help button home button Genetics Science
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Landry, S.
Right arrow Articles by Hoffman, C. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Landry, S.
Right arrow Articles by Hoffman, C. S.
Genetics, Vol. 154, 1463-1471, April 2000, Copyright © 2000

The Fission Yeast git5 Gene Encodes a Gß Subunit Required for Glucose-Triggered Adenylate Cyclase Activation

Sheila Landrya, Maria T. Pettit1,a, Ethel Apolinario2,a, and Charles S. Hoffmana
a Department of Biology, Boston College, Chestnut Hill, Massachusetts 02467

Corresponding author: Charles S. Hoffman, Department of Biology, Boston College, Higgins Hall 315, Chestnut Hill, MA 02467., hoffmacs{at}bc.edu (E-mail)

Communicating editor: P. G. YOUNG


*  ABSTRACT
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Fission yeast adenylate cyclase is activated by the gpa2 G{alpha} subunit of a heterotrimeric guanine-nucleotide binding protein (G protein). We show that the git5 gene, also required for this activation, encodes a Gß subunit. In contrast to another study, we show that git5 is not a negative regulator of the gpa1 G{alpha} involved in the pheromone response pathway. While 43% identical to mammalian Gß's, the git5 protein lacks the amino-terminal coiled-coil found in other Gß subunits, yet the gene possesses some of the coding capacity for this structure 5' to its ORF. Although both gpa2 (G{alpha}) and git5 (Gß) are required for adenylate cyclase activation, only gpa2 is needed to maintain basal cAMP levels. Strains bearing a git5 disruption are derepressed for fbp1 transcription and sexual development even while growing in a glucose-rich environment, although fbp1 derepression is half that observed in gpa2 deletion strains. Multicopy gpa2 partially suppresses the loss of git5, while the converse is not true. These data suggest that Gß is required for activation of adenylate cyclase either by promoting the activation of G{alpha} or by independently activating adenylate cyclase subsequent to G{alpha} stimulation as seen in type II mammalian adenylate cyclase activation.


HETEROTRIMERIC G proteins are composed of {alpha}, ß, an {gamma} subunits and regulate many eukaryotic signal transduction pathways. G protein activation involves a receptor-stimulated GDP to GTP exchange of the guanine nucleotide bound to the G{alpha} subunit, followed by the release of the G{alpha} subunit from the Gß{gamma} dimer (GILMAN 1984 Down, GILMAN 1987 Down; LEVITZKI and BAR-SINAI 1991 Down; SIMON et al. 1991 Down). Originally, it was proposed that the G{alpha} subunit alone regulates the activity of effector molecules directly; however, this model has undergone considerable revision, as effectors that are stimulated by Gß{gamma} alone, by G{alpha} and Gß{gamma} acting independently, or by G{alpha} in concert with Gß{gamma} have been identified (CLAPHAM and NEER 1993 Down; STERNWEIS 1994 Down).

Two genes from the fission yeast Schizosaccharomyces pombe that encode G{alpha} subunits have been identified. The gpa1 gene encodes a positive regulator of the pheromone-induced mating pathway (OBARA et al. 1991 Down). Deletion of gpa1 results in a mating and sporulation defect, while an activated mutant allele causes a pheromone-independent production of conjugation tubes. The gpa2 gene encodes a positive regulator of adenylate cyclase acting in a glucose-monitoring pathway (ISSHIKI et al. 1992 Down). Disruption of gpa2 causes constitutive mating and sporulation in homothallic strains, reduces basal cAMP levels, and eliminates the glucose-induced cAMP response. A single Gß gene, gpb1, has been cloned and was proposed to encode a negative regulator of gpa1 in the pheromone response pathway (KIM et al. 1996 Down). Deletion of gpb1 results in increased mating and sporulation, which is suppressed by loss of either gpa1 or ras1, but has no effect on basal cAMP levels. No G{gamma} subunits have been identified previously in S. pombe.

S. pombe regulates intracellular cAMP levels in response to nutritional signals (MAEDA et al. 1990 Down; HOFFMAN and WINSTON 1991 Down; ISSHIKI et al. 1992 Down; MOCHIZUKI and YAMAMOTO 1992 Down; BYRNE and HOFFMAN 1993 Down), controlling conjugation and sporulation, and the transcription of the fbp1 gene that encodes the gluconeogenic enzyme fructose-1,6-bisphosphatase. Mutations in the git2/cyr1 gene encoding adenylate cyclase (YAMAWAKI-KATAOKA et al. 1989 Down; YOUNG et al. 1989 Down; MAEDA et al. 1990 Down; HOFFMAN and WINSTON 1991 Down) cause constitutive fbp1 transcription (HOFFMAN and WINSTON 1990 Down, HOFFMAN and WINSTON 1991 Down) and allow conjugation and sporulation in homothallic (h90) strains in the absence of a nitrogen- or glucose-starvation signal (MAEDA et al. 1990 Down; KAWAMUKAI et al. 1991 Down). As mentioned above, deletion of gpa2 causes similar phenotypes, although the effects of git2/cyr1 deletions are more pronounced than the effects of a gpa2 deletion.

Previously, we identified eight git (glucose insensitive transcription) genes by mutations that confer constitutive fbp1 transcription (HOFFMAN and WINSTON 1990 Down). These genes encode a cAMP-dependent protein kinase (PKA) activation pathway (HOFFMAN and WINSTON 1991 Down; BYRNE and HOFFMAN 1993 Down), including the adenylate cyclase git2 (cyr1) gene, six genes required for activation of adenylate cyclase (git1, git3, git5, git7, git8, and git10), and the pka1 (git6) gene that encodes the PKA catalytic subunit (MAEDA et al. 1994 Down; JIN et al. 1995 Down). While mutations in git1, git3, git5, git7, git8, and git10 all abolish the glucose-triggered activation of adenylate cyclase, only mutations in git7 and git8 reduce basal cAMP levels (BYRNE and HOFFMAN 1993 Down). We showed previously that git8 is identical to the G{alpha} gene gpa2 (NOCERO et al. 1994 Down). In this article, we describe the cloning and characterization of the git5 gene, which is identical to gpb1. We provide evidence that a sequencing error in the gpb1 study results in the misidentification of the start of the git5/gpb1 open reading frame (ORF) and that the product lacks the amino-terminal coiled-coil domain found in all other Gß subunits. Our data suggest that the git5 product functions to activate adenylate cyclase in a glucose-monitoring pathway and is not part of the gpa1-regulated pheromone response pathway. Two possible roles for this Gß in adenylate cyclase activation are discussed.


