- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Langdon, T.
- Articles by Jenkins, G.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Langdon, T.
- Articles by Jenkins, G.
De Novo Evolution of Satellite DNA on the Rye B Chromosome
Tim Langdona, Charlotte Seagoa, R. Neil Jonesa, Helen Oughamb, Howard Thomasb, John W. Forstera,c, and Glyn Jenkinsaa Institute of Biological Sciences, University of Wales, Penglais, Aberystwyth, Ceredigion SY23 3DD, United Kingdom,
b Institute of Grassland and Environmental Research, Aberystwyth SY23 3EB, United Kingdom
c Plant Biotechnology Centre, Agriculture Victoria, La Trobe University, Burdoora, Victoria 3083, Australia
Corresponding author: Glyn Jenkins, Institute of Biological Sciences, Cledwyn Bldg., University of Wales, Aberystwyth, Penglais, Aberystwyth, Ceredigion, SY23 3DD, United Kingdom., gmj{at}aber.ac.uk (E-mail)
Communicating editor: J. A. BIRCHLER
| ABSTRACT |
|---|
The most distinctive region of the rye B chromosome is a subtelomeric domain that contains an exceptional concentration of B-chromosome-specific sequences. At metaphase this domain appears to be the physical counterpart of the subtelomeric heterochromatic regions present on standard rye chromosomes, but its conformation at interphase is less condensed. In this report we show that the two sequence families that have been previously found to make up the bulk of the domain have been assembled from fragments of a variety of sequence elements, giving rise to their ostensibly foreign origin. A single mechanism, probably based on synthesis-dependent strand annealing (SDSA), is responsible for their assembly. We provide evidence for sequential evolution of one family on the B chromosome itself. The extent of these rearrangements and the complexity of the higher-order organization of the B-chromosome-specific families indicate that instability is a property of the domain itself, rather than of any single sequence. Indirect evidence suggests that particular fragments may have been selected to confer different properties on the domain and that rearrangements are frequently selected for their effect on DNA structure. The current organization appears to represent a transient stage in the evolution of a conventional heterochromatic region from complex sequences.
CEREALS, like other higher eukaryotes, often contain very large amounts of repetitive DNAs, which make up the bulk of the genome in species such as maize, barley, wheat, and rye. It is still not clear whether these nongenic DNAs play useful roles in genome function. The majority of repetitive DNA in these species is derived from long terminal repeat (LTR) retrotransposons (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Cultivated rye (Secale cereale) is a good model for studying satellite evolution, as it has particularly prominent heterochromatic domains located subtelomerically on most chromosome arms. The domains are made up principally of a small number of satellite families (![]()
![]()
![]()
![]()
Rye is also notable for the frequent occurrence of a supernumerary, or B chromosome, which is found in many populations throughout its geographical range. A single rye B chromosome contains the equivalent of 10% of the host haploid DNA content, but no major genes have been located on it, and its presence appears to alter the host phenotype only via nonspecific nucleotypic effects (reviewed in ![]()
![]()
![]()
| MATERIALS AND METHODS |
|---|
Plant material:
All somatic and meiotic materials were taken from a local experimental B population of S. cereale containing B chromosomes (2n = 2x = 14 + B).
DNA sequencing and molecular methods:
Isolation of the E3900 clone has been described previously (![]()
EMBL3 arms (Stratagene, La Jolla, CA). The ligation mix was packaged using a Stratagene Gigagpack Gold kit and used to infect Escherichia coli strain SRB. Genomic DNA was made using a modification of the method of ![]()
Oligonucleotides and conditions used for PCR were as follows: crw-R39 UTR and gag recovery, T3LX (TATCAAGTGGTATCAGAGCCAGG) and AW39R (CCATCTCCTTGTARTAYTCSTCAAC) or T3LX and 3900-13(CTGATTGCTTAATCTATCTTTAC), 96 x 35 sec, 7 cycles of 92 x 40 sec, 48 x 1 min, 68 x 4 min, 22 cycles of 92 x 40 sec, 48 x 10 sec, and 68 x 3 min. Crw-R39-related downstream sequences were as follows: AW37 (TATGTKCTKATHTGGTGGGAYCARAT) and BOTYR (GGCATGACAAGCCACTCATA), under conditions as described above.
Probes were made by single-primer PCR labeling of PCR fragments from the 3900 plasmid template: 15OUT (CAATATTGTGAGTGTTTTGCGA) was used to label the 15OUT/600OUT (GTCTTTCTTCCAACTATCTTT) product (3900 sequence bases 22872779), and 800R (CGCACTAGCCTACGGATAGA) was used to label 800R/15HR2 (GTTCTATACTAGATCCAATAA; 9151584).
