) was then transformed into NY11 (slm7-1) and NYS7 (slm7-1 swi6
). These transformants were tested for growth on YPD at 37° and on 5-FOA at 25°, respectively. Other rescuing plasmids were tested by PCR to determine whether they contained TAF17. Primers used to amplify TAF17 were 5' primer (T17-1), GAGGATCCTTATGAACGGCGGAGG and 3' primer (T17-2), GCGGATCCTCACATAGACTTTGGG. To confirm rescue of the slm7 mutant phenotype, NY11 (slm7-1) was transformed with pZM255 (![]()
Sequencing of slm7-1:
The TAF17 locus in NY11 was amplified by PCR using primers T17-1 and T17-2 (see above). Both strands of three different PCR fragments resulting from this amplification were sequenced using primers T17-1 and T17-2.
| RESULTS |
|---|
Screen for swi6-dependent lethal mutants:
The Swi6 protein plays an important regulatory role in two transcription factors, SBF and MBF, that are required for the induction of gene expression at START in S. cerevisiae. Despite the fact that many of the genes controlled by SBF and MBF are essential for cell cycle progression, a swi6 deletion strain is viable. As such, it seemed likely that some gene(s) or pathway(s) exists in yeast cells that partially compensates for the lack of SWI6 function.
To identify genes involved in such a parallel pathway, and to identify genes that may be functioning in the same pathway as SBF, we devised a synthetic lethal screen for mutants that require SWI6 for viability. This strategy has been useful for identification of genes involved in regulating a common process (![]()
![]()
![]()
![]()
![]()
strain transformed with pNM1, a centromere-based plasmid that contains the URA3 nutritional marker and the SWI6 gene expressed from the inducible GAL1-10 promoter. When a swi6
[pNM1] strain (NY3, Table 1) was grown on glucose-containing medium, expression of SWI6 from the GAL promoter was repressed to the extent that Swi6 was undetectable by Western blotting using anti-Swi6 antiserum (data not shown). However, a more sensitive biological assay revealed some residual SWI6 expression from the glucose-repressed GAL1-10 promoter on the pNM1 plasmid. Whereas a swi4
swi6
[pGAL::SWI4] strain (BY147) dies on glucose-containing media due to inadequate expression of G1 cyclins (![]()
mutant background. Given this observation, we mutagenized swi6
[pNM1] cells and screened for Swi6-dependent viability in two ways: (1) on glucose-containing medium to decrease expression of SWI6 from the GAL promoter on pNM1 to very low levels and (2) on 5-FOA-containing medium to select for cells that had lost the URA3-containing plasmid (![]()
Initial characterization of slm mutants:
We screened ~40,000 colonies from 12 independent pools of strain NY3 treated with EMS for their ability to grow on YEPD (glucose-containing) or 5-FOA-containing medium. Colonies were also tested for their ability to grow at both high (37°) and low (25°) temperatures to allow for identification of temperature-sensitive slm mutants. In this way, a total of 244 colonies were identified that failed to grow on YEPD or 5-FOA at 25° or 37°. Of these mutant isolates, 58 were defective in glucose metabolism, 20 carried mutations conferring temperature-sensitive lethality that was independent of Swi6, and 4 were unable to grow on medium lacking uracil (see MATERIALS AND METHODS). The remaining 162 isolates showed different minimal conditions required for lethality (Fig 1, data not shown). We mated the 162 strains to the parental swi6
strain and found that all but one of the mutations tested were recessive.
To determine the number of loci that were represented by the 161 recessive SWI6-requiring mutant strains, a complementation test was performed. Diploids created by pairwise crossing of the haploid mutants (see MATERIALS AND METHODS) were tested for the ability to grow in the absence of Swi6. Of the 161 slm strains, 128 fell into 10 complementation groups designated SLM1 through SLM10. The 34 mutants that did not fit into these 10 groups were either found in multiple complementation groups or were not members of any of the 10 complementation groups. Representatives of each complementation group were backcrossed to an isogenic swi6
[pNM1] strain. The resulting strains containing mutations in SLM1 through SLM10 were designated NYS1 through NYS10 (Fig 1).
Rescue of slm mutants by SWI4:
We expected to isolate mutants defective in SWI4 in our screen, since swi4
swi6
strains are inviable (![]()
strains were tested for suppression of the swi6-dependent synthetic lethality by transformation with a plasmid carrying the SWI4 gene (Fig 2 and data not shown). Viability was restored to both NYS4 and NYS6 when they were transformed with a centromere-derived plasmid containing the SWI4 gene, but not when transformed with vector alone (Fig 2). To test whether the slm4 mutant harbored a mutation in SWI4, we crossed a slm4 swi6
[pNM1] strain to a swi4
SWI6 strain (NYS4 x BY167) and subjected the diploids to tetrad analysis. Of 10 tetrads analyzed, all had two viable and two inviable meiotic segregants when tested on 5-FOA-containing medium to select against the plasmid-borne SWI6 gene (Table 2). This 2:2 segregation pattern, which reflects lack of recombination between swi4 and slm4, showed that SLM4 and SWI4 were indeed allelic.
|
We performed a similar segregation test with a slm6 mutant strain by crossing a slm6 swi6
[pNM1] strain to the swi4
SWI6 strain (NYS6 x BY167). In this case, 12 tetrads were recovered on galactose-containing medium and meiotic segregants were tested for viability on 5-FOA-containing medium at 25° (the restrictive conditions for the slm6 allele used in the cross). Some of the tetrads yielded progeny with 3:1 and 4:0 segregation of viability:lethality, indicating the recovery of SLM6 and SWI4 recombinants (Table 2). We conclude that, although the slm6 swi6
lethality is rescued by ectopic expression of SWI4, the slm6 strain is mutated at a locus that is unlinked to SWI4.
