Genetics, Vol. 154, 1013-1023, March 2000, Copyright © 2000

Proteasome Mutants, pre4-2 and ump1-2, Suppress the Essential Function but Not the Mitochondrial RNase P Function of the Saccharomyces cerevisiae Gene RPM2

Mallory S. Lutza, Steven R. Ellisa, and Nancy C. Martina
a Department of Biochemistry and Molecular Biology, University of Louisville, Louisville, Kentucky 40292

Corresponding author: Nancy C. Martin, Department of Biochemistry and Molecular Biology, University of Louisville, 319 Abraham Flexner Way, Bldg. A, Rm. 708, Louisville, KY 40292., ncmart01{at}gwise.louisville.edu (E-mail)

Communicating editor: M. JOHNSTON


*  ABSTRACT
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

The Saccharomyces cerevisiae nuclear gene RPM2 encodes a component of the mitochondrial tRNA-processing enzyme RNase P. Cells grown on fermentable carbon sources do not require mitochondrial tRNA processing activity, but still require RPM2, indicating an additional function for the Rpm2 protein. RPM2-null cells arrest after 25 generations on fermentable media. Spontaneous mutations that suppress arrest occur with a frequency of ~9 x 10-6. The resultant mutants do not grow on nonfermentable carbon sources. We identified two loci responsible for this suppression, which encode proteins that influence proteasome function or assembly. PRE4 is an essential gene encoding the ß-7 subunit of the 20S proteasome core. A Val-to-Phe substitution within a highly conserved region of Pre4p that disrupts proteasome function suppresses the growth arrest of RPM2-null cells on fermentable media. The other locus, UMP1, encodes a chaperone involved in 20S proteasome assembly. A nonsense mutation in UMP1 also disrupts proteasome function and suppresses {Delta}rpm2 growth arrest. In an RPM2 wild-type background, pre4-2 and ump1-2 strains fail to grow at restrictive temperatures on nonfermentable carbon sources. These data link proteasome activity with Rpm2p and mitochondrial function.


MITOCHONDRIA are vital organelles in eukaryotic cells. In addition to their role in respiration and oxidative phosphorylation, mitochondria are the site for such diverse cellular functions as heme biosynthesis, metabolite transport, amino acid biosynthesis, and lipid catabolism (ATTARDI and SCHATZ 1988 Down; PON and SCHATZ 1991 Down). Mitochondrial biogenesis and function require input from both nuclear and mitochondrial genomes. In the yeast Saccharomyces cerevisiae, mitochondrial DNA codes for proteins required for oxidative phosphorylation, electron transport, mitochondrial protein synthesis, and mRNA processing. Ribosomal RNA, tRNA genes, and an RNase P RNA gene necessary for mitochondrial protein synthesis are also coded by the organelle genome. The maintenance of a wild-type mitochondrial genome is dependent on mitochondrial protein synthesis (MYERS et al. 1985 Down).

In facultative aerobes like S. cerevisiae, mutations in mitochondrial DNA are tolerated if cells are grown on fermentable carbon sources. Consequently, nuclear genes encoding respiratory components and factors required for mitochondrial gene expression affect respiratory growth but not growth on fermentable carbon sources. In contrast, nuclear mutations that interfere with organelle formation and/or maintenance disrupt growth on all carbon sources (DE PINTO et al. 1999 Down).

Yeast mitochondrial RNase P is a ribonucleoprotein complex required for removing 5' leader sequences from mitochondrial tRNA precursors (MORALES et al. 1992 Down; DANG and MARTIN 1993 Down). The RNA component of mitochondrial RNase P (Rpm1r) is encoded by the mitochondrial genome (SHU et al. 1991 Down). The protein component of mitochondrial RNase P (Rpm2p) is encoded in the nucleus. Biochemical and genetic analyses established Rpm2p as a subunit of mitochondrial RNase P (MORALES et al. 1992 Down; DANG and MARTIN 1993 Down). Rpm2p is the major protein found in highly purified preparations of mitochondrial RNase P (MORALES et al. 1992 Down). Moreover, antibodies raised against Rpm2p immunoprecipitated both RNase P activity and Rpm1r from mitochondrial extracts (DANG and MARTIN 1993 Down). Finally, strains with an insertional disruption midway through the RPM2 reading frame accumulated mitochondrial tRNA precursors with 5' extensions, Rpm1r precursors, and were unable to grow on respiratory carbon sources (MORALES et al. 1992 Down; STRIBINSKIS et al. 1996 Down). These data demonstrate that RPM1 and RPM2 encode subunits of RNase P and that the activity of this ribonucleoprotein complex is required for respiratory but not fermentative growth.

Unexpectedly, cells with a null allele of RPM2 could not grow on either respiratory or fermentable carbon sources, indicating that RPM2 had a function in addition to its role as a subunit of mitochondrial RNase P (KASSENBROCK et al. 1995 Down). This function can be provided by the N-terminal half of Rpm2p, explaining why strains with the insertional disruption grew on fermentable carbon sources. The nature of this second function is unclear, but it could be related to the isolation of RPM2 as one of two high-copy suppressors of a temperature-sensitive (ts) allele of TOM40/ISP42 (KASSENBROCK et al. 1995 Down). TOM40 encodes an essential membrane component of the mitochondrial import machinery (VESTWEBER et al. 1989 Down; MOCZKO et al. 1992 Down; RAPAPORT et al. 1997 Down; HILL et al. 1998 Down). The N-terminal portion of RPM2 that is sufficient for growth on fermentable carbon sources also suppresses the TOM40 mitochondrial import defect (KASSENBROCK et al. 1995 Down). Rpm2p and Tom40p do not appear to interact when assayed with the two-hybrid system, suggesting that RPM2 may suppress the mutant allele without physically interacting with Tom40p (GROOM 1995 Down). Thus, the requirement for RPM2 for growth remains unclear.

RPM2-null mutants display a significant rate of phenotypic reversion on glucose-containing media. This rate is indicative of spontaneous second-site loss-of-function suppressor mutations in genes functionally linked to the essential growth function of RPM2. We labeled these second-site suppressors, suppressors of arrest (soa) mutants.

Here, we describe five independent soa suppressor strains that fall into three different complementation groups, all of which suppress lack of growth of {Delta}rpm2 strains on glucose media. We demonstrate that two of these mutant alleles affect 26S proteasome function. PRE4 was identified as the wild-type allele of soa1 and encodes the ß-7 subunit of the 20S proteasome core (GROLL et al. 1997 Down). UMP1 is the wild-type allele of soa2 and encodes a chaperone necessary during the assembly of the 20S proteasome core complex (RAMOS et al. 1998 Down). Thus, defects in proteasome activity compensate for the lack of RPM2.


*  MATERIALS AND METHODS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Strains, plasmids, and media:
Standard yeast manipulations were used (SHERMAN 1991 Down; SHERMAN and HICKS 1991 Down; KAISER et al. 1994 Down). Yeasts were transformed with plasmid DNA using a lithium acetate method (CHEN et al. 1992 Down). The yeast strains used in this study are listed in Table 1. We used the centromeric pRS300 series of plasmids for subcloning (SIKORSKI and HIETER 1989 Down).


 
View this table:
In this window
In a new window

 
Table 1. Yeast strains used in this study

Rich glucose media, YPD, included 1% Bacto-yeast extract, 2% Bacto-peptone, and 2% glucose. Rich glycerol-ethanol media, YPGE, contained 1% Bacto-yeast extract, 2% Bacto-peptone, 3% (v/v) glycerol, and 2% (v/v) ethanol. Synthetic complete (SC), synthetic complete lacking specific amino acids (SC trp-), and synthetic dextrose minimal media (SD) contain 0.67% Bacto-yeast nitrogen base without amino acids, 2% glucose, and appropriate supplements (KAISER et al. 1994 Down). Solid media for plates included 2% Bacto-agar. Culture media reagents were Fisher Scientific (Pittsburgh) or Difco (Detroit) brand. G418, canavanine, and CdCl2 aqueous solutions were sterilized by passage through a 0.2-µm filter (Micron Separations Inc.) and added to autoclaved plate media at the concentrations reported in RESULTS.

