Involvement of the PP2C-Like Phosphatase Ptc2p in the DNA Checkpoint Pathways of Saccharomyces cerevisiae

Corresponding author: Marie-Claude Marsolier, Service de Biochimie et de Génétique Moléculaire (Bat. 142), CEA/Saclay, F-91191 Gif-Sur-Yvette Cedex, France., marsolie{at}jonas.saclay.cea.fr (E-mail)

Communicating editor: M. JOHNSTON

	ABSTRACT

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

RAD53 encodes a conserved protein kinase that acts as a central transducer in the DNA damage and the DNA replication checkpoint pathways in Saccharomyces cerevisiae. To identify new elements of these pathways acting with or downstream of RAD53, we searched for genes whose overexpression suppressed the toxicity of a dominant-lethal form of RAD53 and identified PTC2, which encodes a protein phosphatase of the PP2C family. PTC2 overexpression induces hypersensitivity to genotoxic agents in wild-type cells and is lethal to rad53, mec1, and dun1 mutants with low ribonucleotide reductase activity. Deleting PTC2 specifically suppresses the hydroxyurea hypersensitivity of mec1 mutants and the lethality of mec1. PTC2 is thus implicated in one or several functions related to RAD53, MEC1, and the DNA checkpoint pathways.

EUKARYOTIC cells have evolved complex mechanisms for coping with DNA damage or the inhibition of DNA replication. These surveillance mechanisms, termed checkpoints, ensure that the integrity of the genome is intact before allowing cell division to proceed (for reviews, see HARTWELL and WEINERT 1989 ; ELLEDGE 1996 ; WEINERT 1998 ). In unicellular organisms, failure of the restraints imposed by the checkpoints results in genomic instability, increased mutation rates, and ultimately death if cells continue to divide unchecked. In mammals, disruptions of checkpoint pathways are believed to be important at early stages of carcinogenesis (HARTWELL and KASTAN 1994 ). Strong evidence for a link between checkpoints and cancer comes from studies of ATM, the gene mutated in the cancer-prone disease ataxia telangiectasia (reviewed in MORGAN and KASTAN 1997 ).

The understanding of checkpoint pathways is presently most advanced in the yeast Saccharomyces cerevisiae. Several classes of DNA checkpoints have been described. One pathway blocks chromosome segregation if DNA replication is incomplete (WEINERT 1992 ; ALLEN et al. 1994 ). The other pathways induce cell cycle arrests at the G1/S and G2/M transitions, respectively, and a slowing of S phase in case of DNA damage (WEINERT and HARTWELL 1988 ; SIEDE et al. 1993 ; PAULOVICH and HARTWELL 1995 ; WEINERT 1998 ).

The components of the DNA checkpoint machinery fall into three categories: sensors, transducers, and targets (WEINERT 1998 ). The sensor class includes RAD9, RAD17, RAD24, and MEC3, which are required for response to DNA damage (LYDALL and WEINERT 1995 ; PAULOVICH et al. 1997 ; DE LA TORRE-RUIZ et al. 1998 ), and POL2, RFC5, and DPB11, which are specifically involved in the response to the inhibition of DNA replication (ARAKI et al. 1995 ; NAVAS et al. 1995 ). The corresponding proteins are thought to recognize DNA damage or stalled replication forks and to generate a signal relayed through Mec1p to various checkpoint elements, including the protein kinases Rad53p and Dun1p and the metaphase-anaphase regulator Pds1p (SANCHEZ et al. 1996 ; SUN et al. 1996 ; GARDNER et al. 1999 ). The protein kinases Mec1p and Rad53p act as transducers in all DNA checkpoint pathways and transmit signals to downstream targets, leading to the transcription of genes involved in DNA replication and repair (ABOUSSEKHRA et al. 1996 ; KISER and WEINERT 1996 ; NAVAS et al. 1996 ) and to the activation of effectors that slow or halt the cell cycle, allowing time for the replication and repair processes.

The essential genes MEC1 and RAD53 are believed to encode central transducers in the DNA checkpoint pathways. Mec1p belongs to a kinase superfamily that also includes the human Atm and Atr proteins and a Schizosaccharomyces pombe homologue, Rad3 (BENTLEY et al. 1996 ). TEL1 is another S. cerevisiae gene that exhibits some functional redundancy and sequence similarity with MEC1. tel1 mutants are not checkpoint defective, but mec1 tel1 double mutants are more sensitive to DNA damage than a mec1 mutant, and overexpression of TEL1 can suppress some mec1 defects (MORROW et al. 1995 ; SANCHEZ et al. 1996 ). MEC1 and TEL1 are placed upstream of RAD53 in the DNA checkpoint pathways as Rad53p phosphorylation in response to DNA damage or replication blocks is MEC1 and TEL1 dependent (SANCHEZ et al. 1996 ; SUN et al. 1996 ).

Significant progress has been made in identifying genes involved in checkpoint control, but there is less information relating to the checkpoint effectors operating downstream of RAD53. In contrast to the cell cycle regulation of S. pombe and of mammalian cells, the inhibitory phosphorylation of the cyclin-dependent kinase Cdc28p is not involved in the checkpoint-induced arrests of cell division in S. cerevisiae (AMON et al. 1992 ; SORGER and MURRAY 1992 ). So far, only one potential target of the cell cycle machinery has been identified. Swi6p is modified in a RAD53-dependent manner in response to DNA damage, which results in the delay of entry into S phase by inhibition of CLN transcription (SIDOROVA and BREEDEN 1997 ). More data are available regarding the transcriptional activation of the RNR genes encoding the ribonucleotide reductase that provides desoxyribonucleotides for DNA replication and repair. Elledge and collaborators have shown that CRT1 encodes a DNA-binding protein that recruits the general repressors Ssn6p and Tup1p to the promoters of the RNR genes (HUANG et al. 1998 ). In response to DNA damage or the inhibition of DNA replication, Crt1p becomes hyperphosphorylated and no longer binds DNA, resulting in transcriptional induction (HUANG et al. 1998 ). Crt1p hyperphosphorylation is abolished in rad53 and mec1 mutants, and is reduced in dun1 mutants, demonstrating its dependence upon the checkpoint pathways. Dun1p had been characterized previously as a protein kinase whose activity was necessary for the transcriptional activation of the RNR genes in response to DNA damage or inhibition of replication (ZHOU and ELLEDGE 1993 ). It has recently been shown that Dun1p also contributes to cell cycle arrest in response to DNA damage (GARDNER et al. 1999 ).

To identify new elements of the DNA checkpoint pathways acting at the level or downstream of Rad53p, we focused on the isolation of genes whose overexpression suppresses the toxicity of a dominant-lethal allele of RAD53. In this article, we present the isolation and analysis of the PTC2 gene, whose product is a member of the PP2C family.