*  MATERIALS AND METHODS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Yeast strains and growth media:
Yeast strains used are listed in Table 1. Genetic nomenclature for S. pombe follows rules proposed by KOHLI 1987 Down. The fbp1::ura4+ and ura4::fbp1-lacZ reporter constructs have been described previously (HOFFMAN and WINSTON 1990 Down). Only relevant genotypes are given in the text and legends.


 
View this table:
[in this window]
[in a new window]

 
Table 1. Strain list

Standard rich media yeast extract agar and yeast extract liquid (GUTZ et al. 1974 Down) were supplemented with 2% casamino acids. Pombe minimal (PM) media (WATANABE et al. 1988 Down) were supplemented with required nutrients at 75 mg/liter, except for leucine, which was added to 150 mg/liter. Glucose was generally present at a concentration of 3%, unless otherwise specified. Sensitivity to 5-fluoroorotic acid (5-FOA) was determined on SC solid media containing 8% glucose as described previously (HOFFMAN and WINSTON 1991 Down). Strains were grown at 30°.

Recombinant DNA methodology:
Standard recombinant DNA techniques, including DNA restriction digests, ligations, and Escherichia coli transformations, were performed according to AUSUBEL et al. 1998 Down. Yeast transformations and plasmid rescue into E. coli were performed as previously described (DAL SANTO et al. 1996 Down). DNA sequencing was performed using the CircumVent thermal cycle DNA sequencing kit (New England Biolabs, Beverly, MA) according to the manufacturer's directions using oligonucleotides from National Biosciences Inc.

Cloning of git5+:
Constitutive transcription of thefbp1-ura4+ reporter due to the git5-311 mutant allele in CHP311 results in a 5-FOA-sensitive phenotype. The git5+ gene carried on plasmid pMP1 was cloned by its ability to confer 5-FOA resistance upon transformation of strain CHP311 with a S. pombe genomic library (MOLZ et al. 1989 Down) from ~20,000 Leu+ transformants. Subcloning experiments identified the portion of the insert DNA carrying the git5+ gene. The sequence of this region (accession no. AF092102), determined on both strands at least once, is identical to the complement of bp 3461–4680 of cosmid c973 (accession no. AB004535) carrying S. pombe genomic DNA from chromosome II.

Plasmid pMP1 was linearized with BglII and was integrated into strain FWP112 (git+; HOFFMAN and WINSTON 1990 Down) by homologous recombination. One integrant was crossed with strain CHP75 (git5-75; HOFFMAN and WINSTON 1990 Down), and the progeny were examined by tetrad dissection. Progeny displayed tight genetic linkage between the LEU2 marker carried on plasmid pMP1 and the git5 mutation (no recombination in 27 tetrads), suggesting that plasmid integration occurred at the git5 locus.

Plasmid pSL10 carrying a cDNA clone of git5+ was identified from a {lambda}ZAP II S. pombe cDNA library (PIDOUX et al. 1996 Down) using the GeneTrapper kit (Life Technologies) with cloning primer git5-GT 5' TGTAGATATGTCGATGTCAGGA 3' according to manufacturer's instructions.

Quantitative oligonucleotide-directed S1 analysis:
Oligonucleotide-directed S1 was performed as described previously (AUSUBEL et al. 1998 Down; using the aqueous hybridization protocol) to measure the level of git5 transcription and to detect possible splicing events 5' to the git5 ORF. A git5-specific primer (git5-oligoS1 5' CATCTTTAGAAATTGAACCAGTATTCCGTCTAATATTCATACAACAGTAACGCCCA 3') and a control primer to the his3 gene (his3-oligoS1 5' TCCATTCCATGTAGGGTGCTCATT 3') were used in combination with RNA isolated from exponential phase cells of strain 972 h- grown in PM medium containing either 8% glucose (repressing conditions) or 0.1% glucose plus 3% glycerol (derepressing conditions). RNA was isolated by hot acid phenol extraction (AUSUBEL et al. 1998 Down).

Construction of a git5{Delta} gene disruption:
The git5 gene was disrupted by replacing a BamHI to XbaI fragment including codons 99–152 of the git5 ORF with a 1.9-kb BglII to XbaI DNA fragment carrying the his7+ gene (APOLINARIO et al. 1993 Down). A linear DNA fragment carrying the his7+-marked git5 disruption was used to replace the git5+ gene in strain FWP94 (gpa2+; resulting in strain CHP463) and in strain CHP462 (gpa2{Delta}; resulting in strain CHP469). The git5-1::his7+ disruption (git5{Delta}) was then crossed into strains carrying thefbp1-ura4+ reporter and was shown to confer a 5-FOA-sensitive phenotype, similar to that of git5 mutant strains. Complementation tests with other git mutant strains were performed as previously described (HOFFMAN and WINSTON 1990 Down). The 5-FOA-sensitive phenotype of diploids constructed by mating a git5{Delta} strain with a git5 point mutant places the git5{Delta} allele in the git5 complementation group.

Subcloning of the git5 ORF:
A 1.4-kb SspI fragment from plasmid pSL10, carrying the git5 ORF, was blunt-end ligated into the SmaI site of plasmid pART1 (MCLEOD et al. 1987 Down). Plasmid pSL11 expresses the git5 ORF from the adh promoter in the vector. Plasmid pSL12 carries the git5 ORF in the opposite orientation with respect to the adh promoter.

High-copy-number suppression analyses:
High-copy-number suppression was determined by transforming host strains to Leu+ with plasmids expressing gpa2+ or git5+, along with empty-vector controls. Transformants were tested for sensitivity or resistance to 5-FOA, as an indication of fbp1-ura4+ transcription, and assayed for ß-galactosidase activity expressed from the fbp1-lacZ reporter as described previously (NOCERO et al. 1994 Down).

cAMP assays:
Intracellular cAMP levels were measured in glucose-starved cells (basal level) and in the same cultures 1 min after exposure to 100 mM glucose as previously described (BYRNE and HOFFMAN 1993 Down).