Fluorescence in situ hybridization:
Preparation and pretreatment of the cytological preparations and fluorescence in situ hybridization (FISH) were performed according to published procedures (![]()
![]()
![]()
![]()
Sequence analysis:
Database searches were performed with BLAST, and further sequence analysis was carried out with the Genetics Computer Group (Madison, WI) programs. Sequence alignments were displayed using GeneDoc (K. B. Nicholas, and H. B. Nicholas, distributed by the authors). Curvature predictions were made using the bend.it server (http://www2.icgeb.trieste.it/~dna/index.html) using the DNase I-based bendability parameters of ![]()
![]()
| RESULTS |
|---|
Complex organization of the B chromosome subtelomeric domain:
Two repeat families (D1100 and E3900) have previously been shown to be major components of the subtelomeric domain of rye B chromosomes (![]()
![]()
![]()
![]()
![]()
![]()
|
The structural complexity revealed by cytogenetic methods was also seen in genomic clones. A partial library was constructed from the DNA of a rye plant containing four B chromosomes in the vector
EMBL3 and was screened with the E3900 clone. A total of 12 positive plaques were selected, from which four clones (designated
GE3900-2, -4, -5, and -6) were chosen for further characterization on the basis of their distinctive patterns in initial EcoRI digests. The library was rescreened with the D1100 clone and a number of positive plaques were recovered. Each gave the same pattern on EcoRI digestion, and a single clone (designated
GD1100-1) was chosen for further characterization. Some restriction fragments of these clones were of sizes predicted from previous Southern analysis of the B-chromosome-specific families. However, other fragments (e.g., 6.5-kb band in
GE3900-4) do not correspond to any known size variants. The identity of these fragments was investigated by Southern hybridization with D1100 and E3900 clones; individual fragments were also recovered from gels and used as probes on genomic DNA extracted from rye plants with B chromosomes (+B DNA) or without B chromosomes (0B DNA). Table 1 summarizes the results.
|
There are three conclusions from this analysis. First, each clone contains more than one size class of EcoRI fragments derived from the D1100 or E3900 families, and none represents a simple monotonous array. Second, two of the clones identified as containing E3900 also contain sequences related to the D1100 family, indicating that the two B-chromosome-specific families are frequently contiguous. Third, several fragments contain sequences that are not B chromosome specific but show similarity to sequences from rye A chromosomes. Of the four bands showing this behavior, three also show hybridization to B-chromosome-specific bands diagnostic for the characterized families, and they presumably correspond to junctions between B-chromosome-specific elements and repetitive sequences common to A and B chromosomes. The fourth fragment (
GE3900-2, 2.1 kb) does not hybridize to either D1100 or E3900.
This last fragment was subcloned into pUC18 and designated as pRAB2100. Southern hybridization patterns of this clone with digested 0B and +B genomic DNAs indicate that it is part of a large medium-copy-number repeat family present on both A and B chromosomes (not shown). B-chromosome-specific fragments identified by the probe suggest that divergent members of the family have been amplified on the B chromosome. The probe also hybridizes to sequences in wheat (Triticum aestivum) and barley (Hordeum vulgare). Sequencing of the ends of this clone indicated that it was homologous to a sequence found in the barley genome. A highly conserved motif found in both sequences shows identity to the polypurine binding site of the maize copia-like retrotransposons PREM2 and Ropie (Figure 2). The pRAB2100 sequence is therefore likely to be derived at least in part from the LTR of a related retrotransposon. FISH to rye metaphase chromosomes with pRAB2100 demonstrated that it is dispersed throughout both A and B genomes (not shown).
|
Unusual and contrasting nucleotypic behavior by E3900- and D1100-rich domains:
The subtelomeric domain of the rye B chromosome has been described as heterochromatic as a consequence of its highly condensed appearance in mitotic and meiotic metaphase karyotypes (Figure 3A). However, a dispersed appearance of D1100-containing domains in some interphase cells has been described (![]()
|
The E3900 clone contains a retrotransposon fragment:
The isolation of the E3900 clone has been described previously (![]()
|
The only extensive region of similarity to previously characterized sequences lies between bases 2853 and 3384, which encodes a partial reading frame for the gag protein of an LTR retrotransposon, most closely related to a highly conserved Ty3/gypsy family, crwydryn, which has colonized the centromeres of the Poaceae (T. LANGDON, C. SEAGO, M. MENDE, M. LEGGETT, H. THOMAS, J. W. FORSTER, H. THOMAS, R. N. JONES and G. JENKINS, unpublished results; ![]()
|
The remainder of the E3900 clone appears to be unrelated to this gag sequence. We were unable to find even fragmentary homologies with other canonical retrotransposon protein components, which usually show levels of conservation far higher than those of gag. In addition, there is neither similarity to the LTR sequences associated with related gag genes nor duplication of sequences flanking the gag reading frame, as would be expected for LTRs. Taken together with the absence of upstream tRNA-primer-binding sites, it is unlikely that the gag sequence retains any potential for mobility (see below and DISCUSSION). The E3900 family, therefore, does not appear to correspond to a scrambled, "slave," or otherwise degenerate retrotransposon despite the presence of this single fragment.