Cell cycle phenotypes of the slm mutants:
If an alternative pathway for expression of SBF- or MBF-driven genes were impaired in a slm mutant, the swi6
slm double mutant might be expected to show a specific cell cycle-arrest phenotype. Since we were particularly interested in any mutants that might identify pathways that function together with Swi6 to regulate gene expression at START, we used FACS analysis to examine the arrest phenotype of the swi6
slm mutants [slm4 (swi4) and mutants were not examined; slm2 and slm5 mutant strains were extremely clumpy and reproducible FACS profiles were difficult to obtain]. Four slm mutants do not show a cell cycle-specific arrest: slm1, slm3, slm9, and slm10 (data not shown). Neither the FACS profiles nor the budding index of these mutants was altered when cells were arrested under nonpermissive conditions (data not shown).
Three other slm swi6
mutants did show a cell cycle-arrest phenotype when incubated under restrictive conditions. Both slm7 and slm8 strains showed a uniform morphological arrest with 8592% large, unbudded cells in the cultures after an 8-hr incubation in the nonpermissive conditions (467/508 unbudded cells for slm7 and 435/514 unbudded cells for slm8; Fig 3A, slm7-1 swi6, slm8-1 swi6). Arrest as large, unbudded cells is typical of cells unable to execute START, such as those deleted for both SWI4 and SWI6 (swi4 swi6, Fig 3A).
Although the morphological arrest phenotype of the slm7 and slm8 cells was uniform, the FACS profile of the slm7-1 swi6
and slm8-1 swi6
mutants under nonpermissive conditions showed some cells in G2. The nonuniformity of the arrest may reflect residual SWI6 or SLM gene function allowing DNA replication in some cells in the culture or it may reflect an uncoupling of the bud morphogenesis and DNA replication pathways in cells lacking Swi6 and Slm7 or Slm8. In any case, the arrest phenotype is consistent with a redundant role for SLM7 and SLM8 with SWI6 in regulating G1 progression. DAPI staining did not reveal any obvious nuclear defects in arresting swi6 slm7 or swi6 slm8 cells.
In contrast to slm7 and slm8, the FACS profile of the slm6 swi6
double mutants showed a shift to a larger G2 peak under nonpermissive conditions (Fig 3A, slm6-1 swi6). After 4 hr in arrest conditions, some of the NYS6 cells were multiply budded with only one or two nuclei visible by DAPI staining. After 8 hr, the majority of the swi6
slm6 cells were arrested as uninucleate cells with elongated buds (Fig 3A, slm6-1 swi6, 8 hr). Some of these cells did not appear to have nuclei, even at permissive temperatures, indicating a possible nuclear migration defect in swi6
slm6 cells.
For cell cycle analysis of the slm swi6 [pGAL::SWI6] mutants, there were two changes to the growth conditions: the carbon source for the cells was changed from galactose to glucose and the temperature was raised from 25° to 37°. To eliminate the effects of changing both the carbon source and the level of Swi6 protein, we examined the slm mutants in an otherwise wild-type background (slm SWI6). We recovered meiotic segregants from diploids formed by mating NYS6, 7, and 8 to wild-type (JO34) cells. The slm6-1 SWI6 strain (NY7) was not temperature sensitive and showed no cell cycle-specific defects (Fig 3B). In contrast, spores that carried a wild-type SWI6 gene (His-) but were still temperature sensitive for viability (on YEPD at 37°) were recovered with a frequency consistent with slm7-1 and slm8-1 strains having a temperature-sensitive growth defect in an otherwise wild-type (SWI6) background. For the slm7-1 strain, this result was not unexpected since the slm7-1 swi6 isolates showed synthetic lethality at low temperature (25°) and were not originally screened for temperature sensitivity on galactose-containing medium (see MATERIALS AND METHODS and Fig 1). However, the slm8 swi6
mutant showed synthetic lethality only at high temperature and the double mutant strain grew well on galactose-containing medium at 37° (see Fig 1). We conclude that the temperature-sensitive phenotype of the slm8-1 mutant strain was suppressed by overexpression of SWI6 on galactose-containing medium at 37° (Fig 1, NYS8). We also saw this suppression when a high-copy (2µ) plasmid containing SWI6 was used to transform the slm8 strain (data not shown).
When incubated at the restrictive temperature, the slm7-1 SWI6 strain (NY11) showed a similar FACS profile to the wild-type control strain (JO34, Fig 3B), and no uniform morphological arrest was observed. Therefore, the G1 arrest phenotype that we observe in the slm7-1 swi6 double mutant at low temperature requires mutation of both slm7 and swi6. By contrast, FACS analysis of a culture of slm8-1 SWI6 cells (NY15) showed an accumulation of cells with 1N DNA content, with the majority of the cells arresting before 2 hr (Fig 3B). This 1N accumulation was not accompanied by a morphological arrest, as many of the cells continued to bud and did not become appreciably larger during continued incubation at the restrictive temperature. We conclude that mutation of SLM8 causes a defect in S-phase progression that results in a G1 arrest phenotype in the absence of Swi6.
Analysis of cell cycle-regulated gene expression in a slm7 mutant:
In our synthetic lethal screen with SWI6, we expected to isolate genes that, like SWI6, were involved in controlling cell cycle-regulated transcription. We therefore examined the transcript levels of cell cycle-regulated genes in slm6-1, slm7-1, and slm8-1 strains. We analyzed gene expression at the permissive temperature (25°) since defects in gene expression seen under permissive growth conditions are likely to reflect a true gene expression defect as opposed to a secondary phenotype due to growth arrest.