	MATERIALS AND METHODS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Strains and media:
Yeast strains were grown in yeast extract/peptone/dextrose with 2% glucose (YPD) or with 2% raffinose and 2% galactose (YPGal + Raf), or in synthetic defined minimal media supplemented with appropriate bases and amino acids and 2% glucose (SD) or galactose (SGal) or raffinose (SRaf). Hydroxyurea (HU; Sigma, St. Louis) was added to the media to final concentrations ranging from 10 to 150 mM. All yeast strains used in this study are listed in Table 1. All strains are congenic with W303-1A, except YPH499, which was used for the screening of the libraries. To generate the dun1 strain, Y300 was transformed with the XhoI-XbaI fragment of pZZ66 (ZHOU and ELLEDGE 1993 ) containing dun1-100::HIS3, and His⁺ transformants were checked for their sensitivities to 150 mM HU. PTC2 was disrupted by PCR targeting using either the Kluyveromyces lactis URA3 gene (LANGLE-ROUAULT and JACOBS 1995 ) or the kanMX cassette (WACH et al. 1994 ). The URA3 and the kanMX cassettes were amplified by PCR with the primers PTC2D5 (5'-ACTATTCCATTGTTGTATAAATATAGAGAACCAGAAAAAGAAAAACGTGATTTGCTTAAGAATT-3') and PTC2D3 (5'-GGTTCGTATATAGGTATGTATATATAATGAAGGATGGAAGATCCTGTAGTTTCTGGTTTTTAAAT-3'), and PTC2D5KAN (5'- ACTATTCCATTGTTGTATAAAATATAGAGAACCAGAAAAAGAAAAGCTTCGTACGCTGCAGGTCGAC -3') and PTC2D3KAN (5'- GGTTCGTATATAGGTATGTATATATAATGAAGGATGGAAGATCCTATCATCGATGAATTCGAGCTCG -3'), respectively, and the amplication products were used to transform the selected strains. All PTC2 disruptions were confirmed by PCR on genomic DNA.

Construction of the tetO-RAD53-GFP fusion:
The RAD53 and the green fluorescent protein (GFP) moieties were first amplified separately by PCR, using as templates the pJA98 (ALLEN et al. 1994 ) and the pYGFP3 plasmids, with the primers RAD53-10 (5'-CCCAGCTTTGTTTAAACATGGAAAATATTACACAACCCACACAG-3') and RAD53-11 (5'-GAATAATTCTTCACCTTTAGACATCGAAAATTGCAAATTCTCG-3'), andGFPA (5'-ATGTCTAAAGGTGAAGAATTATTCACTGG-3') andGFPB (5'-AACGACGGCCAGTGAATTCGAG-3'), respectively. The PCR products were ethanol precipitated and resuspended in TE. Aliquots of both were then used as templates for the sewing PCR reaction with the primers RAD53-10 and GFPB. After digestion with PmeI and PstI, this ultimate PCR product was cloned into the PmeI-PstI sites of pCM183 (GARI et al. 1997 ) behind the tetracycline operator tetO.

Library screening:
RAD53-GFP is lethal to both the Y300 and the YPH499 strains at 37° on glucose and at 30° on galactose. However, RAD53-GFP is harbored by a TRP1 plasmid, and the Y300 TRP1 allele trp1-1 has a high reversion rate (~10^-4) that was incompatible with a screening for suppressors. We therefore performed the initial screenings with YPH499, and later checked the suppressors' activity in both strains. We screened a genomic library built in the multicopy vector pFL44 (STETTLER et al. 1993 ) and a library consisting of cDNAs under the control of the GAL1 promoter (LIU et al. 1992 ) under two conditions: at 33° on galactose and at 37° on glucose. YPH499 cells containing RAD53-GFP were transformed using the lithium acetate procedure (ITO et al. 1983 ) and were incubated directly at the indicated temperature. A total of 40,000 and 60,000 clones transformed with the genomic and the cDNA libraries, respectively, were screened for growth at 33° on galactose, and after verification, only the cDNA library yielded two suppressor constructs, M1-15 and M3-11, encoding the same protein, Ptc2p. A total of 40,000 clones transformed with the genomic library were screened on glucose at 37°, and CRT1 was then isolated as a suppressor of RAD53-GFP.

ß-Galactosidase assays:
pZZ13, a plasmid harboring the RNR3-lacZ reporter gene (ZHOU and ELLEDGE 1992 ), was introduced into wild-type cells (Y300) in combination with either an empty vector (pRS314; SIKORSKI and HIETER 1989 ) or a vector bearing RAD53-GFP. Liquid ß-galactosidase assays were carried out on yeast cells that were grown overnight in selective medium, diluted into fresh medium, and grown to mid-log phase. ß-Galactosidase assays with the colorimetric substrate o-nitrophenyl-ß-galactopyranoside were performed as described in ZHOU and ELLEDGE 1992 . Assays were carried out in triplicate and averaged.

Testing the sensitivity to HU, UV, and PTC2 overexpression:
To test the cells' sensitivity to PTC2 overexpression, transformants containing the GAL1-PTC2 construct M1-15 or the empty vector pRS316 (SIKORSKI and HIETER 1989 ) were first selected on SD-URA plates, streaked onto SRaf-URA medium, and ultimately tested on SGal-URA plates with or without HU. The measurement of UV and HU sensitivity was routinely performed as follows. Overnight precultures were diluted to an OD of 0.1 and grown for an additional 4–5 hr. Tenfold dilutions were then spotted on YPD plates with or without HU. Sets of YPD plates were irradiated by UV light at 20–120 J/m² using a Stratalinker 1800. Next, plates were incubated at 30° for 3 days. For each genotype tested, at least two independent strains were assayed. To quantify more precisely the UV sensitivity of wild-type cells overexpressing PTC2, the following procedure was adopted. Wild-type cells containing either the empty vector pRS316 or the GAL1-PTC2 construct M1-15 were grown to mid-log phase in SRaf-URA medium, plated onto SGal-URA plates at an appropriate dilution (~2000 cfu/plate), and irradiated by UV light. Percent survival was then determined relative to that of unirradiated controls.