The E3900 gag fragment has been generated by chromosomal rearrangements:
The downstream limit of gag-related sequences is defined by a 73-bp insert, flanked by a 13-bp duplication (12/13 base identity). The inserted sequence is strikingly similar to a coding region of the 2-oxoglutarate/malate translocator genes of rice and millet (![]()
![]()
![]()
|
Evidence for a similar process is seen at the upstream limit of the gag fragment (Figure 6B). The conserved reading frame extends 5' from the region shown in Figure 5B to a stop codon at bases 28502852, contained within 14 bp, which duplicates the sequence lying 39 bp downstream. There is no in-frame methionine between this position and the conserved peptide motifs. To confirm that this was the junction of a rearrangement and to clarify the origin of the gag sequence, we attempted to recover intact fragments of the original element. The crwydryn family, in common with other LTR retrotransposons, uses a tRNAmet primer-binding site. We therefore carried out PCR with both 0B and +B rye DNA using a 5' oligonucleotide based on the crwydryn priming site and a degenerate 3' oligonucleotide based on an E3900/crwydryn consensus peptide motif. PCR product of ~900 bp was recovered from both template DNAs; however, two to four times more product was obtained from the +B DNA (not shown). Direct sequencing of the products indicated that the different yields reflected the presence of E3900 gag sequences in the +B reaction only. Products were cloned and sequenced; 4 +B clones all contained gag sequences identical to E3900, while all 14 0B clones characterized were derived from two related but divergent families. One of the +B clones (designated crw-R39-1) was sequenced in its entirety and aligned with E3900. Identity with E3900 is found downstream of the presumed junction (base 2853), but ends abruptly upstream of this point (Figure 6B). An open reading frame (ORF) in this clone extends a further 46 aa; a potential initiator methionine is found 16 aa from the beginning of this ORF. Translation initiation at this site would be consistent with the relative position of the conserved motifs in other gag genes shown in Figure 6. We therefore conclude that crw-R39-1 represents the ancestral sequence of the E3900 gag fragment and that the sequence in E3900 has been generated by rearrangements involving slipped mispairing during DNA synthesis, which have resulted in the deletion of the remainder of the crw-R39 retrotransposon.
Sequential evolution of the E3900 gag fragment:
We also attempted to recover downstream sequences of the crw-R39 retrotransposon to better characterize the 3' junction present in E3900. PCR using degenerate oligonucleotides based on conserved peptide motifs in the E3900 gag gene and the crwydryn reverse transcriptase generated equal amounts of a 1.9-kb product from equivalent quantities of both 0B and +B templates. Direct sequencing indicated that the product of both templates was indeed very similar and that it was related but not identical to that in E3900. The homology was sufficiently close that, on the basis of the presence of a conserved tripeptide motif (Figure 6A), we were able to confirm the position of the downstream breakpoint as lying within 3 bases of the start of the translocator-like sequence. No similarities were found downstream of this point, indicating that, as with the 5' junction, the rearrangement had deleted associated retrotransposon sequences.
One possible explanation for the failure to recover crw-R39 downstream sequences is that only rearranged fragments are present at significant levels. We carried out PCR with the crwydryn PBS oligonucleotide described above and an E3900-specific oligonucleotide whose target lies downstream of the 3' gag rearrangement; a 1-kb product was readily amplified from +B but not 0B rye genomic DNA. It therefore appears that intact crw-R39 elements are rare, even on the B chromosome, but that after the 3' truncation event, a B-chromosome-specific amplification of the rearranged sequences has occurred. Following the second 5' rearrangement that removed upstream crw-R39 sequences, further round(s) of amplification have led to the current situation where the majority of crw-R39 gag sequences detectable by Southern hybridization are part of the E3900 repeat. Given that most functional components of the crw-R39 element are removed by the first rearrangement, it is likely that the gag sequences have played a passive role throughout the amplification process and are not themselves responsible for their instability.