*  RESULTS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Cloning and nucleotide sequence of the git5+ gene:
The git5+ gene was cloned from an S. pombe genomic library by its ability to complement a git5 mutation in strain CHP311 (see MATERIALS AND METHODS). Homologous integration of this plasmid and a subsequent linkage analysis demonstrated that the clone carries the git5+ gene, rather than a high-copy-number suppressor of the git5-311 mutation. Our DNA sequence analysis in the region of plasmid pMP1 that carries the git5 complementing activity (accession no. AF092102) reveals that git5+ gene is the same as gpb1 (KIM et al. 1996 Down; accession no. L28061), encoding a Gß subunit family member. This gene has also been sequenced as part of the S. pombe Genome Sequencing Project (http://www.sanger.ac.uk/Projects/S_pombe/) and is present on cosmid c973 (accession no. AB004535). However, while our sequence and the cosmid sequence both predict a 305-amino acid product, the gpb1 sequence predicts a 317-amino acid product. This is due to a single base pair missing from the gpb1 sequence relative to the cosmid and our git5 sequences that shifts an ATG start codon that is upstream from, but out-of-frame with, the git5 ORF into the same frame as the 305-codon ORF. This A-T base pair is part of an SspI restriction site that separates the out-of-frame ATG from the 305-codon ORF. SspI digestion of plasmid pMP1 (git5+ genomic clone) produces 1.4- and 2.6-kb fragments as predicted if this SspI site is present, and not the 4.0-kb fragment predicted if this site is absent (Fig 1). The 4.15- and 7.8-kb bands produced by SspI digestion of pMP1 are consistent with predictions for the junction fragments of vector and insert DNA. SspI digestion of plasmid pSL10 (git5+ cDNA clone; see MATERIALS AND METHODS) results in the same 1.4-kb SspI restriction fragment that carries the git5 ORF (Fig 1). The presence of this SspI site proves that the ATG identified as the start codon in the gpb1 sequence is not in-frame with the 305-codon Gß-encoding ORF.



View larger version (41K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1. Ssp1 restriction digestion of genomic and cDNA clones of git5+. (A) Plasmids pWH5 (lane 1), pMP1 (git5+ genomic clone in pWH5; lane 2), pBluescript SK(-) (lane 3), and pSL10 [git5+ cDNA clone in pBluescript SK(-); lane 4] were digested with SspI and electrophoresed on a 1.2% agarose gel. Size standards (M) contain {lambda} BstEII DNA. The 1.4-kb fragment common to pMP1 and pSL10 (indicated by an arrow) demonstrates the presence of an SspI site immediately 5' to the git5 ORF, as well as a second SspI site 0.46 kb 3' to the git5 ORF. (B) Schematic of the 10.6-kb insert in pMP1. Plasmid pMP1 carries the region of chromosome 2 from base pair 34,804 of cosmid c1750 (accession no. AB004534) to base pair 10267 of cosmid c973 (accession no. AB004535). The position and orientation of the git5+ ORF is indicated as an arrow. HindIII (H), SspI (S), BamHI (B), and XbaI (X) sites are marked. The SspI site in question, indicated with an asterisk, contributes to the production of the 2.6- and 1.4-kb SspI restriction fragments in lane 2 of A and of the 1.4-kb SspI restriction fragment in lane 4 of A.

Analysis and subcloning of the git5 ORF:
The putative 305-residue git5 product is ~44% identical and 62% similar to Gß subunits from other organisms (Fig 2). However, for the 16 residues identified as contacting the G{alpha} subunit from a crystal structure analysis (SONDEK et al. 1996 Down), git5 displays 63% identity and 75% similarity to members of this family.



View larger version (52K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2. The amino acid sequence alignment between the predicted git5 protein and two other Gß subunits. Included in the git5 protein sequence are the hypothetical residues encoded by the 34 codons upstream from the translational start, including 1 stop codon (X). This sequence has been aligned with the murine Gß4 (mGb4; P29387) and the bovine Gß1 (bosGb1; 1942174) subunits using the CLUSTAL W version 1.7 sequence alignment program (THOMPSON et al. 1994 Down) and was displayed using BOXSHADE. The SspI site used to subclone the git5 ORF breaks the DNA between the second and third base pairs of the isoleucine (I) codon indicated by an arrow. The starting methionine of the git5 protein is indicated by an asterisk. Identical residues are shaded in black, while conserved residues are shaded in gray. The positions of contact residues between the bosGb1 Gß subunit and the bovine G{alpha} and G{gamma} subunits determined by SONDEK et al. 1996 Down are indicated by A and G, respectively. Uppercase lettering identifies sites where git5 possesses an identical or conserved residue to mGb4 or bosGb1, and lowercase lettering identifies sites where git5 residues are not conserved.

The most unusual characteristic of the predicted 305-residue product is the absence of 36 residues at the amino terminus relative to other members of this family (Fig 2). This region of other Gß subunits forms a coiled-coil that appears to be required for the formation of the Gß{gamma} dimer (GARRITSEN et al. 1993 Down; WALL et al. 1995 Down; GARCIA-HIGUERA et al. 1996 Down; LAMBRIGHT et al. 1996 Down; SONDEK et al. 1996 Down; PELLEGRINO et al. 1997 Down). According to SONDEK et al. 1996 Down, the bovine Gß (Fig 2, bosGb1) has an amino-terminal 47-residue coiled-coil preceding the classic seven-bladed ß propeller structure formed by WD repeat proteins. Of these 47 residues, 20 form contacts with the G{gamma} subunit. Modeling of the 305-residue git5 protein predicts only 14 residues preceding the ß propeller, suggesting a loss of 15 G{gamma} contact residues (data not shown). Of the remaining 34 G{gamma} contact residues of bosGb1, 19 (56%) are conserved in git5 (Fig 2). However, the location of these conserved residues is strikingly restricted to the central blades of the Gß that contact G{gamma}. In blades 5, 6, 7, and 1, 16 of 21 (76%) G{gamma} contact residues are conserved, while in blades 2 and 4, as well as the 14 residues preceding the ß propeller, only 3 of 13 (23%) G{gamma} contact residues are conserved.