Analysis of Rad53p phosphorylation:
Wild-type and dun1 cells containing either the empty vector pRS316 (SIKORSKI and HIETER 1989 ) or the GAL1-PTC2 construct were grown overnight in SRaf-URA medium and diluted to an OD of 0.4 in the same medium, to which galactose was added to a final concentration of 2%. The cultures were grown for an additional 2.5 hr and split into two, whereupon one-half was treated with HU (0.2 M final) and the other half was left untreated. All cells were then allowed to grow for a further 2 hr before extraction. Yeast extracts were prepared as described (VIALARD et al. 1998 ), by glass bead beating in 20% trichloroacetic acid (TCA), washing the glass beads in 5% TCA, and combining the wash with the lysate. The protein suspension was then pelleted, resuspended in 1x Laemmli loading buffer (pH 8.8), boiled for 5 min, pelleted, and the supernatant was retained as a whole-cell extract. For Western blotting, proteins were separated on 10% SDS-PAGE with an acrylamide:bis-acrylamide ratio of 30:0.4 and transferred to nitrocellulose membranes (Amersham, Arlington Heights, IL) by electroblotting (Bio-Rad, Richmond, CA). Goat polyclonal antibody raised against a polypeptide corresponding to an amino acid sequence mapping at the C terminus sequence of Rad53p [RAD53 (yC-19); Santa Cruz Biotechnology] was incubated with the nitrocellulose membranes at a 1:1000 dilution in Tris-buffered saline containing 0.1% Tween-20 and 5% (w/v) milk overnight. Secondary horseradish peroxidase-conjugated anti-goat antibody (Santa Cruz Biotechnology) was incubated for 1 hr at a 1:5000 dilution and the blot was revealed by chemiluminescence (Amersham).

	RESULTS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

A dominant lethal allele of RAD53:
We reasoned that we might be able to isolate mutant alleles of RAD53 that constitutively arrest the cell cycle even in the absence of DNA lesions or replication blocks. Such alleles would be lethal, and screening for suppressors should reveal elements of the checkpoint pathways acting downstream or at the level of Rad53p. Fortuitously, one allele of this sort was generated through the construction of a RAD53-GFP fusion. A translational fusion containing the entire coding sequence of RAD53 and the sequence of the GFP was produced (see MATERIALS AND METHODS) and placed under the control of the regulatable tetracycline operator tetO [tetO activity is repressed by tetracycline or derivatives such as doxycycline (GARI et al. 1997 )].

The functionality of the tetO-RAD53-GFP construct was tested by its ability to complement a rad53 deletion. Y601, a rad53 mutant containing a wild-type copy of RAD53 on a URA3-marked plasmid (DESANY et al. 1998 ), was transformed either with an empty vector or with a plasmid bearing RAD53-GFP. Only transformants containing the RAD53-GFP construct were able to lose the URA3 plasmid with the wild-type copy of RAD53 and to form colonies resistant to 5-fluoro-orotic acid [5-FOA; a compound that is toxic to cells containing the URA3 gene (BOEKE et al. 1984 )], demonstrating that RAD53-GFP is functional (data not shown). We were also able to detect the RAD53-GFP protein by fluorescence in the nucleus, confirming previous reports of nuclear localization of Rad53p (see ZHENG et al. 1993 ; data not shown). Overexpression of RAD53 affects the cell cycle (ZHENG et al. 1993 ; ALLEN et al. 1994 ) and we confirmed this result (Fig 1A).

View larger version (41K): [in this window] [in a new window] [Download PPT slide]   Figure 1. (A) The expression of the RAD53-GFP construct is deleterious to cell growth regardless of the medium and the temperature, and is lethal in the presence of hydroxyurea or after UV irradiation. Wild-type cells (WT, Y300) containing either an empty vector (pCM183) or the RAD53-GFP construct were grown overnight in SD-TRP medium containing doxycycline (1 µg/ml) and diluted to an OD of 0.1 in the same medium without doxycycline. The cultures were grown for an additional 4 hr, and 10-fold serial dilutions were then spotted on SD-TRP plates with or without HU or UV treatment. Plates were then incubated at 30° and examined after 3 days. (B) The expression of the RAD53-GFP construct is lethal to both wild-type and mec1 cells on a medium containing galactose. Wild-type (WT, Y300) and mec1 (mec1-21, Y306) cells harboring either an empty vector (pCM183) or the RAD53-GFP construct were selected on SD-TRP medium containing 1 µg/ml doxycycline and then streaked onto SGal-TRP plates without doxycycline. Plates were incubated at 30° and examined after 4 days.

We also found that RAD53-GFP expression in wild-type cells was lethal under conditions of genotoxic stress, including UV irradiation or the presence of HU, a drug that stalls replication forks by limiting deoxyribonucleotide availability through inhibition of ribonucleotide reductase (RNR) activity (Fig 1A). This feature prevented us from testing directly the proficiency of RAD53-GFP in executing RAD53 checkpoint functions. We therefore examined whether RAD53-GFP could activate by itself the transcription of a RNR3-lacZ reporter gene (ZHOU and ELLEDGE 1992 ). The activities of wild-type cells with or without RAD53-GFP reached 74 ± 26 and 6.9 ± 0.5 ß-gal units, respectively. Rad53-GFP thus behaved as a hyperactive Rad53p and seemed to trigger, in the absence of genotoxic stress, physiological events normally induced by DNA damage or replication blocks. The events elicited by Rad53-GFP appear to be deleterious to cell growth under normal conditions, and, interestingly, not only did they not protect the cells against genotoxic stress, but they were even lethal in that case, probably because of their lack of regulation. We also found that the expression of RAD53-GFP was lethal in the absence of genotoxic stress at 37° on glucose and at 30° on galactose. Arrest of cell division was not uniform (as determined by microscopic observation, data not shown), was independent of MEC1 (Fig 1B), and was partially suppressed by a deletion of DUN1 (data not shown), further demonstrating that the toxicity of Rad53-GFP was due to the triggering of events located downstream of Rad53p. We used this characteristic of RAD53-GFP to attempt to isolate new elements of the pathways controlled by RAD53. We sought checkpoint-negative regulators by searching for genes whose overexpression suppresses RAD53-GFP toxicity.

Screening for genes whose overexpression suppresses RAD53-GFP toxicity:
Among the suppressors we isolated was CRT1, which encodes a negative regulator of RNR gene transcription (HUANG et al. 1998 ). This result validated our screen, since negative regulators of the checkpoint pathways were exactly the kind of suppressor we were expecting. Screening a library consisting of cDNAs under the control of the GAL1 promoter (LIU et al. 1992 ) at 33° on galactose yielded two independent constructs encoding Ptc2p, a protein phosphatase of the PP2C family. Both constructs contained the full-length cDNA corresponding to PTC2. The sequences started 42 bp (M1-15) and 293 bp (M3-11) before the translation initiation codon, respectively. The M1-15 clone proved to be a more efficient suppressor of RAD53-GFP and was therefore selected for further analyses.

