- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Roller, A. B.
- Articles by Zahler, A. M.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Roller, A. B.
- Articles by Zahler, A. M.
The Allele-Specific Suppressor sup-39 Alters Use of Cryptic Splice Sites in Caenorhabditis elegans
A. Brock Rollera, David C. Hoffmana, and Alan M. Zahleraa Department of Biology and Center for Molecular Biology of RNA, University of California, Santa Cruz, California 95064
Corresponding author: Alan M. Zahler, Department of Biology and Center for Molecular Biology of RNA, Sinsheimer Laboratories, University of California, Santa Cruz, CA 95064., zahler{at}biology.ucsc.edu (E-mail)
Communicating editor: R. K. HERMAN
| ABSTRACT |
|---|
Mutations in the Caenorhabditis elegans sup-39 gene cause allele-specific suppression of the uncoordination defect of unc-73(e936). e936 is a point mutation that changes the canonical G at the 5' end of intron 16 to a U. This mutation activates three splice donors, two of which define introns beginning with the canonical GU. Use of these two cryptic splice sites causes loss of reading frame; interestingly these messages are not substrates for nonsense-mediated decay. The third splice donor, used in 10% of steady-state e936 messages, is the mutated splice donor at the wild-type position, which defines an intron beginning with UU. In the presence of a sup-39 mutation, these same three splice donors are used, but the ratio of messages produced by splicing at these sites changes. The percentage of unc-73(e936) messages containing the wild-type splice junction is increased to 33% with a corresponding increase in the level of UNC-73 protein. This sup-39-induced change was also observed when the e936 mutant intron region was inserted into a heterologous splicing reporter construct transfected into worms. Experiments with splicing reporter constructs showed that the degree of 5' splice site match to the splicing consensus sequence can strongly influence cryptic splice site choice. We propose that mutant SUP-39 is a new type of informational suppressor that alters the use of weak splice donors.
ANALYSIS of heritable genetic defects in humans has shown that 15% of point mutations responsible for genetic disease disrupt signals involved in splicing (![]()
![]()
![]()
![]()
![]()
The 32P-induced e936 mutant allele of the C. elegans unc-73 gene is a point mutation that changes the canonical G at the 5' end of intron 16 to a U (![]()
![]()
![]()
![]()
![]()
|
This e936 splice donor mutation is of interest because mutations in another gene, sup-39, cause dominant allele-specific extragenic suppression of the unc-73(e936) uncoordination phenotype (![]()
![]()
| MATERIALS AND METHODS |
|---|
Growth of C. elegans strains and isolation of RNA:
C. elegans strains were grown on plates and in liquid culture using standard methods (![]()
Generation of complementary DNAs:
Complementary DNAs (cDNAs) for the unc-73 gene were made in 25-µl reaction mixtures. Reaction mixtures contained 5 µg of total RNA, 25 pmol of oligodeoxynucleotide primer complementary to unc-73 exon 17 (5' ACTTGTCCATCAAAATCTGC 3'), 1 mM each of dATP, dCTP, dGTP, and dTTP, 1 unit of RNA Guard RNase inhibitor (Pharmacia, Piscataway, NJ), 1X AMV reverse transcriptase buffer (Promega, Madison, WI), and 10 units of AMV reverse transcriptase (Promega). Reaction mixtures were incubated at 37° for 1.5 hr and stored at -20°. One microliter of this reaction mixture was added directly to 25 µl PCRs.