The git5 gene contains a single 305-codon ORF:
The coding capacity of the DNA immediately upstream of the git5 ORF displays characteristics of a classical Gß subunit amino terminus, as residues defined by the 9 "codons" prior to the start codon are highly conserved with respect to other Gß subunits (Fig 2). In addition, the sequence TAG, which commonly identifies a 3' splice site in S. pombe, is present 3' to the in-frame STOP codon preceding the git5 ORF but 5' to these codons. This led us to assume that one or more exons must be present 5' to this ORF, such that the true git5 product possesses a standard amino-terminal coiled-coil. However, several lines of evidence suggest that there is no splicing and that the 305-codon ORF encodes the complete and functional git5 product.

We have cloned a cDNA copy of git5 (see MATERIALS AND METHODS) and found its sequence to be colinear to the genomic DNA. The cloned sequence in plasmid pSL10 initiates 122 bp upstream from the start codon of the 305-residue ORF. The cDNA sequenced in the gbp1 study (KIM et al. 1996 Down) initiated 324 bp upstream from the ATG of the 305-codon ORF and also showed no evidence of splicing. Therefore, at this crude level, it does not appear that the 305-codon ORF is connected to an upstream exon by splicing.

We have looked directly for evidence of splicing at the 5' end of the git5 ORF by oligonucleotide-directed S1 analysis. A 56-nucleotide (nt) probe complementary to the git5 transcript and extending past the in-frame STOP codon preceding the ORF was used both to measure levels of git5 transcription and to detect splice junctions within this region. The probe terminates in 4 nt that are not complementary to the git5 sequence. End-labeled probe was hybridized to RNA from cells grown under repressing and derepressing conditions and treated with exonuclease S1 to degrade any unannealed probe, along with single-stranded portions of the annealed probe. The appearance of a 52-nt protected fragment indicates that git5 transcription initiates upstream from the region complementary to this probe (Fig 3A and Fig B). An overexposed S1 analysis (Fig 3B) shows that the UAG sequence in this region of the mRNA does not serve as a 3' splice site. If such splicing occurred, it would have produced a transcript that only protects 29 nt at the 5' end of the probe. In addition, the ratio of the git5-specific product to a his3-specific product that serves as a loading control reveals a modest increase in git5 transcription under derepressing conditions (Fig 3A).



View larger version (21K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3. Oligonucleotide-directed S1 analysis of git5 transcript levels and of a candidate splice junction in the git5 transcript. (A) A 56-nt probe, complementary to the git5 transcript, and a 24-nt probe, complementary to the his3 transcript (a loading control), were hybridized with RNA from 972 (h-) cells grown under glucose-rich (R) and glucose-starved (D) conditions and digested with exonuclease S1 (see MATERIALS AND METHODS). The relative intensities of the S1-protected fragments indicate that git5 transcription is increased modestly by glucose starvation (less than fourfold). (B) Alignment of a schematic of the git5 S1 analysis with an overexposed S1 digest shows no sign of splicing 5' to the 305-codon git5 ORF. Two lanes of an S1 digest are presented horizontally with the gel run left to right. The top lane (Probe) contains the untreated git5 56-mer probe and his3 24-mer probe as size standards. The bottom lane (S1) contains the S1-protected products of an analysis using these probes. The git5 probe produces a major 52-nt band, along with minor bands of 47, 48, and 49 nt. The his3 probe produces bands of 21 and 20 nt, along with bands of 24, 23, and 22 nt representing incompletely digested probe. The bands are roughly colinear with the schematic representation of the probe and RNA alignment. There is no detectable band at 29 nt that would be produced by hybridization of the probe to a transcript that was spliced at the UAG sequence (indicated by asterisks) in the RNA. The 47-, 48,- and 49-nt bands, along with several fainter bands, are likely due to partial melting of the A-T-rich 3' end of the probe from the RNA during S1 treatment.

To test whether the 305-codon ORF encodes a functional git5 protein, we subcloned the 1.4-kb SspI fragment encompassing this ORF from pSL10 into the pART1 expression vector. Both plasmids pSL11 and pSL12, which carry this fragment in either orientation relative to the vector-provided promoter, complement git5 mutations as they restore glucose repression of fbp1 transcription to the same degree as the original genomic clone (Fig 4 and Table 2), although pSL11 (expressing git5 from the plasmid-borne adh promoter) reduces the general growth rate of transformants. The ability of pSL12 to complement suggests that transcription must also occur from ars1 adjacent to the cloning polylinker to allow transcription of git5. Since these subclones separate the git5 ORF from all upstream git5 sequences including any other possible start codons, the product of this single exon is functional.



View larger version (74K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 4. High-copy-number suppression by gpa2+ (G{alpha}) and git5+ (Gß). Two independent transformants of strains FWP112 (git+, wild type), CHP477 (git5{Delta}), and CHP439 (gpa2{Delta}) transformed to Leu+ with pART1 (empty vector), pMP1 (git5a; genomic git5 clone), pSL12 (git5b, SspI subclone of git5 into pART1), or pGMSK1 (gpa2; NOCERO et al. 1994 Down) were tested for growth in the presence (right) and absence (left) of 5-FOA. Growth in the presence of 5-FOA reflects the ability to repress fbp1 transcription. Overexpression of either git5+ or gpa2+ suppresses the 5-FOA-sensitive phenotype of the git5{Delta} strain, while only overexpression of gpa2 suppresses the 5-FOA-sensitive phenotype of the gpa2{Delta} strain. Plasmid pSL11 (not shown) also confers 5-FOA resistance to strain CHP477 (git5{Delta}); however, pSL11 transformants display a general slow growth phenotype regardless of the host strain.