PTC2 overexpression induces hypersensitivity to genotoxic agents in wild-type cells:
Because we imagined that overexpression of PTC2 suppressed the lethality of Rad53-GFP by blocking one of its downstream effects, we expected that Ptc2p would also partially block the action of Rad53p in the presence of genotoxic agents. Indeed, overexpression of PTC2 increased sensitivity to DNA damage or replication blocks (Fig 2 and Fig 3). Overexpression of PTC2 slowed cell growth in the absence of HU, as had already been reported by WELIHINDA et al. 1998 , and was lethal when 20 mM HU was added to the medium. Increasing the concentration of HU to 50 mM decreased further the residual cell growth (Fig 2). PTC2 overexpression also caused a marked decrease in cell viability after UV irradiation (Fig 3).

View larger version (60K): [in this window] [in a new window] [Download PPT slide]   Figure 2. PTC2 overexpression is lethal to wild-type cells growing in the presence of hydroxyurea. Y300 (WT, wild-type) cells containing either the empty vector pRS316 (SIKORSKI and HIETER 1989 ) or the GAL1-PTC2 construct M1-15 were grown onto SRaf-URA plates and then streaked on SGal-URA plates with various concentrations of HU.

View larger version (10K): [in this window] [in a new window] [Download PPT slide]   Figure 3. UV sensitivity of wild-type cells overexpressing PTC2. Y300 (wild-type) cells containing either the empty vector pRS316 (open circle) or the GAL1-PTC2 construct M1-15 (open square) were grown to mid-log phase in SRaf-URA medium, plated onto SGal-URA plates at an appropriate dilution (~2000 cfu/plate), irradiated at the indicated doses of UV light, and percentage survival was determined relative to unirradiated controls.

In the presence of HU or of DNA-damaging agents, Rad53p triggers several responses for sustaining cell viability. To understand which Rad53p-dependent pathways are affected by PTC2 overexpression, we monitored cell cycle progression of wild-type cells overexpressing PTC2 after irradiation by UV light. Cells were blocked in G1 phase by -factor treatment and were UV irradiated. Wild-type cells overexpressing PTC2 arrested normally in G1 after the UV treatment and remained blocked for the next 4 hr, exhibiting no defect in the mechanism of checkpoint arrest (Fig 4). This was in contrast to rad53-21 cells, which resumed their cell cycle ~1 hr after UV irradiation. Similar results were obtained when cells were treated with irradiation or HU treatment (data not shown). We conclude that the hypersensitivity of PTC2-overexpressing cells to genotoxic agents was not caused by a deficiency in checkpoint-induced arrest of cell division.

View larger version (37K): [in this window] [in a new window] [Download PPT slide]   Figure 4. PTC2-overexpressing cells are not defective for checkpoint arrest after UV irradiation. Wild-type (WT, Y300) cells containing either the empty vector pRS316 (SIKORSKI and HIETER 1989 ) or the GAL1-PTC2 construct, as well as rad53-21 mutant cells (Y301), were grown to log phase in YPGal+Raf and blocked in G1 phase by -factor treatment for 3 hr. The cultures were divided into two aliquots, one of which was UV irradiated at 80 J/m2 while the other one was left untreated. The cells were resuspended in YPGal + Raf and allowed to grow for an additional 4 hr. Progress through the cell cycle was monitored by FACS analysis at the indicated time points.

PTC2 overexpression is lethal to mutants with low ribonucleotide reductase activity:
As a further test of PTC2 interaction with the DNA checkpoints, we examined checkpoint mutants for their sensitivity to PTC2 overexpression. We found that the overexpression of PTC2 was lethal to rad53-21 and mec1-21 mutants, even in the absence of genotoxic agents (Fig 5B and Fig C). RAD53 and MEC1 are both essential genes whose functions are required during a normal cell cycle, probably for ribonucleotide reductase activity, since rad53 and mec1 lethality can be suppressed by increased RNR activity (DESANY et al. 1998 ; HUANG et al. 1998 ; ZHAO et al. 1998 ). Since PTC2 overexpression was toxic in the rad53-21 and mec1-21 mutants, we hypothesized that PTC2 function was related to ribonucleotide reductase activity. This hypothesis was supported by the observation that PTC2 overexpression was also lethal to dun1 mutants (Fig 5D). Dun1p is a protein kinase that is required for the transcriptional activation of the RNR genes in response to DNA damage or DNA replication blocks and that contributes to cell cycle arrest in response to DNA damage (ZHOU and ELLEDGE 1993 ; GARDNER et al. 1999 ). Finally, we found that rad53 sml1-1 and mec1 sml1 double mutants were not as sensitive to PTC2 overexpression as rad53-21 and mec1-21 single mutants (Fig 5B and Fig C). Since Sml1p has been characterized only as a negative regulator of the ribonucleotide reductase activity (ZHAO et al. 1998 ), this result suggests that the sensitivity of the rad53-21 and mec1-21 mutants to the overexpression of PTC2 is only due to a defect related to the ribonucleotide reductase function.

View larger version (71K): [in this window] [in a new window] [Download PPT slide]   Figure 5. Lethality of PTC2 overexpression in rad53, mec1, and dun1 strains. Strains with the indicated phenotype containing either the empty vector pRS316 (SIKORSKI and HIETER 1989 ) or the GAL1-PTC2 construct were grown onto SRaf-URA plates and then streaked on SGal-URA plates. (A–C) WT (wild type), W1588-4C; sml1, U952-3B; mec1 sml1, U953-61A; mec1-21, Y306; rad53 sml1-1, U960-5C; and rad53-21, Y301. (D) WT Y300, and dun1, MCM123.

PTC2 deletion suppresses the hypersensitivity to HU of mec1 mutants and the lethality of mec1:
Disrupting PTC2 had no effects on the growth nor on the HU and UV sensitivity of wild-type cells (data not shown). We also deleted PTC2 in the rad53-21, rad53 sml1-1, mec1-21, mec1 sml1, and dun1 mutants. Interestingly, the mec1 mutants were the only strains whose sensitivities to hydroxyurea were modified by the disruption of PTC2: mec1-21 ptc2 double mutants show a dramatic increase in HU resistance compared to mec1-21 single mutants (Fig 6A). No such suppression of mec1-21 sensitivity to UV irradiation by PTC2 disruption was observed (data not shown). Similar results were obtained with the mec1 sml1 mutant: deleting PTC2 increased its resistance to HU, but had no effect on its sensitivity to UV (data not shown).