Polymerase chain reactions:
Oligodeoxynucleotides corresponding to unc-73 exon 13 (5' ATCAAAGATCTCGAGAGATG 3'), exon 15 (5' AGAAGTTGTACGGATAAGAC 3'), complementary to exon 16 (5' GAAACTTCAATGCGTTTAGC 3'), and complementary to exon 17 (5' ACTTGTCCATCAAAATCTGC 3') were used in PCR mixtures with Taq DNA polymerase (Fisher Scientific, Pittsburgh) and unc-73 cDNAs. Gel-purified PCR products were ligated into EcoRV-cut and phosphatased pBluescript II KS/+ and transformed into Escherichia coli. For 32P PCRs, the exon 15 primer was 5' end-labeled at low specific activity with [
-32P]ATP (New England Nuclear, Boston) by T4 polynucleotide kinase (Amersham, Arlington Heights, IL). PCR products were phenol:CHCl3 (1:1) extracted and ethanol precipitated. Product DNA was resuspended in formamide and loaded onto 0.4-mm-thick 6% polyacrylamide urea gels in TBE buffer. After electrophoresis, the gels were dried onto filter paper and visualized with a Molecular Dynamics (Sunnyvale, CA) PhosphorImager. Quantitation of relative splice site usage was done using ImageQuant software (Molecular Dynamics).
RNase protection assays:
RNase protection assays were performed using the Ambion (Austin, TX) RPA II kit according to the manufacturer's instructions. 32P antisense probes were generated by in vitro transcription from digested plasmids. The ribosomal protein L5 mRNA probe was transcribed by T3 RNA polymerase from BglII-digested plasmid pMK250, which contains the C. elegans ribosomal protein L5 cDNA in pBluescript II/SK vector (a gift from Michael Koelle). The unc-73 antisense probe was transcribed using T7 RNA polymerase from pBluescript II/KS+ containing exons 15 and 16 of the wild-type unc-73 cDNA (described above) cut with HindIII. Two different mixed-stage total RNA isolates from each strain were probed. Initially 10 µg of total RNA was tested and RNA concentrations were adjusted for each strain to normalize the L5 mRNA signal. After digestion and ethanol precipitation, protected RNAs were separated on a 1-mm-thick 15-cm-long 6% urea acrylamide denaturing gel, the gel was dried onto chromatography paper, and bands were visualized with a Molecular Dynamics PhosphorImager. The radioactivity in each band was quantitated and the background radiation for the same position in the yeast RNA control lanes was subtracted. The normalized unc-73 mRNA signal was divided by the normalized L5 mRNA signal to determine the relative level of unc-73 mRNA. Digests were done at low RNase concentrations (1:1000 dilution of RNase A/T1 stock supplied with kit). This enzyme concentration did not distinguish between the different unc-73 mutant cryptic splice forms. At high RNase A/T1 concentrations (1:50 dilution of RNaseA/T1 stock supplied with kit) the +23 splice form could be detected as two different bands of higher mobility indicating digestion at the point where 23 nucleotides of this mRNA form looped out from the probe, while the wt and 1 splice forms were not internally cleaved (data not shown).
unc-73(e936); smg-3(r867) strain construction:
The following crosses were performed to generate unc-73(e936) I; smg-3(r867) IV double mutant animals. Males from a smg-3(r867) IV; him-5(e1490) V strain were crossed to unc-73(e936) hermaphrodites. Wild-type F1 progeny were selected. F2 hermaphrodite progeny showing the protruding vulva phenotype were then selected and F3 progeny showing both the unc-73 and smg-3 phenotypes were selected.