The E3900 family displays unusual methylation patterns:
We used the isoschizomers HpaII/MspI and EcoRII/BstNI/MvaI to examine the methylation patterns of E3900 in genomic DNA extracted from leaf tissue. Surprisingly, we found that while most HpaII sites screened were modified, as expected for plant repetitive DNA, the site(s) at 1920 and/or 1997 appear(s) to be specifically protected (Figure 7). The MspI digest indicates that there is also relative undermethylation at site 3067. The situation at EcoRII sites is more complex, but again, there appears to be differential methylation with a relative lack of modification of the gag region and sequences immediately upstream of it. This is demonstrated, for example, by low levels of completely digested fragments detected by the 15OUT probe; only partially digested fragments are seen with probe 800R. The PstI site in the central region (position 1700) is also cleaved in a significant proportion of family members.
|
The D1100 family contains a rearranged MITE element:
The published sequence of the D1100 family (![]()
![]()
![]()
![]()
|
A potential instability motif is present in E3900 and D1100:
The Tnr-like sequence in D1100 is truncated and appears to have been rearranged by the same slipped mispairing and synthesis mechanism seen in E3900. A 12-bp duplication, separated by 15 bp of conserved Tnr-like sequence, is found at the limit of the D1100 Tnr homology (Figure 8B). Strikingly, a similar motif is found immediately upstream of the 5' junctions of both the E3900 gag fragment and the D1100 Tnr element (Figure 8), although there is no significant sequence similarity elsewhere between the families. The motif is repeated some 400 bp upstream of the Tnr junction in D1100 and at the 3' end of E3900. A related sequence is present in the maize 180-bp satellite that forms tandem arrays within knob heterochromatin. The second E3900 motif and the 180-bp motif are both partially duplicated (Figure 9); the maize duplication is seen as an occasional 202-bp variant (![]()
|
| DISCUSSION |
|---|
Generation of novel sequences in the B chromosome-specific domain:
The E3900 and D1100 families, which are amplified specifically within the B chromosome subtelomeric domain in the rye genome, are made up of fragments of a number of previously unrelated elements. Those fragment junctions that can be unambiguously identified indicate that a common process has been responsible for their rearrangement, suggesting that the assembly of each family may have occurred within the B chromosome domain itself as a consequence of the domain's inherent instability, rather than through any intrinsic properties of the ancestral components. This suggestion is supported by a number of observations. First, although both E3900 and D1100 contain fragments of mobile elements, key regions of each element required in conventional mechanisms of mobility have been lost in the most highly amplified family members. Second, the complexity of the genomic clones argues against any simple clonal expansion of the families as the result of the acquisition of novel emergent properties (for example, array expansion as a result of the generation of recombinogenic ends by transposase nicking; ![]()
We propose, therefore, that the E3900 and D1100 families have originated from part of the rye A genome that has undergone a progressive series of amplification and simplification steps as a consequence of its position as the most centromere-distal region in the ancestral B chromosome fragment. The observed concentration gradient of D1100 and, even more strikingly, E3900 (Figure 1) indicates that even within the B-chromosome-specific domain, selective amplification occurs chiefly, if not entirely, at the most distal point. A possible basis for this pattern is suggested by the consistent observation of apparently discontinuous blocks of E3900 at this distal tip during meiotic prophase (Figure 3). While the chromatin linking these blocks may be present although not detectable, it is clear that it must be at best highly stretched and prone to breakage. A number of mechanisms could result in the DNA flanking a breakpoint in this region being used as a template in its repair (for example, by SDSA using a related region of a sister chromatid as a template). If increases in size are favored while the position of the potential fragile site is maintained at a fixed distance from the chromosome end, rounds of sampling will result in ever-decreasing complexity of distal sequences. It is significant that equivalent regions of the rye A chromosomes are also unusual in the quantity of amplified repetitive DNA that they contain, which is far in excess of that seen in related species, such as wheat, and that rearrangements of these satellites are more frequent in distal regions (![]()
![]()
A single mechanism for B-chromosome-specific domain rearrangements?