 
View this table:
[in this window]
[in a new window]

 
Table 2. ß-Galactosidase activity from fbp1-lacZ reporter

Disruption of git5 confers phenotypes associated with a defect in glucose monitoring, but not pheromone signaling:
Disruption of the git5 ORF (git5{Delta}; see MATERIALS AND METHODS) confers Git- mutant phenotypes, including elevated fbp1-lacZ expression in cells grown under glucose-rich conditions (Table 2) and 5-FOA-sensitive growth due to constitutive expression of the fbp1-ura4+ reporter (Fig 4; strain CHP477 carrying empty vector). Complementation analyses place this gene disruption in the git5 complementation group, as a git5-75/git5{Delta} diploid strain displays the Git- 5-FOA-sensitive phenotype (data not shown).

The git5 disruption also stimulates conjugation and sporulation of an h90 homothallic strain growing under nutrient-rich conditions that can be suppressed by exogenous cAMP, similar to the phenotype of a gpa2{Delta} strain (Fig 5). Derepression of sexual development was also attributed to the null allele in the gpb1 study, although the authors of that study concluded that this is due to the activation of the gpa1 protein that positively regulates the pheromone response pathway (KIM et al. 1996 Down). However, this interpretation is unjustified since conjugation and sporulation in the git5{Delta} mutants is starvation independent, but not pheromone independent.



View larger version (106K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 5. Starvation-independent sexual development in git5{Delta} strains. Cells of homothallic strains CHP483 (wild type), CHP481 (gpa2{Delta}), and CHP488 (git5{Delta}) were grown to log phase in PM liquid medium (at 37° to inhibit conjugation) and then diluted to 106 cells/ml in PM liquid medium with or without 5 mM cAMP. These cells were incubated for 24 hr at 30° without shaking and photographed.

As shown in Fig 6, a heterothallic git5{Delta} strain does not produce conjugation tubes when starved in the absence of a mating partner, as is seen in a strain carrying the activated allele of gpa1 (gpa1QL; OBARA et al. 1991 Down). Therefore, git5 does not negatively regulate gpa1.



View larger version (52K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 6. Conjugation tube formation remains pheromone-dependent in git5{Delta} strains. Cells of heterothallic h+ strains FWP87 (git5+ gpa1+), CHP478 (git5{Delta}), and CHP745 (gpa1QL) were pregrown on PM solid medium, transferred to SPA medium for 2 days at 30°, and photographed. Only the CHP745 (gpa1QL) cells display conjugation tubes in the absence of a pheromone-producing mating partner.

High-copy suppression by gpa2+ and git5+:
While multicopy git5+ expression suppresses git5 point mutations and a git5 deletion, it has no effect upon mutations in the other five genes required for adenylate cyclase activation (gpa2, git1, git3, git7, or git10; data shown for only the gpa2 mutant strain; Fig 4 and Table 2). In contrast to this, gpa2+ (G{alpha}) overexpression suppresses the mutant phenotypes associated with the git5 disruption (Fig 4 and Table 2). However, the suppression of a git5 deletion by gpa2+ overexpression is only partial compared to suppression by git5+ itself (Table 2), as indicated by the inability of G{alpha} overexpression to fully repress fbp1-lacZ expression in a git5 mutant strain. This genetic relationship is consistent with a model in which git5 acts in the same heterotrimeric G protein complex as gpa2 (see DISCUSSION).

cAMP levels in gpa2 and git5 disruption strains:
We showed previously that mutations in gpa2 (git8) or in git5 inhibit the glucose-triggered elevation of cAMP levels in fission yeast (BYRNE and HOFFMAN 1993 Down). This cAMP response is due to the activation of adenylate cyclase rather than the inactivation of cAMP phosphodiesterase, which converts cAMP to AMP. In that study, we also showed that the basal cAMP level was reduced in the gpa2/git8 (G{alpha}) mutant, but not in the git5 (Gß) mutant. We show here that deletion of git5 has no effect on basal cAMP levels in strains that either possess or lack the gpa2 gene (Table 3, experiment 1), in agreement with other deletion studies of these two genes (ISSHIKI et al. 1992 Down; KIM et al. 1996 Down). As with the point mutation in git5 (BYRNE and HOFFMAN 1993 Down), the git5 disruption inhibits the cAMP response to glucose (Table 3, experiment 2), confirming a role for git5 in the glucose-triggered adenylate cyclase activation pathway.


 
View this table:
[in this window]
[in a new window]

 
Table 3. Basal cAMP levels in S. pombe strains


*  DISCUSSION
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

We have shown that the fission yeast git5+ gene encodes a Gß subunit and is identical to the previously cloned gpb1+ gene (KIM et al. 1996 Down). While the gpb1 study concluded that this gene acts in the gpa1-regulated pheromone response pathway, and not in the gpa2-regulated adenylate cyclase activation pathway, we come to the opposite conclusions. Our work clearly shows that while git5 is not required for maintaining basal cAMP levels, it is needed to activate adenylate cyclase in response to glucose detection (Table 3). As the gpb1 study only examined basal cAMP levels, there were no direct data to indicate a defect in the cAMP pathway. We have shown previously that while git1+, git3+, git5+, git7+, git10+, and gpa2+ are all required for generating a cAMP response to glucose, only git7+ and gpa2+ are required for maintenance of basal cAMP levels (BYRNE and HOFFMAN 1993 Down).

The gpb1 study described the effects of a gbp1 deletion as stimulating conjugation and sporulation under nutrient-rich conditions, which we have also observed. While the authors of that study attributed this to the activation of the gpa1 protein of the pheromone response pathway, our observations are more consistent with a reduction in activation of gpa2 in the glucose-triggered adenylate cyclase activation pathway. If loss of git5/gpb1 activated gpa1, we would expect to see a pheromone-independent stimulation of conjugation as seen by the production of conjugation tubes in a heterothallic strain, similar to that seen in strains carrying an activated allele of gpa1 (gpa1QL; OBARA et al. 1991 Down). Since git5/gpb1 deletion strains conjugate in a nutrient-independent, but pheromone-dependent, fashion (Fig 5 and Fig 6), it appears that this Gß works in concert with gpa2, but not antagonistically to gpa1.