In addition to testing for the protruding vulva phenotype as a sign of the presence of smg-3(r867), a molecular test was done to confirm the presence of the smg-3 mutation in these strains. The C. elegans homolog of the pre-mRNA splicing factor SRp30b, EEED8.7, is alternatively spliced and the alternatively spliced form of the message containing a premature termination codon is a natural target for degradation by the smg pathway (![]()
![]()
Preparation of protein extracts and immunoblotting:
M9 buffer was used to rinse worms from three 150-mm plates into a centrifuge tube. Tubes were then centrifuged at 4000 x g to pellet the worms. The worm pellets were resuspended in an equal volume of SDS protein sample buffer [4% (w/v) SDS, 0.125 M Tris-Cl pH 6.8, 20% (v/v) glycerol, 10% (v/v) 2-mercaptoethanol] with 2.5 mM phenylmethylsulfonylfluoride added. The resuspended worms were immediately disrupted using a cuphorn sonicator probe for 1 min and then heated to 90° for 15 min. A total of 20 µl of each sample was then separated on a 1-mm-thick 10% SDS-PAGE gel and electroblotted onto nitrocellulose. The filter was probed with affinity-purified anti-UNC-73 rabbit polyclonal antibody (![]()
Generation of GFP/lacZ/unc-73 splicing reporter constructs:
The Fire vector pPD96.02 contains the unc-54 promoter driving expression of a green fluorescent protein (GFP)/ß galactosidase (lacZ) fusion with a nuclear localization signal. The coding region is interrupted by several synthetic introns to improve gene expression. There is a unique EcoRI site in the plasmid in a lacZ exon 16 codons before the end of the open reading frame. The exon 15/16 region of unc-73 genomic DNA was cloned into this EcoRI site. This region contained the last 117 nucleotides of exon 15, all 203 nucleotides of intron 16, and the first 141 nucleotides of exon 16, maintaining the open reading frame with the terminal 16 codons of lacZ when the wild-type intron 16 splice donor is used. Constructs containing the wild-type, e936 point mutation or various other test sequences were generated. Injection/transformation procedures were used to generate N2 worms containing these constructs as extrachromosomal arrays (![]()
Messages produced by the extrachromosomal arrays were tested for the presence of different splice sites in both a sup-39(+) and sup-39(je5) background. The following crosses were done to generate sup-39(je5) animals containing the extrachromosomal arrays. unc-73(e936) hermaphrodites were mated with N2 males. Male progeny from this cross were mated with N2 hermaphrodites containing the extrachromosomal array. GFP-positive uncoordinated F2 animals were selected. These e936; GFP hermaphrodites were mated with e936; je5 males. GFP-positive F2 progeny with wild-type movement were selected and those that did not segregate any uncoordinated progeny were judged to be e936 I; je5 II; Ex.
Detection of splice site usage in reporter constructs:
Total RNA was isolated from the mixed-stage progeny of 20 GFP-expressing animals and reverse transcribed as described above. A reverse transcription primer specific for the extrachromosomal array (5' GTTGAAGAGTAATTGGACTTA 3') or for the native unc-73 gene was used. PCRs with Pfu polymerase were performed for both the native unc-73 gene and the extrachromosomal array using a 3' primer for exon 16 (5' CAGAACGTCAAAGTGTCTTGAG 3'). The 32P-labeled 5' primers were specific for the lacZ gene (5' CTGGAGCCCGTCAGTATCGGC 3') or the native unc-73 gene in a region of exon 15 not included in the reporter construct (5' CTATCGTCTGTTGATTGAGCA 3'). Both 5' primers hybridized to the specific transcripts the same distance from the splice site at the end of exon 15.
| RESULTS |
|---|
The unc-73(e936) mutation results in the activation of cryptic 5' splice sites:
To test the effect of the e936 splice donor mutation on splicing, RT and PCRs were performed on the unc-73 message. RT-PCRs spanning exons 15 and 16 were performed on total RNA isolated from mixed stage unc-73(+); sup-39(+), unc-73(e936); sup-39(+), and unc-73(e936); sup-39(je5) worms. All three strains gave PCR products of similar size to the 1100-bp wild-type product (Fig 1C, lanes 13); no products indicative of skipping of exon 15 or inclusion of intron 16 were observed. This result suggests that cryptic splice sites are activated in unc-73(e936) worms.
To identify the cryptic splice sites used in the e936 mutant, the PCR products shown in Fig 1C were cloned, and multiple isolates from each strain were sequenced. For the wild-type unc-73 gene in the unc-73(+); sup-39(+) strain, the predicted exon 15 splice donor site was used. For the strains carrying the unc-73(e936) mutation alone or in the presence of sup-39(je5), three different 5' splice sites were identified (Fig 1D). Two of these are cryptic splice sites that define introns beginning with the canonical GU. The first is located 1 nucleotide 5' of the wild-type 5' splice site and is referred to as the "-1" 5' splice site. The second is located 23 nucleotides downstream of the wild-type 5' splice site and is referred to as the "+23" 5' splice site. Splicing to either of these sites changes the reading frame to the same nonsense reading frame, which prematurely terminates translation of the protein 12 amino acids into exon 16. The third splice site utilized in both e936 mutant strains was at the correct wild-type exon/intron boundary, demonstrating that an intron beginning with UU is spliced in vivo. This exceptional splice donor, which does not follow the convention of introns beginning with G, is referred to as "wt" because use of this site leads to production of wild-type unc-73 mRNA and protein.