Yeast cells were arrested at START with mating pheromone (
-factor), released into fresh medium, and RNA was prepared from samples of the cells as the culture progressed synchronously through the cell cycle. To accommodate the longer cell cycle in the slm7 mutant, we harvested cells for a longer period of time and sampled every 15 min, instead of every 10 min for the wild-type culture. Northern blot analysis of RNA samples showed that only the slm7-1 SWI6 strain displayed defects in cell cycle-regulated transcription (Fig 4 and data not shown for slm8-1, slm6-1). The maximal level of expression of the cell cycle-regulated gene PCL2, whose expression depends on SBF, and of CLB5, whose expression depends on MBF, was reproducibly reduced at START in cells containing the slm7-1 mutation (peak expression reduced up to 2.5-fold for CLB5 and 2.3-fold for PCL2). However, the maximal level of expression of the CLN2, PCL1 (SBF-dependent), and PCL9 (Swi5-dependent) genes was normal (Fig 4, data not shown for PCL1). We also examined cell cycle-regulated expression of the G2-regulated gene SWI5 to control for changes in synchrony between the wild-type and slm7 SWI6 mutant cultures. The levels of SWI5 transcript indicated that both the wild-type and slm7 SWI6 cultures progressed synchronously through two cell cycles, although some loss of synchrony was observed in the second cell cycle in the slm7-1 SWI6 culture.
|
A slm7-1 swi6
[pNM1] strain dies in the presence of 5-FOA at 25° (Fig 1) and arrests in G1 phase at high temperature (Fig 3A). However, a slm7-1 SWI6 cell does not show a cell cycle-specific defect at 37° (Fig 3B). It is possible that the lack of a cell-cycle specific arrest by the slm7-1 SWI6 at the restrictive temperature indicates that slm7-1 mutants have a general transcriptional defect, not a specific defect in cyclin transcription. To test whether a slm7-1 strain was generally defective in transcription, wild type (BY109), slm7-1 (NY11), taf145ts (YSW93), and rbp1-1 (Y260) strains were grown to log phase at 30° and shifted to 37°. RBP1 encodes the largest subunit of RNA polymerase II and cells containing the rbp1-1 mutation show a rapid decrease in overall transcript levels at the restrictive temperature. By contrast, cells carrying a temperature-sensitive allele of the gene encoding the TATA-binding protein (TBP)-associated factor Taf145 (taf145ts) do not have a general transcriptional defect but do have a specific defect in cyclin transcription (![]()
|
Rescue of slm7-1:
We were interested in identifying the mutated genes in those slm strains that showed a defect in cell cycle-regulated transcription and we focused our attention on SLM7. To clone SLM7, we transformed the slm7-1 (NY11) strain with a genomic library (![]()
background (data not shown). Confirmation that the rescue was attributable to the TAF17 gene and not other genomic sequences was provided by expressing TAF17 from the galactose-inducible GAL1-10 promoter (![]()
|
To ask if slm7-1 corresponds to a mutant allele of TAF17, we used an integrating plasmid to target LEU2 to the TAF17 locus without disrupting the gene. The TAF17::LEU2 strain (NY36) was crossed to a slm7-1 strain (NY34). The TAF17::LEU2/slm7-1 diploid was sporulated and the progeny of the resulting tetrads tested for growth on media lacking leucine (caused by the LEU2 gene) and for death on SD at 37° (caused by the slm7-1 mutation). Of 26 tetrads tested, no progeny showed cosegregation of LEU2 and slm7, indicating that SLM7 is allelic to TAF17.
To identify the TAF17 mutation in the slm7-1 strain, we used whole cell PCR to amplify the TAF17 gene from strain NY11 (slm7-1). Both strands of three different PCR fragments were sequenced and the resulting sequences compared to the Saccharomyces Genome Database sequence. All six sequences were in agreement and showed that the slm7-1 mutation changed codon 133 of TAF17 from a tryptophan codon (TGG) to an amber stop codon (TAG). The mutated gene is predicted to encode a Taf17 derivative lacking the C-terminal 25 amino acids, which include a conserved region of 11 amino acids (Fig 7). We conclude that mutation of the Taf17 protein can lead to defects in G1-regulated gene expression and causes cell cycle arrest in G1 phase when Swi6 levels are low and the cells are grown under nonpermissive conditions.