The data presented here show that the git5 Gß is required for adenylate cyclase activation. The git5 Gß may simply be required for the efficient activation of the gpa2 G{alpha}, facilitating the delivery of the G{alpha} to a G-protein-coupled receptor. Alternatively or in addition, git5 may act more directly to stimulate adenylate cyclase as seen for type II mammalian adenylate cyclase (GAO and GILMAN 1991 Down; TANG and GILMAN 1991 Down; FEDERMAN et al. 1992 Down). For these enzymes, both the G{alpha} subunit and the Gß{gamma} dimer act to stimulate adenylate cyclase in an ordered fashion with the G{alpha} subunit acting first. Our data to date cannot distinguish between these two possibilities.

As described above, the git5 Gß subunit is unusual in its lack of an amino-terminal coiled-coil found in all other members of this protein family. Complicating this observation is the presence of DNA sequences in the 5' untranslated region of the gene that have the capacity to encode a portion of this domain. At first, we assumed that a splicing event must occur to create a transcript that encodes a standard-length Gß. However, there is only one potential 3' splice junction between an upstream in-frame stop codon and the conserved LVQ codons immediately 5' to the large ORF (Fig 2 and Fig 3B). We show that this site is not utilized in splicing as determined by both DNA sequence analysis of cDNA clones and by the more sensitive oligonucleotide-directed S1 analysis (Fig 3B). Most importantly, a subclone containing only this single ORF is fully functional (Fig 4 and Table 2). Therefore, it appears that the genomic sequence immediately upstream from the 305-codon ORF is an evolutionary remnant from a gene that encoded a standard-length Gß subunit possessing an amino-terminal coiled-coil.

The absence of an amino-terminal coiled-coil in the git5 protein brings into question the existence of a G{gamma} subunit in this G protein, since binding to G{gamma} is the major function attributed to this region of Gß (GARRITSEN et al. 1993 Down; WALL et al. 1995 Down; GARCIA-HIGUERA et al. 1996 Down; LAMBRIGHT et al. 1996 Down; SONDEK et al. 1996 Down; PELLEGRINO et al. 1997 Down). However, we have preliminary evidence that suggests that the git5 Gß is part of a classical heterotrimeric G protein. We have isolated a cDNA clone in a two-hybrid screen using a git5 bait that appears to encode a G{gamma} subunit. The 71-codon ORF present on the cDNA is part of a 72-codon gene whose putative product displays characteristics of a G{gamma}, including a lysine-rich carboxy terminus and a carboxy-terminal CAAX box (S. LANDRY and C. S. HOFFMAN, unpublished results).

The regulation of S. pombe adenylate cyclase provides us with a genetically pliable model system for the study of G protein signal transduction that is significantly different from that of the well-studied Saccharomyces cerevisiae pheromone response pathway. In this latter system, the Gß{gamma} dimer is responsible for activation of a mitogen-activated protein kinase cascade, while the G{alpha} subunit is a negative regulator of pheromone response (WHITEWAY et al. 1988 Down; NOMOTO et al. 1990 Down). Given the cooperative functional nature of the G protein subunits in S. pombe adenylate cyclase activation and the lack of the amino-terminal coiled-coil in the Gß subunit, further studies of the relationship between G protein subunit interactions and effector activation in this system may provide us with new insights regarding mechanisms of G protein signal transduction.


*  FOOTNOTES

1 Present address: Georgetown University Medical Center, Washington, DC 20007. Back
2 Present address: Center of Marine Biotechnology, University of Maryland Biotechnology Institute, Baltimore, MD 21202. Back


*  ACKNOWLEDGMENTS

We thank Masayuki Yamamoto for gpa1QL strains and Eva Neer, Fred Winston, and Olaf Nielsen for helpful conversations, suggestions, and questions during the course of this work. We thank Tom Chiles for critical reading of this manuscript and Junona Moroianu for the use of her microscope. This study was supported by National Institutes of Health grant GM46226 to C.S.H.

Manuscript received May 17, 1999; Accepted for publication December 16, 1999.


*  LITERATURE CITED
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

APOLINARIO, E., M. NOCERO, M. JIN, and C. S. HOFFMAN, 1993  Cloning and manipulation of the Schizosaccharomyces pombe his7+ gene as a new selectable marker for molecular genetic studies. Curr. Genet. 24:491-495[Medline].

AUSUBEL, F. M., R. BRENT, R. E. KINGSTON, D. D. MOORE, J. G. SEIDMAN et al. 1998 Current Protocols in Molecular Biology. Wiley-Interscience, New York.

BYRNE, S. M. and C. S. HOFFMAN, 1993  Six git genes encode a glucose-induced adenylate cyclase activation pathway in the fission yeast Schizosaccharomyces pombe.. J. Cell Sci. 105:1095-1100[Abstract].

CLAPHAM, D. E. and E. J. NEER, 1993  New roles for G-protein beta gamma-dimers in transmembrane signalling. Nature 365:403-406[Medline].

DAL SANTO, P., B. BLANCHARD, and C. S. HOFFMAN, 1996  The Schizosaccharomyces pombe pyp1 protein tyrosine phosphatase negatively regulates nutrient monitoring pathways. J. Cell Sci. 109:1919-1925[Abstract].

FEDERMAN, A. D., B. R. CONKLIN, K. A. SCHRADER, R. R. REED, and H. R. BOURNE, 1992  Hormonal stimulation of adenylyl cyclase through Gi-protein beta gamma subunits. Nature 356:159-161[Medline].

GAO, B. N. and A. G. GILMAN, 1991  Cloning and expression of a widely distributed (type IV) adenylyl cyclase. Proc. Natl. Natl. Acad. Sci. USA 88:10178-10182.

GARCIA-HIGUERA, I., J. FENOGLIO, Y. LI, C. LEWIS, and M. P. PANCHENKO et al., 1996  Folding of proteins with WD-repeats: comparison of six members of the WD-repeat superfamily to the G protein beta subunit. Biochemistry 35:13985-13994[Medline].

GARRITSEN, A., P. J. VAN GALEN, and W. F. SIMONDS, 1993  The N-terminal coiled-coil domain of beta is essential for gamma association: a model for G-protein beta gamma subunit interaction. Proc. Natl. Acad. Sci. USA 90:7706-7710[Abstract/Free Full Text].

GILMAN, A. G., 1984  G proteins and dual control of adenylate cyclase. Cell 36:577-579[Medline].