sup-39 mutation alters the relative levels of messages spliced at the different cryptic splice sites:
Having identified the cryptic splice sites used and noting that they were the same for unc-73(e936) in the presence or absence of the sup-39 mutation, we next asked whether the relative levels of messages arising from use of these different cryptic splice sites changed in the presence of the suppressor. Multiple RNA preparations from worms grown on plates or in liquid culture were tested for each strain. cDNAs were generated from total RNA from mixed-stage worms using a primer complementary to unc-73 exon 17. PCRs were then performed on these cDNAs using primer pairs in unc-73 exons 15 and 16. The exon 15 primer was 5' 32P-labeled at a low specific activity. Fig 2A summarizes this approach. PCR products were separated on a 6% polyacrylamide urea sequencing gel.
|
RT-PCR products representing the three cryptic splice sites could be visualized on the sequencing gel (Fig 2B). For the unc-73(+); sup-39(+) strain, only a single band corresponding to the use of the wild-type exon 15 5' splice site was observed (lanes 1 and 2). For the unc-73(+); sup-39(je5) strain, only the wild-type intron 16 5' splice site was detected, indicating that the sup-39 mutation did not affect the splicing of wild-type unc-73 (lane 9). For the unc-73(e936); sup-39(+) (lanes 35) and unc-73(e936); sup-39(je5) (lanes 68) strains, messages resulting from splicing at the three cryptic splice sites identified by sequencing were detected. To quantitate the relative levels of the three different spliced messages, ImageQuant software was used to analyze the PhosphorImager image shown in Fig 2B. The amount of radioactivity in messages using the +23 5' splice site was compared to the amount of radioactivity in the -1 and wt 5' splice sites together (Fig 2C). The -1 and wt 5' splice site bands were difficult to separate using quantitation rectangles so they were counted together. For other gels where separation was sufficient to allow the determination of the individual radioactivity in these two bands located one nucleotide apart, the amount of radioactivity in the -1 and wt splice site products in both the unc-73(e936); sup-39(+) and unc-73(e936); sup-39(je5) animals was roughly equal (data not shown). Because the usage of the wt and -1 splice sites is equal, the wt 5' splice site represents 10% of the steady-state message in unc-73(e936); sup-39(+) animals and 33% of steady-state message in the unc-73(e936); sup-39(je5) animals.
sup-39 mutations cause 50% embryonic lethality and mixed-stage cultures contain many dead embryos (![]()
Determination of the overall level of unc-73 mRNA between wild-type and e936 strains:
The experiments shown in Fig 2 measure the relative amount of steady-state messages spliced at each of the three splice sites used in the presence of the e936 mutation, not actual splice site usage. Splicing at the two cryptic splice sites that change the reading frame and result in the premature termination of translation in exon 16 produces mRNAs that may be substrates for the nonsense-mediated decay pathway of C. elegans (![]()
|
The different forms of the unc-73(e936) message are not substrates for smg regulation:
In C. elegans, the seven smg genes (suppressors with morphogenetic effects on genitalia) are required in the pathway for nonsense-mediated decay (![]()
![]()
sup-39 mutations increase the amount of UNC-73 protein in e936 mutant strains:
Use of the wt site in the unc-73(e936); sup-39(+) worms allows a small amount of full-length mRNA to be made that encodes wild-type protein. This is consistent with the demonstration by ![]()
![]()
sup-39 affects the relative level of messages produced by cryptic splicing of an in vivo splicing reporter:
Because differences in message stability between the e936 spliced isoforms do not appear to account for differences in their relative levels caused by sup-39(je5), perhaps the sup-39 mutation affects the levels of these different spliced isoforms through changes in the splicing of the e936 message. If this is the case, a splicing effect should be seen when this intron is found in the context of another gene. To test this hypothesis, a splicing reporter construct was engineered (Fig 4A). This reporter contained 117 nucleotides of unc-73 exon 15, all of intron 16, and the first 141 nucleotides of exon 16 inserted into the terminal exon of a GFP/lacZ fusion construct under control of the unc-54 promoter. Six constructs, summarized in Fig 4A, were transformed into worms and maintained as extrachromosomal arrays. Worms expressing GFP were selected and RT-PCR was performed on them with primer combinations specific for the native unc-73 gene exon 15/16 splice junction (Fig 4B, lanes 15) or for the extrachromosomal array splice junction (Fig 4B, lanes 612). As can be seen for azEx1, the e936 point mutation in the context of the extrachromosomal array in a sup-39(+) background (lanes 7 and 8) yielded similar ratios of messages containing the cryptic splice sites as the e936 mutation in its native context (lane 2). In a sup-39(je5) background, changes in the ratio of stable messages arising from the different e936 cryptic splice sites in the native gene context (lane 3) are observed in the context of the reporter construct as well (lanes 9 and 10).
|
Analysis of cis-flanking sequences necessary for use of UU splice donor:
Because the use of an intron beginning with UU is highly unusual, we wanted to identify sequences flanking this splice donor involved in promoting usage of this site. Our in vivo splicing reporter fusion construct with the e936 mutation was modifed so that the GU defining the intron beginning at the -1 site was mutated to AU. This construct was transformed into worms, and the extrachromosomal array resulting from this transformation is azEx3. RT-PCR analysis of the stable RNAs arising from azEx3 shows that this mutation appears to eliminate splicing at both the -1 and wt sites (Fig 4C, lane 4). Therefore the G at the -1 position is essential for the use of both the -1 and wt splice sites in e936. As a control, we tested the effect of the -1 G
A mutation on the wild-type intron sequence by testing the splicing of azEx5. This mutation resulted in a slight weakening of use of the wild-type site indicated by a slight activation of splicing to the +23 site in this construct (lanes 5 and 6), while the majority of splicing still occurred at the wt site. This result suggests that, while the G at the -1 position acts to increase the efficiency of splicing to the wt site in the wild-type intron, it is required for splicing to both the -1 and wt splice donors in the e936 intron.
We next sought to determine what would happen if we strengthened the -1 and wt splice sites by improving their match to the 5' splice site consensus sequence. U is found at the +6 position of 62% of C. elegans introns while G, present at this position in unc-73 exon 15, is found at this position in only 7% of C. elegans introns (![]()
![]()
| DISCUSSION |
|---|
The e936 point mutation of unc-73 activates three different cryptic splice donors. Two of these cryptic splice sites define introns beginning with the canonical GU dinucleotide, and the third is the wild-type splice site that is used even though it defines an intron beginning with a highly unusual UU dinucleotide. The same three cryptic splice sites in the unc-73(e936) message are also used in the presence of sup-39(je5), although the ratio of steady-state unc-73 messages using these three different splice sites changes. The fraction of steady-state unc-73 mRNA produced by splicing at the correct wild-type splice donor site increases from 10 to 33%. This change cannot be accounted for by any decrease in the total level of unc-73 messages caused by je5, indicating that the total amount of mRNA encoding full-length UNC-73 protein increases in the presence of je5. The increase in the level of wild-type message leads to an increase in the UNC-73 protein level in these animals. sup-39 mutations appear to function in allele-specific suppression of the unc-73(e936) uncoordination phenotype by increasing the steady-state level of wild-type UNC-73 mRNA, allowing for a sufficient level of wild-type UNC-73 protein to be produced so that proper axon guidance and cell migrations can occur.