|
| DISCUSSION |
|---|
Swi6 is a regulatory component of two transcription factors, SBF and MBF, that promote G1-specific transcription of a number of genes that are essential for START and S-phase in budding yeast (reviewed in ![]()
![]()
![]()
Cell cycle-arrest phenotypes of slm6-1 swi6 and slm8-1 swi6 mutants:
In this screen we hoped to identify genes involved in activating SBF- and MBF-driven gene expression in the absence of SWI6. We identified mutations in three complementation groups, slm6, slm7, and slm8, that died in the absence of Swi6 and had a uniform morphological arrest; the arrest phenotype of these strains was not rescued by overexpression of the cyclins PCL2, CLB5, or CLN2 (data not shown). To date, we have identified the mutated gene in the slm7 strains and we discuss this result below. However, the arrest phenotypes of the slm6 and slm8 strains suggest that further analysis of the SLM6 and SLM8 genes will be of some interest. A slm6-1 mutation caused swi6 cells to accumulate in G2 phase with elongated buds and this arrest could be overcome by increasing the copy number of SWI4. The arrest phenotype of slm6-1 swi6 mutants may reflect a problem with budding or cell wall biosynthesis. Both the SBF and the Pkc1/Slt2 mitogen-activated protein (MAP) kinase pathway are required for maximal induction of cell wall biosynthetic genes encoding proteins used in budding (![]()
![]()
![]()
![]()
In contrast to slm6, the slm8 mutation caused a temperature-dependent accumulation of cells in G1 and cell death in the absence of SWI6. In addition, mutation of SLM8 in the presence of wild-type SWI6 caused a marked accumulation of cells with 1N DNA content when these cells were shifted from 25° to 37°. The arrest of NY15 cells with G1 DNA content was not accompanied by a morphological G1 arrest. Rather, these cells continued to produce buds, indicating that in slm8 swi6 cells budding and DNA synthesis may be unlinked. At the restrictive temperature, swi4
cells arrest with the opposite phenotype (BY108, Fig 3B), as large unbudded cells with mixed DNA content (![]()
![]()
slm7-1 is allelic with the gene encoding the histone H3-like protein Taf17:
Complementation and allelism tests revealed that slm7-1 was allelic to TAF17. TAF17 is an essential gene encoding the TBP-associated factor Taf17/Taf20. Taf17 is one of several TBP-associated factors (TAFIIs) that are subunits of the general transcription factor IID (TFIID). TFIID and other general transcription factors are components of the RNA polymerase II holoenzyme (reviewed in ![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
yTaf145 has histone acetylase activity and this activity resides in the region most conserved between mammals and yeast (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
slm7-1 (taf17) mutants show transcriptional defects in cell cycle-regulated genes:
Cells containing temperature-sensitive mutations in some TafIIs show broad defects in transcriptional activation under nonpermissive conditions, but these defects are not global (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Genome-wide assessment of transcript levels using DNA microarrays in strains carrying temperature-sensitive mutations in Taf17 shows that Taf17 is required for transcription of ~67% of genes tested under restrictive conditions (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
The stability of the Taf17slm7-1 protein has not been established, so the defects in transcription observed in taf17slm7-1 cells may be due to degradation of Taf17slm7-1 and associated proteins and not due to the specific mutation in Taf17slm7-1. However, the taf17slm7-1 mutation is predicted to encode a Taf17 derivative with an intact histone fold, but with a deletion encompassing a highly conserved region outside the histone fold. Since the histone fold of Taf17slm7-1 is intact, this Taf17 variant may interact normally with the other components of the histone-like Taf octamer, and its association with other proteins may promote the stability of Taf17-containing complexes.
The specific defects in cell cycle-regulated transcription in taf17slm7-1 cells suggest that the Taf17slm7-1 protein may only be of regulatory importance in the context of certain promoters. Our data suggest that the CLB5 and PCL2 promoters are partially Taf17 dependent and that CLN2, PCL1, and PCL9 expression is relatively independent of Taf17. Our results agree in part with the DNA microarray analysis on the taf17ts mutant strains described above (http://gaiberg.wi.mit.edu/cgi-bin/young_public/factor.cgi?gene=TAF17) (![]()
![]()
Reasons for synthetic lethality of mutations in TAF17 and mutations in SWI6:
We consider two possible explanations for the synthetic lethality of mutations in SWI6 and mutations in TAF17. Either SCB and/or MCB-driven transcription is Taf17 dependent, or SCBs and MCBs are Taf17 independent and Taf17 controls cell cycle-regulated transcription through other elements. If SCBs and MCBs are Taf17 dependent, the synthetic lethality of mutations in TAF17 and mutations in SWI6 may be due to reduced induction of SBF- or MBF-dependent genes. In swi6 cells, induction of SCB-containing promoters at Start is reduced relative to wild type (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
If SCBs and MCBs are Taf17 independent, there are two possibilities that may explain the synthetic lethality of mutations in SWI6 and mutations in TAF17. First, SBF- or MBF-dependent genes may contain Taf17-dependent elements that are distinct from SCBs and MCBs. Alternatively, Taf17 may activate transcription of SBF- or MBF-independent genes that are necessary for progression through Start in the absence of Swi6. In both these cases, the synthetic lethality of mutations in TAF17 and mutations in SWI6 may be due to a defect in cell cycle regulation by other transcriptional activators. An example of an SBF- and MBF-independent element that could be Taf17 dependent is the ECB promoter element. ECB elements are found upstream of cell cycle-regulated genes, including SWI4, and are under the control of the Mcm1 protein and perhaps other proteins (![]()
Role of chromatin-remodeling complexes in transcriptional activation by SBF or MBF:
Recent chromatin immunoprecipitation experiments have shown that two chromatin remodelling complexes, SAGA and Swi/Snf, facilitate the binding of SBF to the HO promoter in G1 phase (![]()
![]()
![]()
![]()
![]()
![]()
In summary, we have found mutations in 10 genes, SLM110, that are synthetically lethal with deletion of SWI6. Mutations in one of the SLM genes, SLM6, caused swi6
cells to accumulate in G1 phase and may lead to a defect in budding or cell wall biosynthesis. Two mutations, in slm7 and slm8, caused accumulation in G1 phase in a swi6 mutant background. The slm7-1 mutant had altered cell cycle-regulated transcription of some genes that are controlled by SBF and MBF. We cloned the SLM7 gene and showed that it is allelic with TAF17. Our data strongly implicate transcriptional regulatory complexes containing Taf17 in cell cycle-regulated transcription by SBF and MBF.
| FOOTNOTES |
|---|
1 Present address: Centre for Molecular Medicine and Therapeutics, University of British Colombia, Vancouver V5Z 4H4, Canada. ![]()
| ACKNOWLEDGMENTS |
|---|
We thank Helena Friesen, Lea Harrington, Andrew Spence, and Mike Tyers for comments on the manuscript and Jacqueline Segall for helpful discussions. This work was supported by a grant from the Medical Research Council of Canada to B.J.A., who holds a Scientist award from the same agency. N.M. was supported in part by a University of Toronto Open Fellowship.