Construction of null allele of RPM2:
YMW1 and YMW2 are haploid derivatives of W303 cells and were a generous gift from Dr. Michael Walberg (ZIELER et al. 1995 Down). Deletion of RPM2 was performed in a YMW1/YMW2 diploid, YML9. The complete RPM2 open reading frame (ORF) was replaced with the heterologous dominant G418 resistance gene kanMX using a SFH-PCR-based gene disruption technique (WACH et al. 1994 Down; WACH 1996 Down). RPM2/kanMX primers were 5' CAACAAACAGAAAAGAAAAAACAAGCATACACAAACGAAAATGCGTACGCTGCAGGTCGAC 3' and 5' GTTATAACAGTGAAATAAATAAAATATCAAATTGTAAAGGTCAATCGATGAATTCGAGCTCG 3'. Underlined sequences in oligonucleotides mark those parts of the sequence that are complementary to pFA6-MCS in plasmid pFA6-kanMX6 (WACH 1996 Down). Southern blot analysis and PCR confirmed the proper insertion of kanMX at an RPM2 locus, specifically starting one nucleotide (nt) 3' of the first ATG of the RPM2 ORF through to the penultimate nt 5' to the STOP codon.

Suppressors of the RPM2-null mutation:
Three different diploid RPM2/{Delta}rpm2::kanMX strains, YML34, YML37, and YML41, were sporulated and haploid spores were separated by tetrad analysis on YPD plates. The sporulation pattern observed in all cases was a 2:2 ratio of big/small colonies on YPD at 30° after 3 days. The small colonies do not increase in size after an additional week at 30°. A total of 14 small {Delta}rpm2 colonies were individually suspended in 200, 300, or 400 µl of YPD. A small aliquot of cells was counted using a hemocytometer. The remaining cells were plated to YPD at 30°. Suppression of {Delta}rpm2-arrested growth results in phenotypic revertant colonies, most likely occurring through spontaneous second-site suppressors we called suppression of arrest alleles (soa alleles). A maximum of four different colony sizes was seen within revertant populations. Individual colonies were picked and replated to score for homogeneous growth. Only those {Delta}rpm2 soa colonies that grew homogeneously were studied further. To determine if the soa mutations were recessive or dominant to {Delta}rpm2, {Delta}rpm2 soa cells were first mated to {rho}+ {Delta}rpm2 SOA strains containing a wild-type copy of RPM2 on a YEp352 covering plasmid. A 5-FOA shuffle was performed to lose the YEp352 RPM2 plasmid (SIKORSKI and BOEKE 1991 Down).

Identification of wild-type SOA alleles:
Seventeen independent {Delta}rpm2 soa phenotypic revertants were backcrossed with isogenic wild-type strains, YMW1 or YMW2, to isolate the soa mutations in an otherwise wild-type background and determine if suppression originated from single-site mutations. Diploids were sporulated and haploid progeny were separated by tetrad analysis. The growth of haploid progeny was evaluated on rich and minimal glucose and glycerol media at 16° and 37°. Tight conditional growth phenotypes were observed in five independent backcrosses, permitting us to pursue these soa strains further. Tetrad analysis patterns of parental, nonparental, and tetratype indicated that the mutations originated as single, nuclear loci. The ability of RPM2 SOA/RPM2 soa diploids to grow under restrictive conditions demonstrated that soa1, soa2, soa3, soa4, and soa5 were recessive.

RPM2 soa1 yeast (37B1.14OCD3) were transformed with a pRS200 centromeric genomic library, YPH1, (SIKORSKI and HIETER 1989 Down; American Type Culture Collection (ATCC) no. 77165) and screened for suppression of the cold-sensitive (cs) phenotype at 16° on YPGE. A plasmid containing an 8.8-kb insert suppressed this conditional growth phenotype. Subcloning identified a 2.2-kb fragment containing a single ORF, PRE4, that supported growth of RPM2 soa1 cells at 16° on YPGE. Linkage of the mutant phenotype with the PRE4 locus was confirmed by integrating a PRE4 URA3 linearized plasmid at the PRE4 locus in RPM2 soa1 cells (ROTHSTEIN 1991 Down). These cells were mated to isogenic YMW2, and haploid progeny were scored for uracil auxotrophy and for growth under restrictive conditions.

RPM2 soa2 yeast (34D1.51OCC1) were similarly transformed with a YCp50 centromeric genomic library, CEN BANK A (ROSE et al. 1987 Down; ATCC no. 37415), and screened at 37° on YPGE. Plasmid-based suppression was seen with an 11-kb insert. Subcloning identified UMP1 as the wild-type allele suppressing the soa2 ts phenotype. Linkage of the mutant phenotype with the UMP1 locus was confirmed by integrating a UMP1 URA3 linearized plasmid at the UMP1 locus in RPM2 soa2 cells (ROTHSTEIN 1991 Down). These cells were mated to isogenic YMW1, and haploid progeny were scored for uracil auxotrophy and for growth under restrictive conditions.

Nucleic acid techniques and DNA sequencing:
Standard DNA manipulations and methodologies were used (SAMBROOK et al. 1989 Down). Restriction enzymes and T4 DNA ligase were from New England Biolabs (Beverly, MA) or MBI Fermentas. PCR DNA polymerase enzymes used include TAQ (Fisher), Klentaq-LA polymerase mix (Sigma, St. Louis), and Vent (New England Biolabs). The primers for PCR recovery of sequence at the PRE4 locus were upstream primer 5' CATTCCGTGTAGTGCCAATA 3' and downstream primer 5' GGTTACCCGTCAATCCTTTT 3'. The equivalent PCR primers for the UMP1 locus were upstream primer 5' CGGCACTAATCTAATCTTTCAA 3' and downstream primer 5' TGGCAATTTTATCCTACCTGAG 3'.

DNA sequencing was performed by the University of Wisconsin Biotechnology Center, DNA Synthesis and Sequencing Facility (Dr. Charles Nicolet). PCR products were sequenced directly and after cloning into a PCR-TA cloning vector (Invitrogen). Both strands of each PCR product were completely sequenced to assure accuracy. Plasmid DNA was isolated using either the Bio-Rad (Richmond, CA) or Qiagen miniprep kits. BLAST searches compared and aligned nucleotide sequences (ALTSCHUL et al. 1990 Down), while the SIM alignment portion of the ExPASy home page was used for amino acid comparisons. Amino acid numbering of the mature Pre4p is based on information from the Protein Data Bank (Brookhaven, NY) under accession no. 1RYP (GROLL et al. 1997 Down).

Protein analysis:
Protein was isolated from log-phase cultures. Cells were grown at 30° to an OD640 of 0.5 and then transferred to 16° for 3.5 hr. Cells were collected by centrifugation and stored at -70°. Frozen pellets were resuspended in 200 µl NET-NP (150 mM NaCl, 5 mM EDTA, 50 mM Tris-HCl, pH 7.5, 0.5% NP-40) plus protease inhibitors. Protease inhibitors were diluted 1:10 (Complete mini cocktail tablets; Boehringer Mannheim, Indianapolis). An equal volume of sterile glass beads was added, and cells were disrupted for 3 min in a mini-bead beater (Biospec Products) followed by 15 min at -70° and 3 more min in the bead beater. Samples were then boiled and cleared of particulate matter by centrifugation at 12,000 x g in a microfuge. The concentration of proteins in the supernatant was determined (Bio-Rad protein assays). A total of 1 µg of protein was loaded onto a 10% SDS/polyacrylamide gel, run, and blotted to Immobilon-P (Millipore, Bedford, MA) membranes. Probes included a rabbit polyclonal antiubiquitin antibody (HAAS and BRIGHT 1985 Down) generously provided by Dr. A. Haas, and a mouse monoclonal antiactin antibody (Boehringer Mannheim). Enhanced chemiluminescence (Amersham Life Sciences, Arlington Heights, IL) was used for signal detection.