Our splicing assays using RT-PCR on total RNA tested only the relative amount of steady-state mRNA present for each of the cryptic splice forms of unc-73, not splice site usage directly. Because differential stability of the e936 mRNA isoforms was a possibility, it was important to determine whether any of these different splice products, especially the two with premature termination codons (-1 and +23), would be substrates for the nonsense-mediated decay pathway. smg genes regulate the steady-state ratios of mRNAs arising from alternative splicing of two genes encoding SR proteins (![]()
![]()
![]()
Experiments with in vivo splicing reporter constructs demonstrate that sup-39 mutant function is specific for the exon 15/16 region of e936 (Fig 4B, lanes 710). sup-39 mutations alter the relative levels of steady-state messages transcribed from the chimeric reporter construct in the same way that they do for messages transcribed from the e936 mutation in the native unc-73 gene. Because the gene context surrounding this splicing region is completely different in the reporter construct and the unc-73 gene yet the usage of the different cryptic splice sites is altered identically by sup-39 mutations, we propose that mutant SUP-39 plays a role in the regulation of splice site choice. A cis mutation that increases the match of the wt and -1 cryptic splice donors of e936 intron 16 to the 5' splice site consensus sequence increases the usage of these sites relative to the +23 site (Fig 4C, lane 7). This cis mutation, chosen for its ability to strengthen the wt and -1 5' splice sites, mimics the effect of mutant SUP-39 in trans. This result also suggests that mutant SUP-39 plays a role in splice site selection.
Allele-specific extragenic suppression can generally occur by two main mechanisms. In the first, compensatory mutations in a protein that interacts with a mutant protein can act to reestablish or strengthen protein:protein interactions disrupted by the original mutation (![]()
![]()
![]()
![]()
The observation that a point mutation of the canonical G at the 5' end of an intron leads to some level of proper splicing is unprecedented in C. elegans. Unusual splice donors, including introns beginning with UU, have been observed before in C. elegans but not as a result of point mutation. Insertion of the Tc1 and Tc4:rh1030 transposable elements into genes in C. elegans can affect splice site choice and lead to use of noncanonical splice donors (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
We searched the C. elegans genome for the presence of splice donor sites that match the e936 intron 16 -1 splice donor sequence A/guuagg. Out of 28,637 C. elegans introns confirmed by cDNA sequence, only one 5' splice site matching this sequence was identified (W. J. KENT and A. M. ZAHLER, unpublished data). The fact that this is such a weak splice site (leading to 90% splicing at cryptic sites in e936) and the fact that it is so rare in C. elegans suggest that this cryptic phenomenon is not a normal mechanism for regulation of splicing. We have shown that mutation of the +5 position of the e936 intron from G to U dramatically reduced usage of the UU splice donor by making the -1 splice site more closely resemble a consensus splice donor with a U at the +6 position (Fig 4C, lanes 8 and 9). Some combination of unusual or weak consensus sequences at this splice donor appears to be responsible for the equal use of the UU and GU splice donors separated by one nucleotide.