GILMAN, A. G., 1987  G proteins: transducers of receptor-generated signals. Annu. Rev. Biochem. 56:615-649[Medline].

GUTZ, H., H. HESLOT, U. LEUPOLD and N. LOPRIENO, 1974 Schizosaccharomyces pombe, pp. 395–446 in Handbook of Genetics, edited by R. C. KING. Plenum, New York.

HOFFMAN, C. S. and F. WINSTON, 1990  Isolation and characterization of mutants constitutive for expression of the fbp1 gene of Schizosaccharomyces pombe.. Genetics 124:807-816[Abstract].

HOFFMAN, C. S. and F. WINSTON, 1991  Glucose repression of transcription of the Schizosaccharomyces pombe fbp1 gene occurs by a cAMP signaling pathway. Genes Dev. 5:561-571[Abstract/Free Full Text].

ISSHIKI, T., N. MOCHIZUKI, T. MAEDA, and M. YAMAMOTO, 1992  Characterization of a fission yeast gene, gpa2, that encodes a G alpha subunit involved in the monitoring of nutrition. Genes Dev. 6:2455-2462[Abstract/Free Full Text].

JIN, M., M. FUJITA, B. M. CULLEY, E. APOLINARIO, and M. YAMAMOTO et al., 1995  sck1, a high copy number suppressor of defects in the cAMP-dependent protein kinase pathway in fission yeast, encodes a protein homologous to the Saccharomyces cerevisiae SCH9 kinase. Genetics 140:457-467[Abstract].

KAWAMUKAI, M., K. FERGUSON, M. WIGLER, and D. YOUNG, 1991  Genetic and biochemical analysis of the adenylyl cyclase of Schizosaccharomyces pombe. Cell Regul. 2:155-164[Medline].

KIM, D. U., S. K. PARK, K. S. CHUNG, M. U. CHOI, and H. S. YOO, 1996  The G protein beta subunit Gpb1 of Schizosaccharomyces pombe is a negative regulator of sexual development. Mol. Gen. Genet. 252:20-32[Medline].

KOHLI, J., 1987  Genetic nomenclature and gene list of the fission yeast Schizosaccharomyces pombe.. Curr. Genet. 11:575-589[Medline].

LAMBRIGHT, D. G., J. SONDEK, A. BOHM, N. P. SKIBA, and H. E. HAMM et al., 1996  The 2.0 A crystal structure of a heterotrimeric G protein. Nature 379:311-319[Medline].

LEVITZKI, A. and A. BAR-SINAI, 1991  The regulation of adenylyl cyclase by receptor-operated G proteins. Pharmacol. Ther. 50:271-283[Medline].

MAEDA, T., N. MOCHIZUKI, and M. YAMAMOTO, 1990  Adenylyl cyclase is dispensable for vegetative cell growth in the fission yeast Schizosaccharomyces pombe.. Proc. Natl. Acad. Sci. USA 87:7814-7818[Abstract/Free Full Text].

MAEDA, T., Y. WATANABE, H. KUNITOMO, and M. YAMAMOTO, 1994  cloning of the pka1 gene encoding the catalytic subunit of the cAMP-dependent protein kinase in Schizosaccharomyces pombe.. J. Biol. Chem. 269:9632-9637[Abstract/Free Full Text].

MCLEOD, M., M. STEIN, and D. BEACH, 1987  The product of the mei3+ gene, expressed under control of the mating-type locus, induces meiosis and sporulation in fission yeast. EMBO J. 6:729-736[Medline].

MOCHIZUKI, N. and M. YAMAMOTO, 1992  Reduction in the intracellular cAMP level triggers initiation of sexual development in fission yeast. Mol. Gen. Genet. 233:17-24[Medline].

MOLZ, L., R. BOOHER, P. YOUNG, and D. BEACH, 1989  cdc2 and the regulation of mitosis: six interacting mcs genes. Genetics 122:773-782[Abstract/Free Full Text].

NOCERO, M., T. ISSHIKI, M. YAMAMOTO, and C. S. HOFFMAN, 1994  Glucose repression of fbp1 transcription of Schizosaccharomyces pombe is partially regulated by adenylate cyclase activation by a G protein alpha subunit encoded by gpa2 (git8). Genetics 138:39-45[Abstract].

NOMOTO, S., N. NAKAYAMA, K. ARAI, and K. MATSUMOTO, 1990  Regulation of the yeast pheromone response pathway by G protein subunits. EMBO J. 9:691-696[Medline].

OBARA, T., M. NAKAFUKU, M. YAMAMOTO, and Y. KAZIRO, 1991  Isolation and characterization of a gene encoding a G-protein alpha subunit from Schizosaccharomyces pombe: involvement in mating and sporulation pathways. Proc. Natl. Acad. Sci. USA 88:5877-5881[Abstract/Free Full Text].

PELLEGRINO, S., S. ZHANG, A. GARRITSEN, and W. F. SIMONDS, 1997  The coiled-coil region of the G protein beta subunit. Mutational analysis of G gamma and effector interactions. J. Biol. Chem. 272:25360-25366[Abstract/Free Full Text].

PIDOUX, A. L., M. LEDIZET, and W. Z. CANDE, 1996  Fission yeast pkl1 is a kinesin-related protein involved in mitotic spindle function. Mol. Biol. Cell 7:1639-1655[Abstract].

SIMON, M. I., M. P. STRATHMANN, and N. GAUTAM, 1991  Diversity of G proteins in signal transduction. Science 252:802-808[Abstract/Free Full Text].

SONDEK, J., A. BOHM, D. G. LAMBRIGHT, H. E. HAMM, and P. B. SIGLER, 1996  Crystal structure of a G-protein beta gamma dimer at 2.1A resolution. Nature 379:369-374[Medline].

STERNWEIS, P. C., 1994  The active role of beta gamma in signal transduction. Curr. Opin. Cell Biol. 6:198-203[Medline].

TANG, W. J. and A. G. GILMAN, 1991  Type-specific regulation of adenylyl cyclase by G protein beta gamma subunits. Science 254:1500-1503[Abstract/Free Full Text].

THOMPSON, J. D., D. G. HIGGINS, and T. J. GIBSON, 1994  CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673-4680[Abstract/Free Full Text].