Manuscript received September 29, 1999; Accepted for publication January 5, 2000.
| LITERATURE CITED |
|---|
AMON, A., M. TYERS, B. FUTCHER, and K. NASMYTH, 1993 Mechanisms that help the yeast cell cycle clock tick: G2 cyclins transcriptionally activate G2 cyclins and repress G1 cyclins. Cell 74:993-1007[Medline].
ANDREWS, B. J. and I. HERSKOWITZ, 1989a Identification of a DNA binding factor involved in cell cycle-control of the yeast HO gene. Cell 57:21-29[Medline].
ANDREWS, B. J. and I. HERSKOWITZ, 1989b The yeast Swi4 protein contains a motif present in developmental regulators and is part of a complex involved in cell cycle-dependent transcription. Nature 342:830-833[Medline].
ANDREWS, B. J. and L. MOORE, 1992 Interaction of the yeast Swi4 and Swi6 cell cycle regulatory proteins in vitro.. Proc. Natl. Acad. Sci. USA 89:11852-11856
APONE, L. M., C.-M. A. VIRBASIUS, J. C. REESE, and M. R. GREEN, 1996 Yeast TAFII90 is required for cell-cycle progression through G2/M but not for general transcription activation. Genes Dev. 10:2368-2380
APONE, L., C. VIRBASIUS, F. HOLSTEGE, J. WANG, and R. YOUNG et al., 1998 Broad, but not universal, transcriptional requirement for yTAFII17, a histone H3-like TAFII present in TFIID and SAGA. Mol. Cell 2:653-661[Medline].
BENDER, A. and J. R. PRINGLE, 1991 Use of a screen for synthetic lethal and multicopy suppressor mutants to identify two new genes involved in morphogenesis in Saccharomyces cerevisiae.. Mol. Cell. Biol. 11:1295-1305
BERK, A. J., 1999 Activation of RNA polymerase II transcription. Curr. Opin. Cell Biol. 11:330-335[Medline].
BOEKE, J. D., F. LACROUTE, and G. R. FINK, 1984 A positive selection for mutants lacking orotidine-5'-phosphate decarboxylase activity in yeast: 5-fluoro-orotic acid resistance. Mol. Gen. Genet. 197:345-346[Medline].
BREEDEN, L., 1995 Start-specific transcription in yeast. Curr. Top. Microbiol. Immunol. 208:95-127.
BREEDEN, L. and G. E. MIKESELL, 1991 Cell cycle-specific expression of the SWI4 transcription factor is required for cell cycle regulation of HO transcription. Genes Dev. 5:1183-1190
BREEDEN, L. and G. MIKESELL, 1994 Three independent forms of regulation affect expression of HO, CLN1 and CLN2 during the cell cycle of Saccharomyces cerevisiae.. Genetics 138:1015-1024[Abstract].
BREEDEN, L. and K. NASMYTH, 1987a Cell cycle control of the yeast HO gene: cis and trans acting regulators. Cell 48:389-397[Medline].
BREEDEN, L. and K. NASMYTH, 1987b Similarity between the cell cycle genes of fission yeast and budding yeast and the Notch gene of Drosophila. Nature 329:651-654[Medline].
BURLEY, S. and R. ROEDER, 1996 Biochemistry and structural biology of transcription factor IID (TFIID). Annu. Rev. Biochem. 65:769-799[Medline].
CHO, R., M. CAMPBELL, E. WINZELER, L. STEINMETZ, and A. CONWAY et al., 1998 A genome-wide transcriptional analysis of the mitotic cell cycle. Mol. Cell 2:65-73[Medline].
COSMA, M. P., T. TANAKA, and K. NASMYTH, 1999 Ordered recruitment of transcription and chromatin remodeling factors to a cell cycle-regulated and developmentally regulated promoter. Cell 97:299-311[Medline].
COSTIGAN, C., S. GEHRUNG, and M. SNYDER, 1992 A synthetic lethal screen identifies SLK1, a novel protein kinase homolog implicated in yeast cell morphogenesis and cell growth. Mol. Cell. Biol. 12:1162-1178
CROSS, F., M. HOEK, J. D. MCKINNEY, and A. H. TINKELENBERG, 1994 Role of Swi4 in cell cycle regulation of CLN2 expression. Mol. Cell. Biol. 14:4779-4787
DIRICK, L., T. MOLL, H. AUER, and K. NASMYTH, 1992 A central role for SWI6 in modulating cell cycle Start-specific transcription in yeast. Nature 357:508-513[Medline].
DIRICK, L., T. BOHM, and K. NASMYTH, 1995 Roles and regulation of the Cln-Cdc28 kinases at the start of the cell cycle of Saccharomyces cerevisiae.. EMBO J. 14:4803-4813[Medline].