While sup-39 mutations do lead to an increase in the level of messages produced by splicing at an unusual UU splice donor, they do not specifically promote this event. Usage of the -1 and wt cryptic splice sites of e936 is roughly equal in the presence or absence of sup-39 mutations. The sup-39 mutant gene product may function to alter the recognition of the +23 cryptic splice donor relative to the -1 and wt sites, either by promoting assembly of the spliceosome at the wt and -1 splice sites or by inhibiting spliceosome assembly at the +23 splice site. At a subsequent step, the splicing machinery then must distinguish between the -1 and wt splice sites (see Fig 5 for a diagram of this model). The -1 and wt sites contain overlapping regions for interaction with the splicing machinery, specifically for base-pairing with U1 snRNA and U6 snRNA (![]()
![]()
![]()
|
sup-39 mutations could affect RNA processing at a number of different levels. sup-39 mutations may lead to an increase in the activity of a specific splicing factor, either through increases in production or changes in post-translational modification, which can then change the preference of the splicing machinery for particular splice sites. For example, when the splicing factors SF2/ASF and hnRNP A1 are overexpressed in vertebrate tissue culture cells, changes in alternative splice site usage for a number of genes are observed (![]()
![]()
![]()
| ACKNOWLEDGMENTS |
|---|
We are indebted to Yishi Jin for initially suggesting this project. We thank Yishi Jin and Andrew Chisholm for many helpful discussions, encouragement, technical training, and the use of their laboratory facilities without which this work would not have been possible. Thanks to Mark Roth, Jane Silverthorne, Massimo Caputi, John Tamkun, Ian Chin-Sang, and Mei Zhen for suggestions for working with RNA and protein extracts and for many helpful discussions. Thanks to Jim Kent and Leslie Grate for computer analysis of C. elegans splice sites and to Leslie Holeman for technical assistance. Many thanks to Terry Kubiseski, Rob Steven, T. Pawson, and J. Culotti for the generous gift of anti-UNC-73 antibody. Thanks to Rebecca Burdine and Michael Stern for developing the total RNA isolation protocol and to Michael Koelle for the gift of ribosomal protein L5 cDNA plasmid. Thank you to Yishi Jin and Jim Kent for comments on this manuscript. This work was supported by the following grants to A.M.Z.: grant 1R01GM52848 from the National Institutes of Health (NIH), a Junior Faculty Research Award from the American Cancer Society, and a grant from the University of California Cancer Research Coordinating Committee. The Caenorhabditis Genetic Center, which is funded by the NIH National Center for Research Resources, provided the strains used in this study. PhosphorImager analysis was supported by grant BIR-9318111 from the National Science Foundation.
Manuscript received September 9, 1999; Accepted for publication November 9, 1999.
| LITERATURE CITED |
|---|
ANDERSON, P., and J. KIMBLE, 1997 mRNA and translation, pp. 185208 in C. elegans II, edited by D. L. RIDDLE, T. BLUMENTHAL, B. J. MEYER and J. R. PRIESS. Cold Spring Harbor Laboratory Press, Plainview, NY.
ARES, M., JR. and B. WEISER, 1994 Rearrangement of snRNA structure during assembly and function of the spliceosome. Prog. Nucleic Acids Res. Mol. Biol. 50:131-159.
AROIAN, R. V., A. D. LEVY, M. KOGA, Y. OHSHIMA, and J. M. KRAMER et al., 1993 Splicing in Caenorhabditis elegans does not require an AG at the 3' splice acceptor site. Mol. Cell. Biol. 13:626-637
BLUMENTHAL, T., and K. STEWARD, 1997 RNA processing and gene structure, pp. 117145 in C. elegans II, edited by D. L. RIDDLE, T. BLUMENTHAL, B. J. MEYER and J. R. PRIESS. Cold Spring Harbor Laboratory Press, Plainview, NY.
CACERES, J. F., S. STAMM, D. M. HELFMAN, and A. R. KRAINER, 1994 Regulation of alternative splicing in vivo by overexpression of antagonistic splicing factors. Science 265:1706-1709
HODGKIN, J., A. PAPP, R. PULAK, V. AMBROS, and P. ANDERSON, 1989 A new kind of informational suppression in the nematode Caenorhabditis elegans. Genetics 123:301-313
KANDELS-LEWIS, S. and B. SERAPHIN, 1993 Involvement of U6 snRNA in 5' splice site selection. Science 262:2035-2039
KRAWCZAK, M., J. REISS, and D. N. COOPER, 1992 The mutational spectrum of single base-pair substitutions in mRNA splice junctions of human genes: causes and consequences. Hum. Genet. 90:41-54[Medline].
LESSER, C. F. and C. GUTHRIE, 1993 Mutations in U6 snRNA that alter splice site specificity: implications for the active site. Science 262:1982-1988
LEWIS, J. A. and J. T. FLEMING, 1995 Basic culture methods. Methods Cell Biol. 48:3-29[Medline].