View larger version (61K): [in this window] [in a new window] [Download PPT slide]   Figure 6. (A) ptc2 suppresses the HU sensitivity of mec1-21 cells. Wild-type (WT, Y300), mec1-21 (Y306), and mec1-21 ptc2 (MCM134 and MCM135, two independent disruptants) cells were grown to mid-log phase in YPD. Tenfold serial dilutions were then spotted on YPD plates with or without HU. The plates were then incubated at 30° and examined after 3 days. (B) ptc2 partially suppresses the lethality of mec1. A mec1 mutant containing a wild-type copy of MEC1 on a URA3 plasmid (mec1, Y602) was either transformed with pBAD70 (DESANY et al. 1998 ), a TRP1 plasmid harboring the pGAP-RNR1 construct (mec1 + pGAP-RNR1), or deleted for the PTC2 gene (mec1 ptc2-2 and mec1 ptc2-3, corresponding to two independent disruptants, MCM190 and MCM191). Independent clones were grown overnight in YPD (mec1, mec1 ptc2-2, and mec1 ptc2-3) or in SD-TRP (mec1 + pGAP-RNR1) to stationary phase, and 106 cells were plated onto 5-FOA-containing plates. The values reported on the graph correspond to the number of 5-FOA-resistant clones determined after a 3-day incubation at 30°. The assays were carried out in triplicate and averaged. The standard error was ~20%.

We found that ptc2 was able to rescue mec1 lethality, but not rad53 lethality (Fig 6B; data not shown). PTC2 was disrupted in Y601, a rad53 mutant containing a wild-type copy of RAD53 on a URA3 plasmid, and in Y602, a mec1 mutant containing a wild-type copy of MEC1 on a URA3 plasmid (DESANY et al. 1998 ). Independent transformants were tested for their ability to lose the wild-type copies of RAD53 or MEC1 and to grow on 5-fluoroorotic acid (5-FOA)-containing plates. Deletion of PTC2 significantly suppresses mec1 lethality, as 20 times as many 5-FOA-resistant clones were recovered from mec1 ptc2 double mutants than from mec1 single mutants, but less strongly than the overexpression of RNR1 (Fig 6B; DESANY et al. 1998 ). No suppression of rad53 lethality by ptc2 could be observed (data not shown).

Rad53p is probably not a substrate for Ptc2p:
Since phosphorylation of Rad53p is thought to increase its protein kinase activity, the simplest hypothesis for Ptc2p action was that it acts as a Rad53p phosphatase. We therefore tested whether Rad53p was a substrate for Ptc2p by analyzing Rad53p phosphorylation in strains overexpressing PTC2 in the presence of HU. We found that Rad53p was not phosphorylated in the wild-type strain in the absence of HU, whether PTC2 was overexpressed or not (Fig 7, lanes 1 and 2). Rad53p became phosphorylated after HU treatment and exhibited the same apparent phosphorylation patterns in the strains containing or lacking the GAL1-PTC2 construct (Fig 7, lanes 3 and 4). In fact, the bands corresponding to the phosphorylated forms of Rad53p were even more intense in the cells overexpressing PTC2, suggesting that PTC2 overexpression could indirectly increase Rad53p phosphorylation. This also suggests that Ptc2p itself does not dephosphorylate Rad53p. We performed the same experiment in dun1 cells to test whether the lethality of PTC2 overexpression in these cells was correlated with a specific pattern of Rad53p phosphorylation (Fig 7, lanes 5–8). Even in the absence of HU, Rad53p was phosphorylated in both strains containing the empty vector or the GAL1-PTC2 construct (Fig 7, lanes 5 and 6), and the patterns were very similar, closely resembling the phosphorylation pattern of Rad53p in HU-treated wild-type cells (lane 4). This result can be explained by the fact that dun1 cells are partially deficient for the transcription of the RNR genes and the resulting desoxyribonucleotide depletion could activate the checkpoint pathway. Rad53p completely shifted to slower migrating forms after the treatment with HU (Fig 7, lanes 7 and 8), and again the phosphorylation patterns were identical whether the dun1 mutant overexpressed PTC2 or not. The phosphorylation patterns of Rad53p were also examined in wild-type cells grown in asynchronous log-phase cultures and irradiated by UV light at 40, 80, or 160 J/m²: no obvious differences in Rad53p phosphorylation could be observed between the cells containing the empty vector and the GAL1-PTC2 construct (data not shown). We conclude that Rad53p is probably not a Ptc2p substrate.

View larger version (26K): [in this window] [in a new window] [Download PPT slide]   Figure 7. PTC2 overexpression does not affect qualitatively the phosphorylation patterns of Rad53p. Western blot analysis of total proteins from asynchronous log-phase cultures of wild-type or dun1 cells containing the empty vector pRS316 or GAL1-PTC2, either untreated or HU treated. Wild-type (WT, Y300) and dun1 (MCM123) cells were grown overnight in SRaf-URA medium and diluted to an OD of 0.4 in the same medium, to which galactose was added at a final concentration of 2%. The cultures were grown for an additional 2.5 hr and split into two, whereupon one-half was treated with HU (0.2 M final) and the other half was left untreated. All cells were then allowed to grow for an additional 2 hr before extraction.

	DISCUSSION

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

To identify new elements of the DNA checkpoint pathways acting downstream of Rad53p, we took advantage of a hyperactive form of Rad53p, Rad53-GFP, whose expression is lethal to wild-type cells. We isolated genes whose overexpression suppresses the toxicity caused by RAD53-GFP and whose products are candidates for negative regulators of RAD53-controlled pathways. The relevance of this strategy was demonstrated by the isolation of CRT1 as a suppressor of RAD53-GFP lethality. Crt1p is an inhibitor of RNR gene transcription whose activity is regulated in a MEC1- and RAD53-dependent manner in response to DNA damage or replication blocks (HUANG et al. 1998 ). Overexpression of the RNR genes is unlikely to explain the toxicity of RAD53-GFP because increased ribonucleotide reductase activity is not toxic to yeast cells (DESANY et al. 1998 ; HUANG et al. 1998 ; ZHAO et al. 1998 ). Thus, the suppressor activity of CRT1 suggests either that Crt1p overexpression sequesters Rad53-GFP and prevents the hyperactivation of other effectors or that Crt1p represses the transcription of unidentified genes whose hyperactivation is toxic.

PTC2, another suppressor of RAD53-GFP toxicity, encodes a protein that is highly similar to the serine/threonine phosphatases of the PP2C family. PP2C-like enzymes play multiple roles in regulating a number of signal transduction pathways in eukaryotes (FUKUNAGA et al. 1993 ; LEUNG et al. 1994 ; CHIN-SANG and SPENCE 1996 ). The S. cerevisiae genome encodes six PP2C-related enzymes (STARK 1996 ), three of whose physiological roles are unknown. Ptc1p and Ptc3p are implicated in the downregulation of the HOG osmosensing signal transduction pathway (MAEDA et al. 1994 ). Ptc1p is also involved in many other pathways, including cell separation, mitochondrial inheritance, and tRNA splicing (ROBINSON et al. 1994 ; ROEDER et al. 1998 ). Ptc2p has so far only been shown to negatively regulate the unfolded protein response by dephosphorylating the Ire1p kinase (WELIHINDA et al. 1998 ). We have presented evidence suggesting a role for Ptc2p in the DNA checkpoint pathways.