Microscopy:
Nuclear and mitochondrial DNA were stained with the vital dye DAPI (4',6-diamidino-2-phenylindole) in at least four independent experiments for each strain (KAISER et al. 1994 Down). Approximately 107 cells were pelleted in a microfuge with a 5-sec pulse and resuspended in 70% ethanol on ice. Cells were fixed for 10–30 min on ice and washed twice with H2O. Cells were then resuspended in 1 µg/ml DAPI and mounted using either aqueous Light antifade or Prolong antifade (Molecular Probes, Eugene, OR). Observations were made on a Nikon Optiphot light microscope with a x60 Plan-Apo 1.4 NA objective.


*  RESULTS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Identification and isolation of spontaneous second-site suppressors of {Delta}rpm2:
Sporulation of RPM2/{Delta}rpm2::kanMX diploids and subsequent growth of haploid progeny on rich glucose yielded a 2:2 ratio of small/large colonies. More than 90% of the cells from the small colonies with the {Delta}rpm2 allele lacked buds, indicating that they had ceased growth.

As a first step toward understanding this phenotype, we determined the number of cells in these small colonies. An average of ~4.4 x 107 cells per small colony was obtained by direct counting of cells in 14 independent colonies. This number is consistent with ~25 rounds of cell division from the initial spore. The mean spontaneous phenotypic reversion rate from 14 independent {Delta}rpm2::kanMX colonies, plated on rich glucose at 30°, was between 1.5 x 10-7 and 1.4 x 10-6 revertants/original spore. Phenotypic revertants were designated suppressor of arrest (soa). At 30° on rich glucose media revertant colonies grew at different rates from each other and from isogenic wild-type strains. Seventeen {Delta}rpm2 soa double mutants that demonstrated growth defects on YPD, at either 16° or 37°, were selected for further study.

Of 17 soa mutants, 5 demonstrated tight temperature-sensitive (Ts-) or cold-sensitive (Cs-) phenotypes on rich YPGE media linked to the soa phenotype when separate from the {Delta}rpm2 mutation. Subsequent crosses demonstrated that each of the soa mutations were recessive (MATERIALS AND METHODS). The conditional phenotypes were used in screening yeast genomic libraries for wild-type alleles of the soa loci.

Pairwise crosses of each of these five soa haploids were made, and diploids were plated under restrictive growth conditions. These crosses indicated that there were three soa complementation groups (Table 2). Analysis of {Delta}rpm2 soa/{Delta}rpm2 SOA diploid strains showed that mutations in complementation groups soa1 and soa3 were recessive and unable to suppress the {Delta}rpm2 phenotype in the presence of their wild-type alleles. The soa2 allele, on the other hand, was semidominant and partially able to suppress {Delta}rpm2 in the presence of wild-type SOA2.


 
View this table:
In this window
In a new window

 
Table 2. Growth phenotypes of RPM2 soa complementation groups

The SOA1 locus is PRE4, which encodes a ß subunit of the 20S proteasome:
RPM2 soa1 cells were transformed with a low-copy centromeric genomic library (YPH1) and screened for complementation of their Cs- respiratory growth phenotype (MATERIALS AND METHODS). A single plasmid containing an 8.8-kb insert complemented restrictive growth at 16° on YPGE. Subcloning the six ORFs in this insert revealed that PRE4 was responsible for the complementation. PRE4 encodes the ß-7 subunit of the 20S proteasome core complex and is essential for cell viability (HILT et al. 1993 Down; GROLL et al. 1997 Down). Fig 1A shows PRE4 suppression of Cs- and Ts- respiratory growth phenotypes of RPM2 soa1 cells. To determine if soa1 is an allele of PRE4, a plasmid containing wild-type PRE4 and URA3 was integrated at the PRE4 locus in soa1 cells. These cells were crossed to wild type, sporulated, and tetrads were dissected. The haploid progeny exhibited a 4:0 ratio of wild-type/mutant segregation pattern of YPGE growth at 16°, demonstrating that soa1 is a mutant allele of PRE4. The soa1 allele is the second allele of PRE4 identified and was termed pre4-2 (HILT et al. 1993 Down). The previously identified pre4-1 allele produces a truncated protein with decreased peptidylglutamyl peptidase hydrolyzing (PGPH) activity that does not affect cell growth (HILT et al. 1993 Down).



View larger version (56K):
In this window
In a new window
Download PPT slide
 
Figure 1. Permissive and restrictive growth conditions for RPM2 pre4-2 and RPM2 ump1-2 cells on YPGE media. Genomic library screens led to the identification of PRE4 as the wild-type allele of soa1 by suppression of the RPM2 soa1 cs phenotype while UMP1 was identified as the wild-type allele of soa2 by suppression of the RPM2 soa2 ts phenotype. Logarithmically growing cultures were diluted to OD640 = 0.1 and 4 µl of 10-fold serial dilutions were spotted onto YPGE plates. Plates were incubated at given temperatures as follows: 16°, 5 days; 30°, 2 days; 37°, 3 days. (A) Wild-type cells are the original parent strain YMW2; soa1 represents strain 37B1.14OCD3; pRS314 PRE4 is a CEN plasmid with the PRE4 locus. (B) Wild-type cells are the original parent strain YMW1; soa2 represents strain 34D1.51OCC1; pRS316 is a CEN plasmid with the UMP1 locus.

The SOA2 locus is UMP1, which encodes a 20S proteasome maturation factor:
Two overlapping plasmids complementing the soa2 defect were isolated (MATERIALS AND METHODS). Subcloning the six possible ORFs revealed that UMP1 was the complementing gene. Fig 1B shows UMP1 suppression of the Ts- respiratory growth phenotype of RPM2 soa2 cells. UMP1 also suppresses the Ts- respiratory phenotype of the other member of the soa2 complementation group. UMP1, like PRE4, is necessary for the function of the 20S core proteasomal complex. UMP1 encodes a chaperone involved in 20S proteasome assembly (RAMOS et al. 1998 Down). To determine if soa2 mutations were alleles of UMP1, a plasmid containing wild-type UMP1 was integrated at the UMP1 locus in soa2 cells. These cells were crossed to wild type, sporulated, and tetrads were dissected. The haploid progeny revealed a 4:0 ratio of wild-type/mutant segregation pattern of growth on YPGE growth at 37°, demonstrating that the soa2 locus is UMP1. We named the soa2 allele ump1-2.

Sensitivity of soa mutants to canavanine and CdCl2:
To determine if proteasome function was compromised in pre4-2, ump1-2, and soa3 strains, cultures were incubated under a variety of stressful conditions that increase cellular dependence on proteasomal degradation. Exposure of cells to increasing concentrations of the arginine analogue canavanine causes a general increase of mutant proteins that are normally degraded by the proteasome. Relative to wild-type cells, both pre4-2 and ump1-2 cells showed a hypersensitivity to canavanine, a phenotypic characteristic of cells with defective proteasome activity (Fig 2; CHEN and HOCHSTRASSER 1996 Down; RAMOS et al. 1998 Down). RPM2 pre4-2 cells have decreased colony size relative to wild-type strains at 5 µg/ml canavanine and show no growth between 30 and 35 µg/ml canavanine (Fig 2A). Similar results are seen with the RPM2 ump1-2 mutants that do not grow on media containing 40 µg/ml canavanine. In contrast, the RPM2 soa3 cells grow to near-wild-type levels when spotted on the SD-canavanine plates. The combined effect of a null mutation of RPM2 with any of the soa mutations led to poor growth on SD media alone and no growth in the presence of low concentrations of canavanine (5–10 µg/ml; data not shown). This implies that cells lacking RPM2 have an increased sensitivity to stressful conditions.



View larger version (63K):
In this window
In a new window
Download PPT slide
 
Figure 2. Hypersensitivity of pre4-2 and ump1-2 to the arginine analogue canavanine and to oxidative damage caused by CdCl2. pre4-2, ump1-2, and soa3 cultures actively growing in YPD were spotted in 1:10 serial dilutions to minimal media plates. (A) Canavanine (30 µg/ml); (B) CdCl2 (30 µM). Incubation was at permissive temperatures for 3 days. The higher concentrations of canavanine used in this study are due to the can1-100 mutant allele found in strains derived from a W303 background. The can1-100 allele confers resistance to low levels of canavanine.