LI, W. and J. E. SHAW, 1993 A variant Tc4 transposable element in the nematode C. elegans could encode a novel protein. Nucleic Acids Res. 21:59-67
LIN, C. L., L. A. BRISTOL, L. JIN, M. DYKES-HOBERG, and T. CRAWFORD et al., 1998 Aberrant RNA processing in a neurodegenerative disease: the cause for absent EAAT2, a glutamate transporter, in amyotrophic lateral sclerosis. Neuron 20:589-602[Medline].
MELLO, C. and A. FIRE, 1995 DNA transformation. Methods Cell Biol. 48:451-482[Medline].
MORRISON, M., K. S. HARRIS, and M. B. ROTH, 1997 smg mutants affect the expression of alternatively spliced SR protein mRNAs in Caenorhabditis elegans.. Proc. Natl. Acad. Sci. USA 94:9782-9785
NEWMAN, A. and C. NORMAN, 1991 Mutations in yeast U5 snRNA alter the specificity of 5' splice-site cleavage. Cell 65:115-123[Medline].
PENG, X. and S. M. MOUNT, 1995 Genetic enhancement of RNA-processing defects by a dominant mutation in B52, the Drosophila gene for an SR protein splicing factor. Mol. Cell. Biol. 15:6273-6282[Abstract].
PLASTERK, R. H. A., and H. G. A. M. VAN LUENEN, 1997 Transposons, pp. 97116 in C. elegans II, edited by D. L. RIDDLE, T. BLUMENTHAL, B. J. MEYER and J. R. PRIESS. Cold Spring Harbor Laboratory Press, Plainview, NY.
PRELICH, G., 1999 Suppression mechanisms: themes from variations. Trends Genet. 15:261-266[Medline].
PULAK, R. and P. ANDERSON, 1993 mRNA surveillance by the Caenorhabditis elegans smg genes. Genes Dev. 7:1885-1897
RAVE-HAREL, N., E. KEREM, M. NISSIM-RAFINIA, I. MADJAR, and R. GOSHEN et al., 1997 The molecular basis of partial penetrance of splicing mutations in cystic fibrosis. Am. J. Hum. Genet. 60:87-94[Medline].
RUN, J. Q., R. STEVEN, M. S. HUNG, R. VAN WEEGHEL, and J. G. CULOTTI et al., 1996 Suppressors of the unc-73 gene of Caenorhabditis elegans.. Genetics 143:225-236[Abstract].
RUSHFORTH, A. M. and P. ANDERSON, 1996 Splicing removes the Caenorhabditis elegans transposon Tc1 from most mutant pre-mRNAs. Mol. Cell. Biol. 16:422-429[Abstract].
STEVEN, R., T. J. KUBISESKI, H. ZHENG, S. KULKARNI, and J. MANCILLAS et al., 1998 UNC-73 activates the Rac GTPase and is required for cell and growth cone migrations in C. elegans.. Cell 92:785-795[Medline].
ZHANG, H. and T. BLUMENTHAL, 1996 Functional analysis of an intron 3' splice site in Caenorhabditis elegans.. RNA 2:380-388[Abstract].
This article has been cited by other articles:
![]() |
X. ROCA, R. SACHIDANANDAM, and A. R. KRAINER Determinants of the inherent strength of human 5' splice sites RNA, May 1, 2005; 11(5): 683 - 698. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Zahler, J. D. Tuttle, and A. D. Chisholm Genetic Suppression of Intronic +1G Mutations by Compensatory U1 snRNA Changes in Caenorhabditis elegans Genetics, August 1, 2004; 167(4): 1689 - 1696. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Roca, R. Sachidanandam, and A. R. Krainer Intrinsic differences between authentic and cryptic 5' splice sites Nucleic Acids Res., November 1, 2003; 31(21): 6321 - 6333. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Farrer, A. B. Roller, W. J. Kent, and A. M. Zahler Analysis of the role of Caenorhabditis elegans GC-AG introns in regulated splicing Nucleic Acids Res., August 1, 2002; 30(15): 3360 - 3367. [Abstract] [Full Text] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Roller, A. B.
- Articles by Zahler, A. M.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Roller, A. B.
- Articles by Zahler, A. M.