It is difficult to link the suppression of RAD53-GFP lethality by the overexpression of PTC2 to a precise target, as the specific causes of RAD53-GFP toxicity have not been elucidated. We presume that RAD53-GFP constitutively activates several pathways normally triggered in response to DNA damage or replication blocks. The simplest explanation is that Ptc2p acts as a Rad53p phosphatase but Ptc2p does not appear to be a major regulator of Rad53p overall phosphorylation.

Overexpression of PTC2 is lethal to wild-type cells growing in the presence of 20 mM hydroxyurea, and to rad53-21, mec1-21, and dun1, but not to rad53 sml1-1 nor to mec1 sml1 mutants. A common property of all the cells hypersensitive to PTC2 overexpression is an impairment of their ribonucleotide reductase activity. A simple interpretation of these results is that Ptc2p is involved in a pathway related to ribonucleotide reductase function. It could be the ribonucleotide reductase activity itself or a process depending on or related to this activity. We favor the latter hypothesis for two reasons. First, although a post-transcriptional regulation of the ribonucleotide reductase activity cannot be ruled out, PTC2 overexpression does not affect the transcriptional activation of a RNR3-lacZ reporter gene after a treatment with HU (data not shown), and so it is unlikely to act directly on RNR gene transcription. Second, overexpression of PTC2 in wild-type cells does not trigger the phosphorylation of Rad53p, in contrast to the presence of HU or the disruption of DUN1, which both impede ribonucleotide reductase activity.

DNA replication is a process dependent on ribonucleotide reductase activity in which Ptc2p could be involved. Recent articles have demonstrated that the firing of replication origins is closely related to ribonucleotide reductase activity and DNA checkpoint functions (DESANY et al. 1998 ; SANTOCANALE and DIFFLEY 1998 ; SHIRAHIGE et al. 1998 ; DOHRMANN et al. 1999 ). In particular, Rad53p and Mec1p act as negative regulators of the firing of replication origins (SANTOCANALE and DIFFLEY 1998 ; SHIRAHIGE et al. 1998 ). Besides, mec1, but not rad53, is suppressible by mutations in the Dbf4p/Cdc7p protein kinase complex that is required for origin initiation (JACKSON et al. 1993 ; DESANY et al. 1998 ), and the mec1-21 mutation, but not the rad53-21 mutation, can suppress the temperature sensitivity of the origin-firing mutant orc2-1 (LIANG et al. 1995 ; DESANY et al. 1998 ). Similarly, the deletion of PTC2 partially suppresses the lethality of mec1, but not of rad53, and the HU sensitivity of mec1 mutants, but not of rad53 nor of dun1 mutants. If PTC2 played a part in DNA replication, we would expect that its deletion would impair this process and affect cell growth. However, wild-type cells deleted for the PTC2 gene have no obvious defect in DNA replication nor in their response to HU treatment or to UV irradiation. It is possible that Ptc2p activity is redundant. Ptc2p belongs to the PP2C family of protein serine/threonine phosphatases, which numbers five other members in S. cerevisiae: Ptc1p, Ptc3p, Ybr125p, Yor090p, and Ycr079p (STARK 1996 ). In particular, PTC2 and PTC3 belong to two blocks of genes originating from the duplication of the yeast genome (WOLFE and SHIELDS 1997 ) and they are 62% identical at the amino acid level. We found that disrupting both PTC2 and PTC3 had no effect on the HU sensitivity or the UV resistance of yeast cells (data not shown). However, the possibility remains that other members of the PP2C family could carry out some functions of Ptc2p in ptc2 strains.

	FOOTNOTES

¹ Present address: Institut Jacques Monod, 75251 Paris, France.

	ACKNOWLEDGMENTS

We thank Stephen Elledge, Etienne Schwob, Ajith Welihinda, Randal Kaufman, and Rodney Rothstein for very generously providing strains and plasmids. P.R. was supported by a Commissariat à l'Energie Atomique postdoctoral fellowship. This work was financed in part by a specific radiobiology action grant from the Ministère de l'Education Nationale, de la Recherche et de la Technologie.

Manuscript received August 4, 1999; Accepted for publication December 29, 1999.

	LITERATURE CITED

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

ABOUSSEKHRA, A., J. E. VIALARD, D. E. MORRISON, M. A. DE LA TORRE-RUIZ, and L. CERNAKOVA et al., 1996  A novel role for the budding yeast RAD9 checkpoint gene in DNA damage-dependent transcription. EMBO J. 15:3912-3922[Medline].

ALLEN, J. A., Z. ZHOU, W. SIEDE, E. C. FRIEDBERG, and S. J. ELLEDGE, 1994  The SAD1/RAD53 protein kinase controls multiple checkpoints and DNA damage-induced transcription in yeast. Genes Dev. 8:2416-2428[Abstract/Free Full Text].

AMON, A., U. SURANA, I. MUROFF, and K. NASMYTH, 1992  Regulation of p34CDC28 tyrosine phosphorylation is not required for entry into mitosis in S. cerevisiae.. Nature 355:368-371[Medline].

ARAKI, H., S. H. LEEM, A. PHONGDARA, and A. SUGINO, 1995  Dpb11, which interacts with DNA polymerase II(epsilon) in Saccharomyces cerevisiae, has a dual role in S-phase progression and at a cell cycle checkpoint. Proc. Natl. Acad. Sci. USA 92:11791-11795[Abstract/Free Full Text].

BENTLEY, N. J., D. A. HOLTZMAN, G. FLAGGS, K. S. KEEGAN, and A. DEMAGGIO et al., 1996  The Schizosaccharomyces pombe rad3 checkpoint gene. EMBO J. 15:6641-6651[Medline].

BOEKE, J. D., F. LACROUTE, and G. R. FINK, 1984  A positive selection for mutants lacking orotidine-5'-phosphate decarboxylase activity in yeast: 5-fluoro-orotic acid resistance. Mol. Gen. Genet. 197:345-346[Medline].

CHIN-SANG, I. D. and A. M. SPENCE, 1996  Caenorhabditis elegans sex-determining protein FEM-2 is a protein phosphatase that promotes male development and interacts directly with FEM-3. Genes Dev. 10:2314-2325[Abstract/Free Full Text].

DE LA TORRE-RUIZ, M. A., C. M. GREEN, and N. F. LOWNDES, 1998  RAD9 and RAD24 define two additive, interacting branches of the DNA damage checkpoint pathway in budding yeast normally required for Rad53 modification and activation. EMBO J. 17:2687-2698[Medline].

DESANY, B. A., A. A. ALCASABAS, J. B. BACHANT, and S. J. ELLEDGE, 1998  Recovery from DNA replicational stress is the essential function of the S-phase checkpoint pathway. Genes Dev. 12:2956-2970[Abstract/Free Full Text].