A second test of proteasome function is the sensitivity of cells to oxidative damage caused by CdCl2. RPM2 pre4-2 and RPM2 ump1-2 cells grow poorly in the presence of 30 µM CdCl2 (Fig 2B). The double {Delta}rpm2 soa mutants failed to grow under the same conditions (data not shown). Similar to results obtained with canavanine, RPM2 soa3 cells were not sensitive to CdCl2. Both the canavanine and CdCl2 sensitivities were overcome if RPM2 pre4-2 and RPM2 ump1-2 cells were transformed with PRE4 and UMP1, respectively, on low-copy vectors (Fig 2A and Fig B). The soa3 complementation group does not show evidence of defective 26S proteasome activity. Our investigations into the relationship of soa3 as a suppressor of {Delta}rpm2 yeast are ongoing.

Degradation of ubiquitinated proteins is inhibited in pre4-2 yeast:
As a further test of impaired proteasome activity in pre4-2 cells, we examined the level of ubiquitinated proteins at permissive and restrictive growth conditions (HAAS 1988 Down; CHEN and HOCHSTRASSER 1995 Down; RINALDI et al. 1998 Down). Wild-type and mutant cells were grown at 30° in YPGE media. Aliquots from log-phase cultures were either transferred to 16° for 3 hr or maintained at 30°. Total protein was isolated, fractionated by SDS-PAGE, transferred to polyvinyldifluoride membrane, and probed with antiubiquitin antibody. The blot showed an increased signal in RPM2 pre4-2 extracts vs. wild-type cells at 16° (Fig 3; HAAS and BRIGHT 1985 Down). The diffuse signal in the molecular weight range 35–250 kD, which reflects a general increase in ubiquitinated proteins, is typical for cells with impaired proteasome activity.



View larger version (71K):
In this window
In a new window
Download PPT slide
 
Figure 3. Accumulation of ubiquitinated proteins in the pre4-2 strain 37B1.14OCD3. A Western blot of total yeast extracts was probed with a polyclonal antibody against ubiquitin. Yeast cell extract (1 µg) from mid-log-phase cultures was loaded into each well of a 10% polyacrylamide gel. (Lanes 1 and 3) YMW2 wild-type cells; (lanes 2 and 4) 37B1.14OCD3 (pre4-2) cells. Lanes 1 and 2 were grown at 30° until cultures reached an OD640 = 0.5. Lanes 3 and 4 were shifted to the restrictive temperature of 16°. The shift to 16° was for 3 hr from identical 30° OD640 = 0.5 cultures. High-molecular-mass ubiquitin-protein conjugates are indicated on the left. Molecular mass standards in kilodaltons are indicated on the right.

The pre4-2 allele contains a missense mutation:
The pre4-2 mutation is a guanine-to-thymidine base change at nucleotide 157 in the PRE4 ORF, which results in a valine-to-phenylalanine substitution at amino acid (aa) 12 in the mature protein. Sequence comparison of pre4-2p with the three most closely related 20S proteasome ß-7 subunits and with the archtype ß subunit of Thermoplasma acidiphilium showed that this amino acid substitution resides within a highly conserved region. This change introduces a bulky Phe at the start of ß-strand 2 within the ß-sandwich tertiary structure described in GROLL et al. 1997 Down.

Sequence of ump1-2 and ump1-3 reveals both contain nonsense mutations:
Cells lacking UMP1 are viable but grow slowly (RAMOS et al. 1998 Down). Ump1p is postulated to interact with proPre2p and block protease maturation until proteasome assembly is complete. Both ump1-2 and ump1-3 contained nonsense mutations resulting in premature stop codons at codons 10 or 36, respectively.

Morphology of {Delta}rpm2 soa and RPM2 soa mutants:
Cells lacking RPM2 fail to produce mature mitochondrial tRNA, leading to an absence of mitochondrial protein synthesis and petite S. cerevisiae strains. The state of the mitochondrial genome was analyzed using a combination of DAPI staining and genetic crosses. DAPI staining revealed mitochondrial DNA in {Delta}rpm2 pre4-2 cells, while {Delta}rpm2 ump1-2 and {Delta}rpm2 soa3 showed no extranuclear fluorescent staining (Fig 4). Mitochondrial DNA was distributed throughout the elongated, interconnected {Delta}rpm2 pre4-2 cells even though nuclear DNA did not appear to be segregating properly. To determine if {Delta}rpm2 pre4-2 maintained a wild-type mitochondrial genome, the cells were mated to YMW2 {rho}o, an isogenic strain containing a wild-type nuclear genome but lacking mitochondrial DNA. The resultant diploids were unable to grow on YPGE, demonstrating that {Delta}rpm2 pre4-2 cells are {rho}-.



View larger version (56K):
In this window
In a new window
Download PPT slide
 
Figure 4. Morphology of {Delta}rpm2 soa mutants under permissive growth conditions. Cultures were grown in YPD at 30° to an OD640 = 0.5. (A) Wild-type YMW2; (B) {Delta}rpm2 pre4-2; (C) {Delta}rpm2 ump1-2; (D) {Delta}rpm2 soa3. Fluorescence images reveal nuclear and mitochondrial DNA stained with DAPI. In {Delta}rpm2 pre4-2 and {Delta}rpm2 ump1-2 cultures not all interconnected cells appear to contain nuclear DNA (B and C). {Delta}rpm2 pre4-2 cells are {rho}- (B) while {Delta}rpm2 ump1-2 and {Delta}rpm2 soa3 cells are {rho}o (C and D). Bar, 5 µm.

Proteasome degradation of cyclins involved in cell cycle regulation has been well documented (CHUN et al. 1996 Down; KING et al. 1996 Down; HERSHKO 1997 Down). The {Delta}rpm2 pre4-2 and {Delta}rpm2 ump1-2 mutants displayed a range of morphologies indicative of cells defective in cell cycle progression (Fig 4). Approximately 5–10% of {Delta}rpm2 pre4-2 cells grown at 30° on YPD were multiply budded or showed interconnected, elongated morphologies (Fig 4B). After an overnight shift to the restrictive temperature of 16°, the entire culture displayed aberrant morphologies with many dead, serially connected ghosts observed (data not shown). {Delta}rpm2 ump1-2 cultures of interconnected cells continue to divide at 37° but do so quite slowly with decreased viability (data not shown). At 30° an interconnected, elongated morphology was most evident when the {Delta}rpm2 ump1-2 cultures reached stationary phase (Fig 4C). {Delta}rpm2 soa3 cultures appeared as wild-type cells at both permissive and restrictive temperatures (Fig 4D).

Mutant morphologies of cells at permissive and restrictive conditions were not as prominent within the soa1 and soa2 strains with wild-type RPM2. All the single soa mutants were respiratory competent with {rho}+ mitochondrial genomes. We used DAPI staining to observe the nuclear and mitochondrial DNA patterns in these soa mutants. During log-phase growth at 30°, pre4-2 and ump1-2 cultures are noticeably different from wild-type cells in that they contain multiply budded and elongated cells (Fig 5A, Fig C, and Fig E). However, this mutant phenotype is not displayed to the same degree as it was in {Delta}rpm2 pre4-2 and {Delta}rpm2 ump1-2 cultures. As in Fig 4, not all cell bodies contain nuclear DNA, but mitochondrial DNA is found throughout the interconnected cells. Under restrictive conditions (3–16 hr at 16° or 37°, respectively) both RPM2 pre4-2 and RPM2 ump1-2 cultures contained elongated, multiply budded cells similar to their {Delta}rpm2 counterparts. Consistent with the results from the double mutant, RPM2 soa3 retains a wild-type morphology under permissive and restrictive conditions, supporting the conclusion that soa3 is not a proteasome-functional mutant (Fig 5G and Fig H).