The junctions between the component fragments of the B-chromosome-specific families are unusually consistent in containing duplications of flanking sequences. Those examples described above are clearly defined by comparison with conserved sequences but similar arrangements involving uncharacterized elements are also likely to be present; for example a duplication of bases 36413658 is present 12 bp downstream and immediately flanking a series of simple sequence repeats [(TTTTC)4; Figure 4; also see below]. Duplication patterns of this type have been found to occur in the majority of spontaneous deletions in the maize Wx gene (![]()
![]()
![]()
![]()
![]()
![]()
Preferred sites for rearrangements in amplified sequences:
Although the lesions repaired by SDSA may be created by random domain-wide processes, there appear to be sequences that are preferentially involved in rearrangements. The most prominent of these is the instability motif seen adjacent to junctions in both E3900 and D1100, which is similar to a sequence found near the hot spot for retrotransposon integration identified in the maize knob satellite (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
|
Sequence rearrangements in chromatin structure:
Strikingly, the E3900 maximum takes the form of a double peak, separated by 54 bp, which resembles the nucleosome-positioning structure seen in a number of satellite families (![]()
In all three of these cases, unusual structures appear to have been created or enhanced at preexisting unstable rearrangement sites. The predicted structures tend to have a regular spatial organization, with a periodicity of multiples of 207 bp (Figure 10). The most plausible explanation for these events is that nucleosome positioning, typical of heterochromatic repeats, is evolving on previously euchromatic DNA, which is unlikely to have contained strong packaging signals (![]()
![]()
![]()
Methylation and chromatin structure:
A particularly intriguing aspect of the curvature maxima is the contribution of CpG dinucleotides, which may underlie the unusual hypomethylation pattern seen. The predicted structure near 1908 bp is partly determined by the CpG dinucleotide contained within the HpaII site at 1920 bp, which appears to be unmethylated (Figure 7). Although there is no current model for reliably predicting the effect of methylation on DNA structure, an approximation can be made by replacing the CpG motif with TpA. This single change decreased the predicted curvature of the region from ~12° per helical turn to ~10.5°. The specificity of this effect is demonstrated in Figure 10C, where all CpG dinucleotides have been replaced by TpA. Most peaks show little change either in position or magnitude, despite replacements of almost 10% of the E3900 sequence. Remarkably, there is very strong enhancement of the predicted peak adjacent to 1908 bp, which again can be shown to be due almost entirely to a single dinucleotide replacement. Replacement at both peaks increases the probability of a 5n (1035-bp) structure while reducing the probability of an out-of-phase structure at 2.5n. Another strong single replacement effect is seen at ~3540 bp, where methylation increases the probability of a 2n structure. Although these simulations must be treated with caution, it is tempting to speculate that the 1920-bp HpaII site is protected from methylation as a consequence of structural constraints, either because the bases are not accessible to methylases or because the site acts as a switch between two chromatin conformations and its methylation is not compatible with the function of the B chromosome domain in leaf tissue. This possibility is discussed further below.
Potential significance of amplified sequences:
Structural considerations appear to have been important in the more recent stages of evolution of the B-chromosome-specific families, but are unlikely to have been significant in the initial stages of amplification, when individual families would not have been sufficiently concentrated to have had large-scale effects on chromatin conformation. Although the large number of fragments apparently involved in E3900 evolution suggest that many random events have occurred, there are distinctive elements in both E3900 and D1100 that may have provided adaptive advantages during their initial amplification.
The most interesting fragment present in the B-chromosome-specific families is the E3900 sequence derived from a Ty3-gypsy retrotransposon. Initially amplified as an uninterrupted but chimeric gag reading frame, probably attached to its original LTR promoter, this sequence had the potential to express a peptide analogous to the mouse Fv1 product, a gag-like protein that confers resistance to leukemia retrovirus by interfering with a stage of infection that follows the virus' entry into the cell (![]()
![]()
![]()
![]()
The D1100 family, in contrast to E3900, is likely to have played a role in chromosome organization since its origin. The elements are smaller than E3900 and show no evidence of a genic origin or of such high levels of rearrangement. Instead, a MITE fragment is present, which appears to have been inserted into an AT-rich sequence, an organization typical of cereal MARs (![]()
![]()
![]()
![]()
-satellite arrays (![]()
![]()
The B-chromosome-specific domain represents a transient stage in satellite evolution:
Satellite families have been studied extensively in both animals and plants, and the evolution of tandemly repeated sequences after their organization into arrays has been well documented. The origin of most satellites, however, is unknown. The data reported here are unusual in describing the creation of satellite repeats de novo from complex euchromatic sequences. It is still not clear why the evolution of new families on the B chromosome should be favored over the apparently simpler processes of capture and amplification or modification of existing repeats from the A chromosomes, particularly as translocation of A genome domains to the B chromosome has been observed (![]()
It is of some interest to consider if the contemporary B-chromosome-specific domain represents a stable evolutionary stage. The unusual discontinuous appearance of the most terminal subdomain at meiotic prophase and the variable degree of condensation of the domain in vegetative cells indicate that the region does not behave consistently. An obvious explanation is that this reflects the conflicting properties of the two major sequence families, D1100 and E3900, with conformation effects similar to those seen in the occurrence of position effect variegation (PEV; ![]()
![]()
![]()
![]()
![]()
By analogy with the demonstrated role of heterochromatic domains in Drosophila (![]()
![]()
![]()
| ACKNOWLEDGMENTS |
|---|
This work was supported by Biotechnology and Biological Sciences Research Council grant PO1643 to G.J., R.N.J., and J.W.F.