DRYSDALE, C., B. JACKSON, R. MCVEIGH, E. KLEBANOW, and Y. BAI et al., 1998 The Gcn4p activation domain interacts specifically in vitro with RNA polymerase II holoenzyme, TFIID, and the Adap-Gcn5p coactivator complex. Mol. Cell. Biol. 18:1711-1724
ENGEBRECHT, J., J. HIRSCH, and G. S. ROEDER, 1990 Meiotic gene conversion and crossing over: their relationship to each other and to chromosome synapsis and segregation. Cell 62:927-937[Medline].
ESPINOZA, F. H., J. OGAS, I. HERSKOWITZ, and D. O. MORGAN, 1994 Cell cycle control by a complex of the cyclin HCS26(PCL1) and the kinase PHO85. Science 266:1388-1391
FERNANDEZ-SARABIA, M. J., A. SUTTON, T. ZHONG, and K. T. ARNDT, 1992 SIT4 protein phosphatase is required for the normal accumulation of SWI4, CLN1, CLN2 and HCS26 RNAs during late G1. Genes Dev. 6:2417-2428
FOSTER, R., G. E. MIKESELL, and L. BREEDEN, 1993 Multiple Swi6-dependent cis-acting elements control SWI4 transcription through the cell cycle. Mol. Cell. Biol. 13:3972-3801.
GIETZ, D., A. ST. JEAN, R. A. WOODS, and R. H. SCHIESTL, 1992 Improved method for high efficiency transformation of intact yeast cells. Nucleic Acids Res. 20:1425
GOODRICH, J., T. HOEY, C. THUT, A. ADMON, and R. TJIAN, 1993 Drosophila TAFII40 interacts with both a VP16 activation domain and the basal transcription factor TFIIB. Cell 75:519-530[Medline].
GRANT, P., L. DUGGAN, J. COTE, S. ROBERTS, and J. BROWNELL et al., 1997 Yeast Gcn5 functions in two multisubunit complexes to acetylate nucleosomal histones: characterization of an Ada complex and the SAGA (Spt/Ada) complex. Genes Dev. 11:1640-1650
GRANT, P., D. SCHIELTZ, M. PRAY-GRANT, D. STEGER, and J. REESE et al., 1998 A subset of TAF(II)s are integral components of the SAGA complex required for nucleosome acetylation and transcriptional stimulation. Cell 94:45-53[Medline].
GRAY, J., J. OGAS, Y. KAMADA, M. STONE, and D. LEVIN et al., 1997 A role for the Pkc1 MAP kinase pathway of Saccharomyces cerevisiae in bud emergence and identification of a putative upstream regulator. EMBO J. 16:4924-4937[Medline].
GUARENTE, L., 1993 Synthetic enhancement in gene interaction: a genetic tool come of age. Trends Genet. 9:362-366[Medline].
GUPTA, S., J. KECECIOGLU, and A. SCHAFFER, 1995 Improving the practical space and time efficiency of the shortest-paths approach to sum-of-pairs multiple sequence alignment. J. Computational Biol. 2:459-472.
HARRINGTON, L. A. and B. J. ANDREWS, 1996 Binding to the yeast Swi4,6-dependent cell cycle box, CACGAAA, is cell cycle regulated in vivo.. Nucleic Acids Res. 24:558-565
HISATAKE, K., S. HASEGAWA, R. TAKEDA, Y. NAKATANI, and M. HORIKOSHI et al., 1993 The p250 subunit of native TATA-binding factor TFIID is the cell cycle regulatory protein CCG1. Nature 362:179-181[Medline].
HOFFMANN, A., C. CHIANG, T. OELGESCHLAGER, X. XIE, and S. BURLEY et al., 1996 A histone octamer-like structure within TFIID. Nature 380:356-359[Medline].
HOLSTEGE, F., E. JENNINGS, J. WYRICK, T. LEE, and C. HENGARTNER et al., 1998 Dissecting the regulatory circuitry of a eukaryotic genome. Cell 95:717-728[Medline].
HOLTZMAN, D. A., S. YANG, and D. DRUBIN, 1993 Synthetic-lethal interactions identify two novel genes, SLA1 and SLA2, that control membrane cytoskeleton assembly in Saccharomyces cerevisiae.. J. Cell Biol. 122:635-644
IGUAL, J. C., A. L. JOHNSON, and L. H. JOHNSTON, 1996 Coordinated regulation of gene expression by the cell cycle transcription factor Swi4 and the protein kinase C MAP kinase pathway for yeast cell integrity. EMBO J. 15:5001-5013[Medline].
KLEMM, R., J. GOODRICH, S. ZHOU, and R. TJIAN, 1995 Molecular cloning and expression of the 32-kDa subunit of human TFIID reveals interactions with VP16 and TFIIB that mediate transcriptional activation. Proc. Natl. Acad. Sci. USA 92:5788-5792
KOCH, C. and K. NASMYTH, 1994 Cell cycle regulated transcription in yeast. Curr. Opin. Cell Biol. 6:451-459[Medline].
KOCH, C., T. MOLL, M. NEUBERG, H. AHORN, and K. NASMYTH, 1993 A role for the transcription factors Mbp1 and Swi4 in progression from G1 to S phase. Science 261:1551-1557
KOCH, C., A. SCHLEIFFER, G. AMMERER, and K. NASMYTH, 1996 Switching transcription on and off during the yeast cell cycle: Cln/Cdc28 kinases activate bound transcription factor SBF (Swi4/Swi6) at Start, whereas Clb/Cdc28 kinases displace it from the promoter in G2. Genes Dev. 10:129-141
LOWNDES, N. F., A. L. JOHNSON, and L. H. JOHNSTON, 1991 Coordination of expression of DNA synthesis genes in budding yeast by a cell-cycle regulated trans factor. Nature 350:247-250[Medline].