View larger version (52K):
In this window
In a new window
Download PPT slide
 
Figure 5. DAPI staining of RPM2 soa mutants under permissive and restrictive growth conditions. Cultures were grown in YPD at 30° to mid-log phase for observation of permissive conditions (A, C, E, and G). Identically grown cultures were shifted to either 16° (B and H) or 37° (D, F, and I) for 3–16 hr before observation by fluorescent microscopy. (A and B) RPM2 pre4-2, (C and D) RPM2 ump1-2, (E and F) RPM2 soa3, (G–I) wild-type YMW2 cells. Bar, 5 µm.


*  DISCUSSION
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

The results presented here demonstrate that growth on fermentable carbon sources can be restored in null mutants of RPM2 by mutations in two different genes that disrupt 20S proteasome function. One encodes the proteasome ß-7 subunit; the other encodes a chaperone necessary for assembly of an active 20S proteasome complex (RAMOS et al. 1998 Down).

Proteasome function is essential in all eukaryotic cells for the regulated degradation of targeted proteins. The ATP- and ubiquitin-dependent proteasome pathway plays a key role in the degradation of misfolded/mutant proteins, as well as in controlling cell growth and division through the degradation of regulatory proteins (CHUN et al. 1996 Down; HILT and WOLF 1996 Down; KING et al. 1996 Down; HERSHKO 1997 Down). The 26S proteasome is the proteolytic component of the ubiquitin-mediated protein degradation pathway. It is a dumbbell-shaped symmetrical structure composed of a barrel-shaped 20S proteolytic core capped by 19S regulatory particles. The yeast 20S proteasome has been crystalized recently and contains 14 distinct but structurally related subunits: 7 of type {alpha} and 7 of type ß organized into four stacked heptomeric rings in the configuration {alpha}ßß{alpha} (GROLL et al. 1997 Down). The 20S core complex is assembled from proprotein precursors including inactive precursors of the proteasome proteases (NANDI et al. 1997 Down). All ß subunits are encoded by essential genes.

Subunits within the 20S core complex can have both structural and catalytic roles in proteasome function. Three different ß subunits each provide distinct N-terminal threonine proteases to the proteasome catalytic core. The PUP1, PRE2, and PRE3 genes encode ß-subunit proteases with trypsin-like, chymotrypsin-like, and PGPH specificities, respectively (ARENDT and HOCHSTRASSER 1997 Down; HEINEMEYER et al. 1997 Down; CIECHANOVER and SCHWARTZ 1998 Down). Pre4p is not catalytically active as a protease but is necessary for PGPH activity (HILT et al. 1993 Down; HEINEMEYER et al. 1997 Down). Mutations in proteasome ß subunits, such as Pre4p, are thought to influence the conformation of catalytic subunits or affect the binding and orientation of substrate peptides. Consistent with a critical role for noncatalytic subunits in proteasome structure is the observation that a null mutant of PRE4 is lethal. The requirement for PRE4 is not, however, solely related to its role in PGPH activity, since the truncated allele pre4-1 lacks PGPH activity but displays no detectable effects on cell growth or on the degradation of a reporter protein in vivo (HILT et al. 1993 Down).

Our work suggests that the Val-to-Phe substitution in ß-7 has global effects on proteasome activity. Cells with a pre4-2 allele exhibit biochemical and morphological stress-related phenotypes characteristic of cells with reduced proteasome activity. Moreover, pre4-2 cells accumulated higher levels of ubiquitin-protein conjugates relative to wild type. We interpret these data to indicate that the pre4-2 mutation affects more than just the PGPH activity of the proteasome. Biochemical, immunological, and crystallographic studies have shown that Pre4p is in close proximity to Pre3p and Pup1p (GROLL et al. 1997 Down; HEINEMEYER et al. 1997 Down; KOPP et al. 1997 Down). Thus, the pre4-2 mutation could potentially disrupt multiple proteolytic activities within the proteasome as well as overall structural integrity. Similar "poisoning" of the Drosophila melanogaster 20S proteasome by mutant ß-2 or ß-6 subunits has been reported (SMYTH and BELOTE 1999 Down). However, unlike the D. melanogaster mutants, pre4-2 is recessive to PRE4 in the presence or absence of RPM2, indicating that the wild-type protein is preferentially incorporated into the 20S proteasome during assembly.

Proper proteasome assembly is critical to proteasome function. Unlike Pre4p, Ump1p is not an integral component of the 20S core complex. However, since Ump1p is involved in the assembly and maturation of the 20S core complex, mutations that affect its expression or function have global effects on proteasome function (RAMOS et al. 1998 Down). Thus, ump1-2, like pre4-2, appears to suppress the lack of growth on fermentative carbon sources in {Delta}rpm2 cells by disrupting proteasome function. Yeast carrying null alleles of UMP1 accumulated 15S precursors to the 20S core complex and proPre2p (RAMOS et al. 1998 Down). They grow at much slower rates and are sensitive to stressful conditions. In agreement with these results, the ump1-2 mutant reported here had sensitivities to canavanine and CdCl2 characteristic of proteasome mutants, presumably because the cells had fewer fully assembled, proteolytically active 20S proteasome complexes. The semidominant nature of the ump1-2 allele in suppressing RPM2-null mutations suggests that a single wild-type UMP1 gene in a {Delta}rpm2/{Delta}rpm2 diploid does not support the assembly of wild-type levels of 20S proteasome complexes.

Rpm2p is a multifunctional protein that is required for mitochondrial RNase P activity and for an essential function, which, like mitochondria, is required during fermentative growth. The amino-terminal 714-aa portion of RPM2, which supports growth on glucose, is sufficient to serve as a high-copy suppressor of a mitochondrial protein import defect resulting from a mutant allele of TOM40 (KASSENBROCK et al. 1995 Down). The pre4-2 and ump1-2 suppression of {Delta}rpm2 suggests a model relating proteasomal activity to an essential feature of mitochondrial biogenesis.

Two other proteasome mutants that suppress mitochondrially related phenotypes have been reported (CAMPBELL et al. 1994 Down; RINALDI et al. 1998). A mutant allele of RPT3 (ynt1-1) was identified as a suppressor of the enhanced rate of escape of mitochondrial DNA to the nucleus in strains with mutant alleles of YME1 (THORSNESS et al. 1993 Down; CAMPBELL et al. 1994 Down). The RPT3 mutant also suppressed abnormal mitochondrial morphologies and growth defects associated with yme1 mutations. Yme1p is an ATP- and zinc-dependent protease component of the i-AAA proteolytic complex, which is localized to the inner mitochondrial membrane (THORSNESS et al. 1993 Down; LEONHARD et al. 1996 Down; WEBER et al. 1996 Down). Unassembled subunits of ATP synthase and respiratory chain components are degraded, in part, through a pathway involving Yme1p (PEARCE and SHERMAN 1995 Down; WEBER et al. 1996 Down). RPT3, on the other hand, encodes one of six ATPase activities found in the base subcomplex of the proteasome 19S regulatory particle (GLICKMAN et al. 1998 Down). Like cells with the pre4-2 allele, the mutant allele of RPT3 leads to cold-sensitive growth on nonfermentable carbon sources (CAMPBELL et al. 1994 Down). It seems unlikely that the RPT3 mutant suppresses YME1 mutations by replacing the mitochondrial protein as a functional component of the i-AAA complex. Instead, RPT3 may function to suppress YME1 mutants by disrupting the pathway used to degrade abnormal mitochondria (CAMPBELL and THORSNESS 1998 Down). Recent studies have indicated that a vacuolar protease, Pep4p, plays an important role in the escape of mitochondrial DNA to the nucleus in YME1 mutants. Mutants in PEP4 suppress DNA transfer from mitochondria to nucleus in YME1 mutants without suppressing growth defects and abnormal mitochondrial morphologies. This suggests that the vacuole may function in the degradation of abnormal mitochondria in YME1 strains (CAMPBELL et al. 1994 Down; CAMPBELL and THORSNESS 1998 Down). In contrast, RPT3 mutants suppress all phenotypes associated with the YME1 mutation, indicating that proteasome mutants help promote mitochondrial integrity.