DOHRMANN, P. R., G. OSHIRO, M. TECKLENBURG, and R. A. SCLAFANI, 1999  RAD53 regulates DBF4 independently of checkpoint function in Saccharomyces cerevisiae.. Genetics 151:965-977[Abstract/Free Full Text].

ELLEDGE, S. J., 1996  Cell cycle checkpoints: preventing an identity crisis. Science 274:1664-1672[Abstract/Free Full Text].

FUKUNAGA, K., T. KOBAYASHI, S. TAMURA, and E. MIYAMOTO, 1993  Dephosphorylation of autophosphorylated Ca²⁺/calmodulin-dependent protein kinase II by protein phosphatase 2C. J. Biol. Chem. 268:133-137[Abstract/Free Full Text].

GARDNER, R., C. W. PUTNAM, and T. WEINERT, 1999  RAD53, DUN1 and PDS1 define two parallel G2/M checkpoint pathways in budding yeast. EMBO J. 18:3173-3185[Medline].

GARI, E., L. PIEDRAFITA, M. ALDEA, and E. HERRERO, 1997  A set of vectors with a tetracycline-regulatable promoter system for modulated gene expression in Saccharomyces cerevisiae.. Yeast 13:837-848[Medline].

HARTWELL, L. H. and M. B. KASTAN, 1994  Cell cycle control and cancer. Science 266:1821-1828[Abstract/Free Full Text].

HARTWELL, L. H. and T. A. WEINERT, 1989  Checkpoints: controls that ensure the order of cell cycle events. Science 246:629-634[Abstract/Free Full Text].

HUANG, M., Z. ZHOU, and S. J. ELLEDGE, 1998  The DNA replication and damage checkpoint pathways induce transcription by inhibition of the Crt1 repressor. Cell 94:595-605[Medline].

ITO, H., Y. FUKUDA, K. MURATA, and A. KIMURA, 1983  Transformation of intact yeast cells treated with alkali cations. J. Bacteriol. 153:163-168[Abstract/Free Full Text].

JACKSON, A. L., P. M. PAHL, K. HARRISON, J. ROSAMOND, and R. A. SCLAFANI, 1993  Cell cycle regulation of the yeast Cdc7 protein kinase by association with the Dbf4 protein. Mol. Cell. Biol. 13:2899-2908[Abstract/Free Full Text].

KISER, G. L. and T. A. WEINERT, 1996  Distinct roles of yeast MEC and RAD checkpoint genes in transcriptional induction after DNA damage and implications for function. Mol. Biol. Cell 7:703-718[Abstract].

LANGLE-ROUAULT, F. and E. JACOBS, 1995  A method for performing precise alterations in the yeast genome using a recycable selectable marker. Nucleic Acids Res. 23:3079-3081[Free Full Text].

LEUNG, J., M. BOUVIER-DURAND, P. C. MORRIS, D. GUERRIER, and F. CHEFDOR et al., 1994  Arabidopsis ABA response gene ABI1: features of a calcium-modulated protein phosphatase. Science 264:1448-1452[Abstract/Free Full Text].

LIANG, C., M. WEINREICH, and B. STILLMAN, 1995  ORC and Cdc6p interact and determine the frequency of initiation of DNA replication in the genome. Cell 81:667-676[Medline].

LIU, H., J. KRIZEK, and A. BRETSCHER, 1992  Construction of a GAL1-regulated yeast cDNA expression library and its application to the identification of genes whose overexpression causes lethality in yeast. Genetics 132:665-673[Abstract].

LYDALL, D. and T. WEINERT, 1995  Yeast checkpoint genes in DNA damage processing: implications for repair and arrest. Science 270:1488-1491[Abstract/Free Full Text].

MAEDA, T., S. M. WURGLER-MURPHY, and H. SAITO, 1994  A two-component system that regulates an osmosensing MAP kinase cascade in yeast. Nature 369:242-245. [see comments][Medline].

MORGAN, S. E. and M. B. KASTAN, 1997  p53 and ATM: cell cycle, cell death, and cancer. Adv. Cancer Res. 71:1-25[Medline].

MORROW, D. M., D. A. TAGLE, Y. SHILOH, F. S. COLLINS, and P. HIETER, 1995  TEL1, an S. cerevisiae homolog of the human gene mutated in ataxia telangiectasia, is functionally related to the yeast checkpoint gene MEC1. Cell 82:831-840[Medline].

NAVAS, T. A., Z. ZHOU, and S. J. ELLEDGE, 1995  DNA polymerase epsilon links the DNA replication machinery to the S phase checkpoint. Cell 80:29-39[Medline].

NAVAS, T. A., Y. SANCHEZ, and S. J. ELLEDGE, 1996  RAD9 and DNA polymerase epsilon form parallel sensory branches for transducing the DNA damage checkpoint signal in Saccharomyces cerevisiae.. Genes Dev. 10:2632-2643[Abstract/Free Full Text].

PAULOVICH, A. G. and L. H. HARTWELL, 1995  A checkpoint regulates the rate of progression through S phase in S. cerevisiae in response to DNA damage. Cell 82:841-847[Medline].

PAULOVICH, A. G., R. U. MARGULIES, B. M. GARVIK, and L. H. HARTWELL, 1997  RAD9, RAD17, and RAD24 are required for S phase regulation in Saccharomyces cerevisiae in response to DNA damage. Genetics 145:45-62[Abstract].

ROBINSON, M. K., W. H. VAN ZYL, E. M. PHIZICKY, and J. R. BROACH, 1994  TPD1 of Saccharomyces cerevisiae encodes a protein phosphatase 2C-like activity implicated in tRNA splicing and cell separation. Mol. Cell. Biol. 14:3634-3645[Abstract/Free Full Text].

ROEDER, A. D., G. J. HERMANN, B. R. KEEGAN, S. A. THATCHER, and J. M. SHAW, 1998  Mitochondrial inheritance is delayed in Saccharomyces cerevisiae cells lacking the serine/threonine phosphatase PTC1. Mol. Biol. Cell 9:917-930[Abstract/Free Full Text].

SANCHEZ, Y., B. A. DESANY, W. J. JONES, Q. LIU, and B. WANG et al., 1996  Regulation of RAD53 by the ATM-like kinases MEC1 and TEL1 in yeast cell cycle checkpoint pathways. Science 271:357-360. [see comments][Abstract].

SANTOCANALE, C. and J. F. DIFFLEY, 1998  A Mec1- and Rad53-dependent checkpoint controls late-firing origins of DNA replication. Nature 395:615-618[Medline].

SHIRAHIGE, K., Y. HORI, K. SHIRAISHI, M. YAMASHITA, and K. TAKAHASHI et al., 1998  Regulation of DNA-replication origins during cell-cycle progression. Nature 395:618-621[Medline].