Manuscript received July 26, 1999; Accepted for publication October 18, 1999.
| LITERATURE CITED |
|---|
ANANIEV, E. V., R. L. PHILLIPS, and H. W. RINES, 1998a Complex structure of knob DNA on maize chromosome 9: retrotransposon invasion into heterochromatin. Genetics 149:2025-2037
ANANIEV, E. V., H. W. RINES, and R. L. PHILLIPS, 1998b Chromosome-specific molecular organization of maize (Zea mays L.) centromeric regions. Proc. Natl. Acad. Sci. USA 95:13071-13078.
AVRAMOVA, Z., A. TIKHONOV, M. CHEN, and J. L. BENNETZEN, 1998 Matrix attachment regions and structural colinearity in the genomes of two grass species. Nucleic Acids Res. 26:761-767
BENNETZEN, J. L. and E. A. KELLOG, 1997 Do plants have a one-way ticket to genomic obesity? Plant Cell 9:1509-1514[Medline].
BENNETZEN, J. L., P. SANMIGUEL, M. S. CHEN, A. TIKHONOV, and M. FRANCKI et al., 1998 Grass genomes. Proc. Natl. Acad. Sci. USA 95:1975-1978
BEST, B., P. LE TISSIER, G. TOWERS, and J. P. STOYE, 1996 Positional cloning of the mouse retrovirus restriction gene Fv1.. Nature 382:826-829[Medline].
BLUNDEN, R., T. J. WILKES, J. W. FORSTER, M. M. JIMENEZ, and M. J. SANDERY et al., 1993 Identification of the E3900 family, a second family of rye B chromosome specific repeated sequences. Genome 36:706-712[Medline].
BRUKNER, I. R., R. SANCHEZ, D. SUCK, and S. PONGOR, 1995 Trinucleotide models for DNA bending propensity: comparison of models based on DnaseI digestion and nucleosome packaging data. J. Biomol. Struct. Dyn. 13:309-317[Medline].
CAIZZI, R., C. CAGGESE, and S. PIMPINELLI, 1993 BarI-1, a new transposon-like family in Drosophila melanogaster with a unique heterochromatic organization. Genetics 133:335-345[Abstract].
CRAIG, J., S. BOYLE, P. PERRY, and W. BICKMORE, 1997 Scaffold attachments within the human genome. J. Cell Sci. 110:2673-2682[Abstract].
CSINK, A. K. and S. HENIKOFF, 1998 Something from nothing: the evolution and utility of satellite repeats. Trends Genet. 14:200-204[Medline].
DERNBURG, A. F., J. W. SEDAT, and R. S. HAWLEY, 1996 Direct evidence of a role for heterochromatin in meiotic chromosome segregation. Cell 86:135-146[Medline].
DONG, F. G., J. T. MILLER, S. A. JACKSON, G. L. WANG, and P. C. RONALD et al., 1998 Rice (Oryza sativa) centromeric regions consist of complex DNA. Proc. Natl. Acad. Sci. USA 95:8135-8140
FITZGERALD, D. J., G. L. DRYDEN, E. C. BRONSON, J. S. WILLIAMS, and J. N. ANDERSON, 1994 Conserved patterns of bending in satellite and nucleosome positioning DNA. J. Biol. Chem. 269:21303-21314
GABRIELIAN, A. and S. PONGOR, 1996 Correlation of intrinsic DNA curvature with DNA property periodicity. FEBS Lett. 393:65-68[Medline].
GOODSELL, D. S. and R. E. DICKERSON, 1994 Bending and curvature calculations in B-DNA. Nucleic Acids Res. 22:5497-5503
GORBONUVA, V. and A. A. LEVY, 1997 Non-homologous DNA end joining in plant cells is associated with deletions and filler DNA insertions. Nucleic Acids Res. 25:4650-4657
GREBENSTEIN, B., O. GREBENSTEIN, W. SAUER, and V. HEMLEBEN, 1995 Characterization of a highly repeated DNA component of perennial oats (Helictotrichon, Poaceae) with sequence similarity to a A-genome-specific satellite DNA of rice (Oryza) Theor. Appl. Genet. 90:1101-1105.
GUSTAFSON, J. P., A. J. LUKASZEWSKI, and M. D. BENNETT, 1983 Somatic deletion and redistribution of telomeric heterochromatin in the genus Secale and Triticale.. Chromosoma 88:293-298.
HASEGAWA, N., 1934 A cytological study on 8-chromosome rye. Cytologia 6:68-77.