LOWNDES, N. F., A. L. JOHNSON, L. BREEDEN, and L. H. JOHNSTON, 1992 SWI6 protein is required for transcription of the periodically expressed DNA synthesis genes in budding yeast. Nature 357:505-508[Medline].
LU, H. and A. LEVINE, 1995 Human TAFII31 protein is a transcriptional coactivator of the p53 protein. Proc. Natl. Acad. Sci. USA 92:5154-5158
MADDEN, K., Y.-J. SHEU, K. BAETZ, B. ANDREWS, and M. SNYDER, 1997 SBF cell cycle regulator as a target of the yeast PKC-MAP kinase pathway. Science 275:1781-1784
MARTIN, J., R. HALENBECK, and J. KAUFMANN, 1999 Human transcription factor hTAFII150(CIF150) is involved in transcriptional regulation of cell cycle progression. Mol. Cell. Biol. 19:5548-5556
MCINERNY, C. J., J. F. PARTRIDGE, G. E. MIKESELL, D. P. CREEMER, and L. L. BREEDEN, 1997 A novel Mcm1-dependent promoter element in the SWI4, CLN3, CDC6, and CDC47 promoters activates M/G1-specific transcription. Genes Dev. 11:1277-1288
MEASDAY, V., L. MOORE, J. OGAS, M. TYERS, and B. ANDREWS, 1994 The PCL2 (ORFD)-PHO85 cyclin-dependent kinase complex: a cell cycle regulator in yeast. Science 266:1391-1395
MEASDAY, V., L. MOORE, R. RETNAKARAN, J. LEE, and M. DONOVIEL et al., 1997 A family of cyclin-like proteins that interact with the cyclin-dependent kinase, Pho85. Mol. Cell. Biol. 17:1212-1223
MICHEL, B., P. KOMARNITSKY, and S. BURATOWSKI, 1998 Histone-like TAFs are essential for transcription in vivo. Mol. Cell 2:663-673[Medline].
MIZZEN, C., X. YANG, T. KOKUBO, J. BROWNELL, and A. BANNISTER et al., 1996 The TAF(II)250 subunit of TFIID has histone acetyltransferase activity. Cell 87:1261-1270[Medline].
MOQTADERI, Z., Y. BAI, D. POON, P. WEIL, and K. STRUHL, 1996a TBP-associated factors are not generally required for transcriptional activation in yeast. Nature 383:188-191[Medline].
MOQTADERI, Z., J. DEPAULO YALE, K. STRUHL, and S. BURATOWSKI, 1996b Yeast homologues of higher eukaryotic TFIID subunits. Proc. Natl. Acad. Sci. USA 93:14654-14658
MOQTADERI, Z., M. KEAVENEY, and K. STRUHL, 1998 The histone H3-like TAF is broadly required for transcription in yeast. Mol. Cell 2:675-682[Medline].
NAKATANI, Y., S. BAGBY, and M. IKURA, 1996 The histone folds in transcription factor TFIID. J. Biol. Chem. 271:6575-6578
NASMYTH, K., 1985 A repetitive DNA sequence that confers cell-cycle START (CDC28) dependent transcription of the HO gene in yeast. Cell 42:225-235[Medline].
NASMYTH, K. and L. DIRICK, 1991 The role of SWI4 and SWI6 in the activity of G1 cyclins in yeast. Cell 66:995-1013[Medline].
NATARAJAN, K., B. JACKSON, E. RHEE, and A. HINNEBUSCH, 1998 yTAFII61 has a general role in RNA polymerase II transcription and is required by Gcn4p to recruit the SAGA coactivator complex. Mol. Cell 2:683-692[Medline].
OGAS, J., B. J. ANDREWS, and I. HERSKOWITZ, 1991 Transcriptional activation of CLN1, CLN2 and a putative new G1 cyclin (HCS26) by SWI4, a positive regulator of G1 specific transcription. Cell 66:1015-1026[Medline].
PARTRIDGE, J. F., G. E. MIKESELL, and L. L. BREEDEN, 1997 Cell cycle-dependent transcription of CLN1 involves Swi4 binding to MCB-like elements. J. Biol. Chem. 272:9071-9077
PRIMIG, M., S. SOCKANATHAN, H. AUER, and K. NASMYTH, 1992 Anatomy of a transcription factor important for the start of the cell cycle in S. cerevisiae.. Nature 358:593-597[Medline].
RUPPERT, S., E. H. WANG, and R. TJIAN, 1993 Cloning and expression of human TAFII250: a TBP-associated factor implicated in cell-cycle regulation. Nature 362:175-179[Medline].
SCHWOB, E. and K. NASMYTH, 1993 CLB5 and CLB6, a new pair of B cyclins involved in DNA replication in Saccharomyces cerevisiae.. Genes Dev. 7:1160-1175
SEKIGUCHI, T., Y. NOHIRO, Y. NAKAMURA, N. HISAMOTO, and T. NISHIMOTO, 1991 The human CCGI gene, essential for progression of the G1 phase, encodes a 210-kilodalton nuclear DNA-binding protein. Mol. Cell. Biol. 11:3317-3325
SHEN, W. and M. GREEN, 1997 Yeast TAF(II)145 functions as a core promoter selectivity factor, not a general coactivator. Cell 90:615-624[Medline].
SHERMAN, F., and J. HICKS, 1991 Micromanipulation and dissection of asci, pp. 2137 in Guide to Yeast Genetics and Molecular Biology, edited by C. GUTHRIE and G. FINK. Academic Press, San Diego.