A proteasome mutant has also been shown to suppress a mutation in the mitochondrial genome (RINALDI et al. 1994 Down, RINALDI et al. 1995 Down). A search for MnCl2-generated suppressors of a mitochondrial tRNAASP point mutant led to the isolation of a yeast proteasomal gene RPN11/MPR1 (ZENNARO et al. 1989 Down; RINALDI et al. 1994 Down, RINALDI et al. 1998 Down; GLICKMAN et al. 1998 Down). RPN11/MPR1 is a non-ATPase subunit of the lid portion of the 19S proteasomal regulatory particle (GLICKMAN et al. 1998 Down). Similar to pre4-2, mpr1-1 cultures grown to stationary phase accumulate ubiquitinated proteins and growth phenotypes were more prominent on glycerol medium. Cells with the mpr1-1 allele contain an increased quantity of total mitochondrial DNA per cell, suggesting that a decrease of proteasome activity can elevate the copy number of mitochondrial DNA (RINALDI et al. 1998 Down).

The proteasome mutants isolated here are unique with respect to the work described above because they specifically affect the 20S proteolytic core vs. the 19S regulatory cap subunits of the 26S proteasome. A suppression mechanism that stabilizes mitochondrial DNA through the loss of proteasome function, as observed in RINALDI et al. 1998 Down, cannot account for suppression in {Delta}rpm2 yeast since the {Delta}rpm2 ump1-2 and {Delta}rpm2 soa3-1 cells are {rho}o. Alternatively, if the ynt1-1 proteasome mutant suppresses yme1 by supporting global mitochondrial integrity, thereby bypassing the vacuolar degradation pathway, a similar mechanism stabilizing mitochondria in the presence of decreased proteasomal degradation could account for phenotypic suppression in {Delta}rpm2 pre4-2 and {Delta}rpm2 ump1-2 strains.

We suggest that the mechanism by which proteasome mutants suppress the RPM2-null allele is indirect, affecting the steady-state level of key protein(s) that compensate for the loss of RPM2. Unlike mammalian cells, lower eukaryotes, including S. cerevisiae, do not degrade long-lived proteins through the ubiquitin-proteasome pathway (reviewed in GOLDBERG et al. 1997 Down). Thus, pre4-2 and ump1-2 strains should accumulate short-lived proteins, including regulatory proteins known to have profound effects on cell growth. Consistent with this interpretation is the observation that the null allele of RPM2 can also be suppressed by multiple copies of YBL066, which encodes a putative transcription factor, and PAB1, which encodes the poly (A)-binding protein (GROOM et al. 1998 Down; H. C. HEYMAN and N. C. MARTIN, personal communication). Both of these genes have the potential to increase the steady-state level of certain proteins, which, in turn, could suppress RPM2 mutants.

Proteasome degradation of outer mitochondrial membrane proteins could act as part of a general system of mitochondrial maintenance similar to that described for the ER membrane proteins, insuring that improperly folded proteins or misassembled complexes are degraded rapidly (KOPITO 1997 Down; PLEMPER and WOLF 1999 Down). Essential functions of mitochondria that depend on outer mitochondrial membrane proteins include import, fusion, and distribution. Decreased proteasome activity would then impact mitochondrial function by increasing the longevity of mitochondrially associated proteins, potentially suppressing lethal phenotypes in strains containing mutations adverse for proper function or maintenance of mitochondria. This model accounts for our results while also encompassing the results obtained with both the YME1 and tRNAASP mutants (ZENNARO et al. 1989 Down; CAMPBELL et al. 1994 Down; CAMPBELL and THORSNESS 1998 Down).

Nuclear gene products comprise the majority of mitochondrial proteins needed for respiratory and nonrespiratory growth. A mitochondrial import system is integral to the transport of these nuclear-encoded proteins into the different mitochondrial compartments. Increased stabilization of mitochondrial outer membrane proteins or increased rates of mitochondrial import could affect the growth characteristics of yeast under both respiratory and fermentative conditions. An RPM2 essential growth function directed at this level could be compensated for by increasing the half-life of specific proteasome targets. This hypothesis is supported by previous results that RPM2 was isolated as a high-copy suppressor of a defective allele of the essential mitochondrial import channel protein Tom40p (KASSENBROCK et al. 1995 Down).

Proteasomes could regulate the levels of proteins targeted to mitochondrial compartments. At least one case of control of mitochondrial protein levels by cystosolic proteasome activity has been established. Regulation to achieve proper levels of two isoforms of cytochrome c, encoded by two different nuclear genes and localized to the intermembrane space, occurs through a ubiquitin-proteasome degradation mechanism (PEARCE and SHERMAN 1997 Down). It is therefore likely that other proteins destined for mitochondria can be regulated by proteasome activity before mitochondrial import.

The direct turnover of mitochondria utilizing a pathway balancing proteasomal and vacuolar degradation activities would provide cells with a mechanism for monitoring and removing unneeded or improperly functioning mitochondria (CAMPBELL and THORSNESS 1998 Down; SUTOVSKY et al. 1998 Down). A hypothesis that mitochondrial turnover involves ubiquitin-tagged proteins is supported by studies of ubiquitin localization. Ubiquitin conjugates and ubiquitin-conjugating enzymes have been localized to mitochondrial membrane fractions and the mitochondrial outer membrane (ZHAUNG and MCCAULEY 1989 Down; MAGNANI et al. 1991 Down). FISK and YAFFE 1999 Down demonstrated that the loss of an E3 ubiquitin ligase affects mitochondrial inheritance. A mechanism for protein ubiquitination on the cytosolic side of mitochondria would be useful in regulated degradation of mitochondrial proteins by the proteasome or for targeted turnover of mitochondria by the vacuole.

Cell fractionation experiments have previously shown that detectable Rpm2p is localized to the mitochondrial fraction (KASSENBROCK et al. 1995 Down). Rpm2p, as a component of mitochondrial RNase P activity, is localized to the matrix. However, the presence of low levels of Rpm2p in other mitochondrial fractions or in the cytosol cannot be ruled out. The limited growth of the small {Delta}rpm2 colonies suggests that a proteasome target affecting mitochondrial function, or mitochondria themselves, is diluted out after 25 generations. The specific role of Rpm2p during cell growth remains unknown but we clearly demonstrated that decreased proteasome function can provide the resources necessary in the absence of RPM2. Our results suggest that Rpm2p has a role in regulating the synthesis or turnover of proteins important for growth. This role can be bypassed in the two novel proteasome mutants characterized here.


*  ACKNOWLEDGMENTS

We thank Ms. Clarissa Moxely and Mr. Michael Mindrum for technical assistance with the complementation assays and library screens. We thank Dr. A. Haas for the generous donation of affinity purified polyclonal antiubiquitin antibody and Dr. M. Walberg for the generous donation of YMW1 and YMW2 yeast strains. This work was supported by National Institutes of Health grant 992332 to N.C.M.

Manuscript received August 25, 1999; Accepted for publication November 2, 1999.


*  LITERATURE CITED
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

ALTSCHUL, S. F., W. GISH, W. MILLER, E. W. MYERS, and D. J. LIPMAN, 1990  Basic local alignment search tool. J. Mol. Biol. 215:403-410[Medline].

ARENDT, C. S. and M. HOCHSTRASSER, 1997  Identification of the yeast 20S proteasome catalytic centers and subunit interactions required for active-site formation. Proc. Natl. Acad. Sci. USA 94:7156-7161[Abstract/Free Full Text].

ATTARDI, G. and G. SCHATZ, 1988  Biogenesis of mitochondria. Annu. Rev. Cell Biol. 4:289-333.

CAMPBELL, C. L. and P. E. THORSNESS, 1998  Escape of mitochondrial DNA to the nucleus in yme1 yeast is mediated by vacuolar-dependent turnover of abnormal mitochondrial compartments. J. Cell Sci. 111:2455-2464[Abstract].

CAMPBELL, C. L., N. TANAKA, K. H. WHITE, and P. E. THORSNESS, 1994  Mitochondrial morphological and functional defects in yeast caused by yme1 are suppressed by mutation of a 26S protease subunit homologue. Mol. Biol. Cell 5:899-905[Abstract].