HESLOP-HARRISON, J. S., T. SCHWARZACHER, K. ANAMTHAWAT-JONSSON, A. R. LEITCH, and I. J. LEITCH, 1991 In situ hybridisation with automated chromosome denaturation. Technique 3:109-116.
HOUBEN, A., R. G. KYNAST, U. HEIM, H. HERMANN, and R. N. JONES et al., 1996 Molecular cytogenetic characterisation of the terminal heterochromatic segment of the B-chromosome of rye (Secale cereale). Chromosoma 105:97-103[Medline].
JONES, J. D. G. and R. B. FLAVELL, 1982 The structure, amount and chromosomal localization of defined repeated DNA sequences in species of the genus Secale.. Chromosoma 86:613-641.
JONES, R. N., and M. J. PUERTAS, 1993 The B-chromosomes of rye, pp. 81112 in Frontiers in Plant Science Research, edited by K. K. DHIR and T. S. SAREEN. Bhagwati Enterprises, Delhi.
KARP, A., P. G. OWEN, S. H. STEELE, P. J. BEBELI, and P. J. KALTSIKES, 1992 Variation in telomeric heterochromatin in somaclones of rye. Genome 35:590-593.
KIPLING, D. and P. E. WARBURTON, 1997 Centromeres, CENP-B and Tigger too. Trends Genet. 13:141-145[Medline].
LANZER, M., S. P. WERTHEIMER, D. DEBRUIN, and J. V. RAVETCH, 1994 Chromatin structure determines the sites of chromosome breakages in Plasmodium falciparum.. Nucleic Acids Res. 22:3099-3103
LEITCH, I. J., and J. S. HESLOP-HARRISON, 1992 Detection of digoxygenin labelled DNA probes hybridized to plant chromosomes in situ, pp. 1825 in Methods in Molecular Biology: Protocols for Nucleic Acid Analysis by Non-Radioactive Techniques, edited by P. G. ISAAC. Humana Press, Clifton, NJ.
LIMA-DE-FARIA, A., 1962 Genetic interaction in rye expressed at the chromosome phenotype. Genetics 47:1455-1462
LIU, K. and A. STEIN, 1997 DNA sequence encodes information for nucleosome array formation. J. Mol. Biol. 270:559-573[Medline].
LOWARY, P. T. and J. WIDOM, 1997 Nucleosome packaging and nucleosome positioning of genomic DNA. Proc. Natl. Acad. Sci. USA 94:1183-1188
MOLLEGAARD, N. E., C. BAILLY, M. J. WARING, and P. E. NIELSEN, 1997 Effects of diaminopurine and inosine substitutions on A-tract induced DNA curvature. Importance of the 3'-A-tract junction. Nucleic Acids Res. 25:3497-3502
MORAIS-CECILIO, L., M. DELGADO, R. N. JONES, and W. VIEGAS, 1997 Interphase arrangement of rye B chromosomes in rye and wheat. Chrom. Res. 5:177-181.
MOSCHETTI, R., R. CAIZZI, and S. PIMPINELLI, 1996 Segregation distortion in Drosophila melanogaster: genomic organization of Responder sequences. Genetics 144:1665-1671[Abstract].
MULLER, H. P. and H. E. VARMUS, 1994 DNA bending creates favored sites for retroviral integration: an explanation for preferred insertion sites in nucleosomes. EMBO J. 13:4704-4714[Medline].
MUNTEANU, M. G., K. VLAHOVICEK, S. PARTHASARATY, I. SIMON, and S. PONGOR, 1998 Rod models of DNA: sequence-dependent anisotropic elastic modelling of local bending phenomena. Trends Biochem. Sci. 23:341-346[Medline].
NAGAKI, K., H. TSUJIMOTO, and T. SASAKUMA, 1998 Dynamics of tandem repetitive Afa-family sequences in triticeae, wheat-related species. J. Mol. Evol. 47:183-189[Medline].
NASSIF, N., J. PENNEY, S. PAL, W. R. ENGELS, and G. B. GLOOR, 1994 Efficient copying of nonhomologous sequences from ectopic sites via P-element-induced gap repair. Mol. Cell. Biol. 14:1613-1625
NEVES, N., A. BARAO, A. CASTILHO, M. SILVA, and L. MORAIS et al., 1992 Influence of DNA methylation on rye B-chromosome nondisjunction. Genome 35:650-652.
ORTIZ, M., M. J. PUERTAS, M. M. JIMENEZ, F. ROMERA, and R. N. JONES, 1996 B-chromosomes in inbred lines of rye (Secale cereale L.) 2. Effects on metaphase I and first pollen mitosis. Genetica 97:65-72.
OSTASHEVSKY, J. Y., 1996 Centromeric locations in karyotypes: a rule derived from the theory of branched polymers. J. Theor. Biol. 181:293-298[Medline].