SIDOROVA, J. and L. BREEDEN, 1993 Analysis of the SWI4/SWI6 protein complex, which directs G1/S-phase specific transcription in Saccharomyces cerevisiae. Mol. Cell. Biol. 13:1069-1077
SIEGMUND, R. F. and K. NASMYTH, 1996 The Saccharomyces cerevisiae Start-specific transcription factor Swi4 interacts through the ankyrin repeats with the mitotic Clb2/Cdc28 kinase and through its conserved carboxy terminus with Swi6. Mol. Cell. Biol. 16:2647-2655
SIKORSKI, R. S. and P. HIETER, 1989 A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.. Genetics 12:19-27.
SPELLMAN, P. T., G. SHERLOCK, M. Q. ZHANG, R. I. VISHWANATH, and K. ANDERS et al., 1998 Comprehensive identification of cell cycle-regulated genes of the yeast Saccharomyces cerevisiae by microarray hybridization. Mol. Biol. Cell 9:3273-3297
STUART, D. and C. WITTENBERG, 1994 Cell cycle-dependent transcription of CLN2 is conferred by multiple distinct cis-acting regulatory elements. Mol. Cell. Biol. 14:4788-4801
STUART, D. and C. WITTENBERG, 1995 CLN3, not positive feedback, determines the timing of CLN2 transcription in cycling cells. Genes Dev. 9:2780-2794
TABA, M. R., I. MUROFF, G. LYDALL, G. TEBB, and K. NASMYTH, 1991 Changes in a Swi4,6-DNA-binding complex occur at the time of HO activation in yeast. Genes Dev. 5:2000-2013
TANSEY, W. P. and W. HERR, 1997 TAFs: Guilt by Association? Cell 88:729-732[Medline].
THUT, C., J. CHEN, R. KLEMM, and R. TJIAN, 1995 p53 transcriptional activation mediated by coactivators TAFII40 and TAFII60. Science 267:100-104
TYERS, M., G. TOKIWA, and B. FUTCHER, 1993 Comparison of the Saccharomyces cerevisiae G1 cyclins: Cln3 may be an upstream activator of Cln1, Cln2 and other cyclins. EMBO J. 12:1955-1968[Medline].
VERMA, R., J. SMILEY, B. ANDREWS, and J. CAMPBELL, 1992 Regulation of the yeast DNA replication genes through the MluI cell cycle box is dependent on SWI6.. Proc. Natl. Acad. Sci. USA 89:9479-9483
WALKER, S., J. REESE, L. APONE, and M. GREEN, 1996 Transcription activation in cells lacking TAFIIS. Nature 383:185-188[Medline].
WALKER, S. S., W.-C. SHEN, J. C. REESE, L. M. APONE, and M. R. GREEN, 1997 Yeast TAFII145 required for transcription of G1/S cyclin genes and regulated by the cellular growth state. Cell 90:607-614[Medline].
WANG, E. H., S. ZOU, and R. TJIAN, 1997 TAFII250-dependent transcription of cyclin A is directed by ATF activator proteins. Genes Dev. 11:2658-2669
WITTENBERG, C., K. SUGIMOTO, and S. I. REED, 1990 G1-specific cyclins of S. cerevisiae: Cell cycle periodicity, regulation by mating pheromone, and association with the p34CDC28 protein kinase. Cell 62:225-237[Medline].
XIE, X., T. KOKUBO, S. COHEN, U. MIRZA, and A. HOFFMANN et al., 1996 Structural similarity between TAFs and the heterotetrameric core of the histone octamer. Nature 380:316-322[Medline].
This article has been cited by other articles:
![]() |
E. Milgrom, R. W. West Jr., C. Gao, and W.-C. W. Shen TFIID and Spt-Ada-Gcn5-Acetyltransferase Functions Probed by Genome-wide Synthetic Genetic Array Analysis Using a Saccharomyces cerevisiae taf9-ts Allele Genetics, November 1, 2005; 171(3): 959 - 973. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Costanzo, O. Schub, and B. Andrews G1 Transcription Factors Are Differentially Regulated in Saccharomyces cerevisiae by the Swi6-Binding Protein Stb1 Mol. Cell. Biol., July 15, 2003; 23(14): 5064 - 5077. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. Sanders, J. Jennings, A. Canutescu, A. J. Link, and P. A. Weil Proteomics of the Eukaryotic Transcription Machinery: Identification of Proteins Associated with Components of Yeast TFIID by Multidimensional Mass Spectrometry Mol. Cell. Biol., July 1, 2002; 22(13): 4723 - 4738. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Durso, A. K. Fisher, T. J. Albright-Frey, and J. C. Reese Analysis of TAF90 Mutants Displaying Allele-Specific and Broad Defects in Transcription Mol. Cell. Biol., November 1, 2001; 21(21): 7331 - 7344. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Kirchner, S. L. Sanders, E. Klebanow, and P. A. Weil Molecular Genetic Dissection of TAF25, an Essential Yeast Gene Encoding a Subunit Shared by TFIID and SAGA Multiprotein Transcription Factors Mol. Cell. Biol., October 1, 2001; 21(19): 6668 - 6680. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Kraemer, R. T. Ranallo, R. C. Ogg, and L. A. Stargell TFIIA Interacts with TFIID via Association with TATA-Binding Protein and TAF40 Mol. Cell. Biol., March 1, 2001; 21(5): 1737 - 1746. [Abstract] [Full Text] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Macpherson, N.
- Articles by Andrews, B.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Macpherson, N.
- Articles by Andrews, B.