WALL, M. A., D. E. COLEMAN, E. LEE, J. A. INIGUEZ-LLUHI, and B. A. POSNER et al., 1995  The structure of the G protein heterotrimer Gi alpha 1 beta 1 gamma 2. Cell 83:1047-1058[Medline].

WATANABE, Y., Y. LINO, K. FURUHATA, C. SHIMODA, and M. YAMAMOTO, 1988  The S. pombe mei2 gene encoding a crucial molecule for commitment to meiosis is under the regulation of cAMP. EMBO J. 7:761-767[Medline].

WHITEWAY, M., L. HOUGAN, D. DIGNARD, L. BELL, and G. SAARI et al., 1988  Function of the STE4 and STE18 genes in mating pheromone signal transduction in Saccharomyces cerevisiae.. Cold Spring Harbor Symp. Quant. Biol. 53:585-590.

YAMAWAKI-KATAOKA, Y., T. TAMAOKI, H. R. CHOE, H. TANAKA, and T. KATAOKA, 1989  Adenylate cyclases in yeast: a comparison of the genes from Schizosaccharomyces pombe and Saccharomyces cerevisiae.. Proc. Natl. Acad. Sci. USA 86:5693-5697[Abstract/Free Full Text].

YOUNG, D., M. RIGGS, J. FIELD, A. VOJTEK, and D. BROEK et al., 1989  The adenylyl cyclase gene from Schizosaccharomyces pombe.. Proc. Natl. Acad. Sci. USA 86:7989-7993[Abstract/Free Full Text].




This article has been cited by other articles:


Home page
GeneticsHome page
M. A. Alaamery and C. S. Hoffman
Schizosaccharomyces pombe Hsp90/Git10 Is Required for Glucose/cAMP Signaling
Genetics, April 1, 2008; 178(4): 1927 - 1936.
[Abstract] [Full Text] [PDF]


Home page
Sci SignalHome page
C. S. Hoffman
Propping Up Our Knowledge of G Protein Signaling Pathways: Diverse Functions of Putative Noncanonical Gbeta Subunits in Fungi
Sci. Signal., January 23, 2007; 2007(370): pe3 - pe3.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
R. S. Kao, E. Morreale, L. Wang, F. D. Ivey, and C. S. Hoffman
Schizosaccharomyces pombe Git1 Is a C2-Domain Protein Required for Glucose Activation of Adenylate Cyclase
Genetics, May 1, 2006; 173(1): 49 - 61.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
L. Wang, K. Griffiths Jr., Y. H. Zhang, F. D. Ivey, and C. S. Hoffman
Schizosaccharomyces pombe Adenylate Cyclase Suppressor Mutations Suggest a Role for cAMP Phosphodiesterase Regulation in Feedback Control of Glucose/cAMP Signaling
Genetics, December 1, 2005; 171(4): 1523 - 1533.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
A. Lafon, J.-A. Seo, K.-H. Han, J.-H. Yu, and C. d'Enfert
The Heterotrimeric G-Protein GanB({alpha})-SfaD({beta})-GpgA({gamma}) Is a Carbon Source Sensor Involved in Early cAMP-Dependent Germination in Aspergillus nidulans
Genetics, September 1, 2005; 171(1): 71 - 80.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
F. D. Ivey and C. S. Hoffman
Direct activation of fission yeast adenylate cyclase by the Gpa2 G{alpha} of the glucose signaling pathway
PNAS, April 26, 2005; 102(17): 6108 - 6113.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
C. S. Hoffman
Except in Every Detail: Comparing and Contrasting G-Protein Signaling in Saccharomyces cerevisiae and Schizosaccharomyces pombe
Eukaryot. Cell, March 1, 2005; 4(3): 495 - 503.
[Full Text] [PDF]


Home page
Eukaryot CellHome page
P. Muller, A. Leibbrandt, H. Teunissen, S. Cubasch, C. Aichinger, and R. Kahmann
The G{beta}-Subunit-Encoding Gene bpp1 Controls Cyclic-AMP Signaling in Ustilago maydis
Eukaryot. Cell, June 1, 2004; 3(3): 806 - 814.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
K. Schadick, H. M. Fourcade, P. Boumenot, J. J. Seitz, J. L. Morrell, L. Chang, K. L. Gould, J. F. Partridge, R. C. Allshire, K. Kitagawa, et al.
Schizosaccharomyces pombe Git7p, a Member of the Saccharomyces cerevisiae Sgt1p Family, Is Required for Glucose and Cyclic AMP Signaling, Cell Wall Integrity, and Septation
Eukaryot. Cell, August 1, 2002; 1(4): 558 - 567.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
Q. Yang, S. I. Poole, and K. A. Borkovich
A G-Protein {beta} Subunit Required for Sexual and Vegetative Development and Maintenance of Normal G{alpha} Protein Levels in Neurospora crassa
Eukaryot. Cell, June 1, 2002; 1(3): 378 - 390.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
J. A. Alspaugh, R. Pukkila-Worley, T. Harashima, L. M. Cavallo, D. Funnell, G. M. Cox, J. R. Perfect, J. W. Kronstad, and J. Heitman
Adenylyl Cyclase Functions Downstream of the G{alpha} Protein Gpa1 and Controls Mating and Pathogenicity of Cryptococcus neoformans
Eukaryot. Cell, February 1, 2002; 1(1): 75 - 84.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
C. A. D'Souza, J. A. Alspaugh, C. Yue, T. Harashima, G. M. Cox, J. R. Perfect, and J. Heitman
Cyclic AMP-Dependent Protein Kinase Controls Virulence of the Fungal Pathogen Cryptococcus neoformans
Mol. Cell. Biol., May 1, 2001; 21(9): 3179 - 3191.
[Abstract] [Full Text]


Home page
GeneticsHome page
S. Landry and C. S. Hoffman
The git5 G{beta} and git11 G{{gamma}} Form an Atypical G{beta}{{gamma}} Dimer Acting in the Fission Yeast Glucose/cAMP Pathway
Genetics, March 1, 2001; 157(3): 1159 - 1168.
[Abstract] [Full Text]