CHEN, D. C., B. C. YANG, and T. T. KUO, 1992  One-step transformation of yeast in stationary phase. Curr. Genet. 21:83-84[Medline].

CHEN, P. and M. HOCHSTRASSER, 1995  Biogenesis, structure and function of the yeast 20S proteasome. EMBO J. 14:2620-2630[Medline].

CHEN, P. and M. HOCHSTRASSER, 1996  Autocatalytic subunit processing couples active site formation in the 20S proteasome to completion of assembly. Cell 86:961-972[Medline].

CHUN, K. T., N. MATHIAS, and M. G. GOEBL, 1996  Ubiquitin-dependent proteolysis and cell cycle control in yeast. Prog. Cell Cycle Res. 2:115-127[Medline].

CIECHANOVER, A. and A. L. SCHWARTZ, 1998  The ubiquitin-proteasome pathway: the complexity and myriad functions of protein death. Proc. Natl. Acad. Sci. USA 95:2727-2730[Free Full Text].

DANG, Y. L. and N. C. MARTIN, 1993  Yeast mitochondrial RNase P. Sequence of the RPM2 gene and demonstration that its product is a protein subunit of the enzyme. J. Biol. Chem. 268:19791-19796[Abstract/Free Full Text].

DE PINTO, B., S. B. MALLADI, and N. ALTAMURA, 1999  MitBASE pilot: a database on nuclear genes involved in mitochondrial biogenesis and its regulation in Saccharomyces cerevisiae.. Nucleic Acids Res. 27:147-149[Abstract/Free Full Text].

FISK, H. A. and M. P. YAFFE, 1999  A role for ubiquitination in mitochondrial inheritance in Saccharomyces cerevisiae.. J. Cell Biol. 145:1199-1208[Abstract/Free Full Text].

GLICKMAN, M. H., D. M. RUBIN, V. A. FRIED, and D. FINLEY, 1998  The regulatory particle of the Saccharomyces cerevisiae proteasome. Mol. Cell. Biol. 18:3149-3162[Abstract/Free Full Text].

GOLDBERG, A. L., T. N. AKOPIAN, A. F. KISSELEV, D. H. LEE, and M. ROHRWOLD, 1997  New insights into the mechanisms and importance of the proteasome in intracellular protein degradation. Biol. Chem. 378:131-140[Medline].

GROLL, M., L. DITZEL, J. LOWE, D. STOCK, and M. BOCHTLER et al., 1997  Structure of 20S proteasome from yeast at 2.4 A resolution. Nature 386:463-471[Medline].

GROOM, K. R., 1995 Genetic approaches yield new insights into the functional expression and biogenesis of the Rpm1r and Rpm2p subunits of yeast mitochondrial RNase P. Thesis, University of Louisville, Louisville.

GROOM, K. R., H. C. HEYMAN, M. C. STEFFEN, L. HAWKINS, and N. C. MARTIN, 1998  Kluyveromyces lactis SEF1 and its Saccharomyces cerevisiae homologue bypass the unknown essential function, but not the mitochondrial RNase P function, of the S. cerevisiae RPM2 gene. Yeast 14:77-87[Medline].

HAAS, A. L., 1988 Immunochemical probes of ubiquitin pool dynamics, pp. 173–206 in Ubiquitin, edited by M. RECHSTEINER. Plenum Press, Salt Lake City.

HAAS, A. L. and P. M. BRIGHT, 1985  The immunochemical detection and quantitation of intracellular ubiquitin-protein conjugates. J. Biol. Chem. 260:12464-12473[Abstract/Free Full Text].

HEINEMEYER, W., M. FISCHER, T. KRIMMER, U. STACHON, and D. H. WOLF, 1997  The active sites of the eukaryotic 20S proteasome and their involvement in subunit precursor processing. J. Biol. Chem. 272:25200-25209[Abstract/Free Full Text].

HERSHKO, A., 1997  Roles of ubiquitin-mediated proteolysis in cell cycle control. Curr. Opin. Cell Biol. 9:788-799[Medline].

HILL, K., K. MODEL, M. T. RYAN, K. DIETMEIER, and F. MARTIN et al., 1998  Tom40 forms the hydrophilic channel of the mitochondrial import pore for preproteins. Nature 395:516-521[Medline].

HILT, W. and D. H. WOLF, 1996  Proteasomes: destruction as a programme. Trends Biochem. Sci. 21:96-102[Medline].

HILT, W., C. ENENKEL, A. GRUHLER, T. SINGER, and D. H. WOLF, 1993  The PRE4 gene codes for a subunit of the yeast proteasome necessary for peptidylglutamyl-peptide-hydrolyzing activity. Mutations link the proteasome to stress- and ubiquitin-dependent proteolysis. J. Biol. Chem. 268:3479-3486[Abstract/Free Full Text].

KAISER, C., S. MICHAELIS and A. MITCHELL, 1994 Methods in Yeast Genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

KASSENBROCK, C. K., G. J. GAO, K. R. GROOM, P. SULO, and M. G. DOUGLAS et al., 1995  RPM2, independently of its mitochondrial RNase P function, suppresses an ISP42 mutant defective in mitochondrial import and is essential for normal growth. Mol. Cell. Biol. 15:4763-4770[Abstract].

KING, R. W., R. J. DESHAIES, J. M. PETERS, and M. W. KIRSCHNER, 1996  How proteolysis drives the cell cycle. Science 274:1652-1659[Abstract/Free Full Text].

KOPITO, R. R., 1997  ER quality control: the cytoplasmic connection. Cell 88:427-430[Medline].

KOPP, F., K. B. HENDIL, B. DAHLMANN, P. KRISTENSEN, and A. SOBEK et al., 1997  Subunit arrangement in the human 20S proteasome. Proc. Natl. Acad. Sci. USA 94:2939-2944[Abstract/Free Full Text].

LEONHARD, K., J. M. HERRMANN, R. A. STUART, G. MANNHAUPT, and W. NEUPERT et al., 1996  AAA proteases with catalytic sites on opposite membrane surfaces comprise a proteolytic system for the ATP-dependent degradation of inner membrane proteins in mitochondria. EMBO J. 15:4218-4229[Medline].

MAGNANI, M., G. SERAFINI, A. ANTONELLI, M. MALATESTA, and G. GAZZANELLI, 1991  Evidence for a particulate location of ubiquitin conjugates and ubiquitin-conjugating enzymes in rabbit brain. J. Biol. Chem. 266:21018-21024[Abstract/Free Full Text].

MOCZKO, M., K. DIETMEIER, T. SOLLNER, B. SEGUI, and H. F. STEGER et al., 1992  Identification of the mitochondrial receptor complex in Saccharomyces cerevisiae.. FEBS Lett. 310:265-268[Medline].

MORALES, M. J., Y. L. DANG, Y. C. LOU, P. SULO, and N. C. MARTIN, 1992  A 105-kDa protein is required for yeast mitochondrial RNase P activity. Proc. Natl. Acad. Sci. USA 89:9875-9879[Abstract/Free Full Text].

MYERS, A. M., L. K. PAPE, and A. TZAGOLOFF, 1985  Mitochondrial protein synthesis is required for maintenance of intact mitochondrial genomes in Saccharomyces cerevisiae.. EMBO J. 4:2087-2092[Medline].

NANDI, D., E. WOODWARD, D. B. GINSBURG, and J. J. MONACO, 1997  Intermediates in the formation of mouse 20S proteasomes: implications for the assembly of precursor beta subunits. EMBO J. 16:5363-5375[Medline].

PEARCE, D. A. and F. SHERMAN, 1995  Degradation of cytochrome oxidase subunits in mutants of yeast lacking cytochrome c and suppression of the degradation by mutation of yme1. J. Biol. Chem. 270:20879-20882[Abstract/Free Full Text].

PEARCE, D. A. and F. SHERMAN, 1997  Differential ubiquitin-dependent degradation of the yeast apo- cytochrome c isozymes. J. Biol. Chem. 272:31829-31836[Abstract/Free Full Text].