SIDOROVA, J. M. and L. L. BREEDEN, 1997  Rad53-dependent phosphorylation of Swi6 and down-regulation of CLN1 and CLN2 transcription occur in response to DNA damage in Saccharomyces cerevisiae.. Genes Dev. 11:3032-3045[Abstract/Free Full Text].

SIEDE, W., A. S. FRIEDBERG, and E. C. FRIEDBERG, 1993  RAD9-dependent G1 arrest defines a second checkpoint for damaged DNA in the cell cycle of Saccharomyces cerevisiae.. Proc. Natl. Acad. Sci. USA 90:7985-7989[Abstract/Free Full Text].

SIKORSKI, R. S. and P. HIETER, 1989  A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.. Genetics 122:19-27[Abstract/Free Full Text].

SORGER, P. K. and A. W. MURRAY, 1992  S-phase feedback control in budding yeast independent of tyrosine phosphorylation of p34cdc28. Nature 355:365-368[Medline].

STARK, M. J., 1996  Yeast protein serine/threonine phosphatases: multiple roles and diverse regulation. Yeast 12:1647-1675[Medline].

STETTLER, S., N. CHIANNILKULCHAI, S. HERMANN-LE DENMAT, D. LALO, and F. LACROUTE et al., 1993  A general suppressor of RNA polymerase I, II and III mutations in Saccharomyces cerevisiae.. Mol. Gen. Genet. 239:169-176[Medline].

SUN, Z., D. S. FAY, F. MARINI, M. FOIANI, and D. F. STERN, 1996  Spk1/Rad53 is regulated by Mec1-dependent protein phosphorylation in DNA replication and damage checkpoint pathways. Genes Dev. 10:395-406[Abstract/Free Full Text].

VIALARD, J. E., C. S. GILBERT, C. M. GREEN, and N. F. LOWNDES, 1998  The budding yeast Rad9 checkpoint protein is subjected to Mec1/Tel1-dependent hyperphosphorylation and interacts with Rad53 after DNA damage. EMBO J. 17:5679-5688[Medline].

WACH, A., A. BRACHAT, R. POHLMANN, and P. PHILIPPSEN, 1994  New heterologous modules for classical or PCR-based gene disruptions in Saccharomyces cerevisiae.. Yeast 10:1793-1808[Medline].

WEINERT, T., 1998  DNA damage checkpoints update: getting molecular. Curr. Opin. Genet. Dev. 8:185-193[Medline].

WEINERT, T. A., 1992  Dual cell cycle checkpoints sensitive to chromosome replication and DNA damage in the budding yeast Saccharomyces cerevisiae.. Radiat. Res. 132:141-143[Medline].

WEINERT, T. A. and L. H. HARTWELL, 1988  The RAD9 gene controls the cell cycle response to DNA damage in Saccharomyces cerevisiae.. Science 241:317-322[Abstract/Free Full Text].

WELIHINDA, A. A., W. TIRASOPHON, S. R. GREEN, and R. J. KAUFMAN, 1998  Protein serine/threonine phosphatase Ptc2p negatively regulates the unfolded-protein response by dephosphorylating Ire1p kinase. Mol. Cell. Biol. 18:1967-1977[Abstract/Free Full Text].

WOLFE, K. H. and D. C. SHIELDS, 1997  Molecular evidence for an ancient duplication of the entire yeast genome. Nature 387:708-713[Medline].

ZHAO, X., E. G. MULLER, and R. ROTHSTEIN, 1998  A suppressor of two essential checkpoint genes identifies a novel protein that negatively affects dNTP pools. Mol. Cell 2:329-340[Medline].

ZHENG, P., D. S. FAY, J. BURTON, H. XIAO, and J. L. PINKHAM et al., 1993  SPK1 is an essential S-phase-specific gene of Saccharomyces cerevisiae that encodes a nuclear serine/threonine/tyrosine kinase. Mol. Cell. Biol. 13:5829-5842[Abstract/Free Full Text].

ZHOU, Z. and S. J. ELLEDGE, 1992  Isolation of crt mutants constitutive for transcription of the DNA damage inducible gene RNR3 in Saccharomyces cerevisiae.. Genetics 131:851-866[Abstract].

ZHOU, Z. and S. J. ELLEDGE, 1993  DUN1 encodes a protein kinase that controls the DNA damage response in yeast. Cell 75:1119-1127[Medline].

This article has been cited by other articles:

				N. Lancelot, G. Charier, J. Couprie, I. Duband-Goulet, B. Alpha-Bazin, E. Quemeneur, E. Ma, M.-C. Marsolier-Kergoat, V. Ropars, J.-B. Charbonnier, et al. The checkpoint Saccharomyces cerevisiae Rad9 protein contains a tandem tudor domain that recognizes DNA Nucleic Acids Res., September 27, 2007; 35(17): 5898 - 5912. [Abstract] [Full Text] [PDF]

				G. Guillemain, E. Ma, S. Mauger, S. Miron, R. Thai, R. Guerois, F. Ochsenbein, and M.-C. Marsolier-Kergoat Mechanisms of Checkpoint Kinase Rad53 Inactivation after a Double-Strand Break in Saccharomyces cerevisiae Mol. Cell. Biol., May 1, 2007; 27(9): 3378 - 3389. [Abstract] [Full Text] [PDF]

				C. Clemenson and M.-C. Marsolier-Kergoat The Spindle Assembly Checkpoint Regulates the Phosphorylation State of a Subset of DNA Checkpoint Proteins in Saccharomyces cerevisiae Mol. Cell. Biol., December 15, 2006; 26(24): 9149 - 9161. [Abstract] [Full Text] [PDF]

				A. Gonzalez, A. Ruiz, R. Serrano, J. Arino, and A. Casamayor Transcriptional Profiling of the Protein Phosphatase 2C Family in Yeast Provides Insights into the Unique Functional Roles of Ptc1 J. Biol. Chem., November 17, 2006; 281(46): 35057 - 35069. [Abstract] [Full Text] [PDF]

				J. A. Sharp, G. Rizki, and P. D. Kaufman Regulation of Histone Deposition Proteins Asf1/Hir1 by Multiple DNA Damage Checkpoint Kinases in Saccharomyces cerevisiae Genetics, November 1, 2005; 171(3): 885 - 899. [Abstract] [Full Text] [PDF]

				C. Dubacq, A. Chevalier, and C. Mann The Protein Kinase Snf1 Is Required for Tolerance to the Ribonucleotide Reductase Inhibitor Hydroxyurea Mol. Cell. Biol., March 15, 2004; 24(6): 2560 - 2572. [Abstract] [Full Text] [PDF]