PLEMPER, R. K. and D. H. WOLF, 1999  Retrograde protein translocation: ERADication of secretory proteins in health and disease. Trends Biochem. Sci. 24:266-270[Medline].

PON, L., and G. SCHATZ, 1991 Biogenesis of yeast mitochondria, pp. 333–406 in The Molecular and Cellular Biology of the Yeast Saccharomyces: Genome Dynamics, Protein Synthesis, and Energetics, edited by J. R. BROACH, J. R. PRINGLE and E. W. JONES. Cold Spring Harbor Press, Cold Spring Harbor, NY.

RAMOS, P. C., J. HOCKENDORFF, E. S. JOHNSON, A. VARSHAVSKY, and R. J. DOHMEN, 1998  Ump1p is required for proper maturation of the 20S proteasome and becomes its substrate upon completion of the assembly. Cell 92:489-499[Medline].

RAPAPORT, D., W. NEUPERT, and R. LILL, 1997  Mitochondrial protein import. Tom40 plays a major role in targeting and translocation of preproteins by forming a specific binding site for the presequence. J. Biol. Chem. 272:18725-18731[Abstract/Free Full Text].

RINALDI, T., S. FRANCISCI, E. SENNARO, L. FRONTALI, and M. BOLOTIN-FUKUHARA, 1994  Suppression of a mitochondrial point mutation in a tRNA gene can cast light on the mechanisms of 3' end-processing. Curr. Genet. 25:451-455[Medline].

RINALDI, T., M. BOLOTIN-FUKUHARA, and L. FRONTALI, 1995  A Saccharomyces cerevisiae gene essential for viability has been conserved in evolution. Gene 160:135-136[Medline].

RINALDI, T., C. RICCI, D. PORRO, M. BOLOTIN-FUKUHARA, and L. FRONTALI, 1998  A mutation in a novel yeast proteasomal gene, RPN11/MPR1, produces a cell cycle arrest, overreplication of nuclear and mitochondrial DNA, and an altered mitochondrial morphology. Mol. Biol. Cell 9:2917-2931[Abstract/Free Full Text].

ROSE, M. D., P. NOVICK, J. H. THOMAS, D. BOTSTEIN, and G. R. FINK, 1987  A Saccharomyces cerevisiae genomic plasmid bank based on a centromere-containing shuttle vector. Gene 60:237-243[Medline].

ROTHSTEIN, R., 1991  Targeting, disruption, replacement, and allele rescue: integrative DNA transformation in yeast. Methods Enzymol. 194:281-301[Medline].

SAMBROOK, J., E. F. FRITSCH and T. MANIATIS, 1989 Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

SHERMAN, F., 1991  Getting started with yeast. Methods Enzymol. 194:3-21[Medline].

SHERMAN, F. and J. HICKS, 1991  Micromanipulation and dissection of asci. Methods Enzymol. 194:21-37[Medline].

SHU, H. H., C. A. WISE, G. D. CLARK-WALKER, and N. C. MARTIN, 1991  A gene required for RNase P activity in Candida (Torulopsis) glabrata mitochondria codes for a 227-nucleotide RNA with homology to bacterial RNase P RNA. Mol. Cell. Biol. 11:1662-1667[Abstract/Free Full Text].

SIKORSKI, R. S. and J. D. BOEKE, 1991  In vitro mutagenesis and plasmid shuffling: from cloned gene to mutant yeast. Methods Enzymol. 194:302-318[Medline].

SIKORSKI, R. S. and P. HIETER, 1989  A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.. Genetics 122:19-27[Abstract/Free Full Text].

SMYTH, K. A. and J. M. BELOTE, 1999  The dominant temperature-sensitive lethal DTS7 of Drosophila melanogaster encodes an altered 20S proteasome beta-type subunit. Genetics 151:211-220[Abstract/Free Full Text].

STRIBINSKIS, V., G. J. GAO, P. SULO, Y. L. DANG, and N. C. MARTIN, 1996  Yeast mitochondrial RNase P RNA synthesis is altered in an RNase P protein subunit mutant: insights into the biogenesis of a mitochondrial RNA-processing enzyme. Mol. Cell. Biol. 16:3429-3436[Abstract].

SUTOVSKY, P., R. MORENO, and G. SCHATTEN, 1998  Sperm mitochondrial ubiquitination and a model explaining the strictly maternal mtDNA inheritance in mammals. Mol. Biol. Cell 9:309a.

THORSNESS, P. E., K. H. WHITE, and T. D. FOX, 1993  Inactivation of YME1, a member of the ftsH-SEC18-PAS1-CDC48 family of putative ATPase-encoding genes, causes increased escape of DNA from mitochondria in Saccharomyces cerevisiae.. Mol. Cell. Biol. 13:5418-5426[Abstract/Free Full Text].

VESTWEBER, D., J. BRUNNER, A. BAKER, and G. SCHATZ, 1989  A 42K outer-membrane protein is a component of the yeast mitochondrial protein import site. Nature 341:205-209[Medline].

WACH, A., 1996  PCR-synthesis of marker cassettes with long flanking homology regions for gene disruptions in S. cerevisiae.. Yeast 12:259-265[Medline].

WACH, A., A. BRACHAT, R. POHLMANN, and P. PHILIPPSEN, 1994  New heterologous modules for classical or PCR-based gene disruptions in Saccharomyces cerevisiae.. Yeast 10:1793-1808[Medline].

WEBER, E. R., T. HANEKAMP, and P. E. THORSNESS, 1996  Biochemical and functional analysis of the YNE1 gene product, and ATP and zinc-dependent mitochondrial protease from S. cerevisiae. Mol. Biol. Cell 7:307-317[Abstract].

ZENNARO, E., S. FRANCISCI, A. RAGNINI, L. FRONTALI, and M. BOLOTIN-FUKUHARA, 1989  A point mutation in a mitochondrial tRNA gene abolishes its 3' end processing. Nucleic Acids Res. 17:5751-5764[Abstract/Free Full Text].

ZHAUNG, Z. P. and R. MCCAULEY, 1989  Ubiquitin is involved in the in vitro insertion of monoamine oxidase B into mitochondrial outer membranes. J. Biol. Chem. 264:14594-14596[Abstract/Free Full Text].

ZIELER, H. A., M. WALBERG, and P. BERG, 1995  Suppression of mutations in two Saccharomyces cerevisiae genes by the adenovirus E1A protein. Mol. Cell. Biol. 15:3227-3237[Abstract].




This article has been cited by other articles:


Home page
Nucleic Acids ResHome page
V. Stribinskis and K. S. Ramos
Rpm2p, a protein subunit of mitochondrial RNase P, physically and genetically interacts with cytoplasmic processing bodies
Nucleic Acids Res., February 28, 2007; 35(4): 1301 - 1311.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
V. Stribinskis, H.-C. Heyman, S. R. Ellis, M. C. Steffen, and N. C. Martin
Rpm2p, a Component of Yeast Mitochondrial RNase P, Acts as a Transcriptional Activator in the Nucleus
Mol. Cell. Biol., August 1, 2005; 25(15): 6546 - 6558.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. A. Fleming, E. S. Lightcap, S. Sadis, V. Thoroddsen, C. E. Bulawa, and R. K. Blackman
Complementary whole-genome technologies reveal the cellular response to proteasome inhibition by PS-341
PNAS, February 5, 2002; 99(3): 1461 - 1466.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
V. Stribinskis, G.-J. Gao, S. R. Ellis, and N. C. Martin
Rpm2, the Protein Subunit of Mitochondrial RNase P in Saccharomyces cerevisiae, Also Has a Role in the Translation of Mitochondrially Encoded Subunits of Cytochrome c Oxidase
Genetics, June 1, 2001; 158(2): 573 - 585.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
E. V. Koonin, Y. I. Wolf, and L. Aravind
Prediction of the Archaeal Exosome and Its Connections with the Proteasome and the Translation and Transcription Machineries by a Comparative-Genomic Approach
Genome Res., February 1, 2001; 11(2): 240 - 252.
[Abstract] [Full Text]