PAN, W. H., A. HOUBEN, and R. SCHLEGEL, 1992 Highly effective cell synchronization in plant roots by hydroxyurea and amiprophos-methyl or colchicine. Genome 36:387-390.
PANSTRUGA, R., R. BUSCHGES, P. RIFFANELLI, and P. SCHULZE-LEFERT, 1998 A contiguous 60 kb genomic stretch from barley reveals molecular evidence for gene islands in a monocot genome. Nucleic Acids Res. 26:1056-1062
PASERO, P., N. SJAKSTE, C. BLETTRY, C. GOT, and M. MARILLEY, 1993 Long-range organization and sequence-directed curvature of Xenopus laevis satellite 1 DNA. Nucleic Acids Res. 21:4703-4710
PRESTING, G. G., L. MALYSHEVA, J. FUCHS, and I. Z. SCHUBERT, 1998 A TY3/GYPSY retrotransposon-like sequence localizes to the centromeric regions of cereal chromosomes. Plant J. 16:721-728[Medline].
PRUSS, D., F. D. BUSHMAN, and A. P. WOLFFE, 1994 Human immunodeficiency virus integrase directs integration to sites of severe DNA distortion within the nucleosome core. Proc. Natl. Acad. Sci. USA 91:5913-5917
PUERTAS, M. J., M. M. JIMENEZ, F. ROMERA, J. M. VEGA, and M. DIEZ, 1990 Maternal imprinting effect on B-chromosome transmission in rye. Heredity 64:197-204.
PUERTAS, M. J., M. GONZALEZ-SANCHEZ, S. MANZANERO, F. ROMERA, and M. M. JIMENEZ, 1998 Genetic control of the rate of transmission of rye B chromosomes. IV. Localization of the genes controlling B transmission rate. Heredity 80:209-213.
RAEDER, U. and P. BRODA, 1985 Rapid preparation of DNA from filamentous fungi. Lett. Appl. Microbiol. 1:17-20.
ROMERA, F., M. M. JIMENEZ, and M. J. PUERTAS, 1991 Factors controlling the dynamics of the B-chromosome polymorphism in Korean rye. Heredity 67:189-195.
ROSSI, M. S., C. G. PESCE, O. A. REIG, A. R. KORNBLIHTT, and J. ZORZOPULOS, 1993 Retroviral-like features in the monomer of the major satellite DNA from the South American rodents of the genus Ctenomys.. DNA Seq. 3:379-381[Medline].
RUBIN, E. and A. A. LEVY, 1997 Abortive gap repair: underlying mechanism for Ds element formation. Mol. Cell. Biol. 17:6294-6302[Abstract].
SALOMON, S. and H. PUCHTA, 1998 Capture of genomic and T-DNA sequences during double-strand break repair in somatic plant cells. EMBO J. 17:6086-6095[Medline].
SALSER, W., S. BOWEN, D. BROWNE, F. EL-ADLI, and N. FEDEROFF et al., 1976 Investigation of the organization of mammalian chromosomes at the DNA sequence level. Fed. Proc. 35:23-35[Medline].
SANCHEZ-ALONSO, P. and P. GUZMAN, 1998 Organization of chromosome ends in Ustilago maydis. RecQ-like helicase motifs at telomeric regions. Genetics 148:1043-1054
SANDERY, M. J., J. W. FORSTER, R. BLUNDEN, and R. N. JONES, 1990 Identification of a family of repeated sequences on the rye B chromosome. Genome 33:908-913.
SANMIGUEL, P., A. TIKHONOV, Y. K. JIN, N. MOTCHOULSKAIA, and D. ZAKHAROV et al., 1996 Nested retrotransposons in the intergenic regions of the maize genome. Science 274:765-768
SMITH, G. P., 1976 Evolution of repeated DNA sequences by unequal crossover. Science 191:528-535
STRAUSBAUGH, L. D. and S. M. WILLIAMS, 1996 High density of an SAR-associated motif differentiates heterochromatin from euchromatin. J. Theor. Biol. 183:159-167[Medline].
TANIGUCHI, M. and T. SUGIYAMA, 1996 Isolation, characterisation and expression of cDNA clones encoding a mitochondrial malate translocator from Panicum miliaceum L. Plant Mol. Biol. 30:51-64[Medline].
TATOUT, C., L. LAVIE, and J. M. DERAGON, 1998 Similar target site selection occurs in integration of plant and mammalian retroposons. J. Mol. Evol. 47:463-470[Medline].
TENZEN, T., Y. MATSUDA, H. OHTSUBO, and E. OHTSUBO, 1994 Transposition of Tnr1 in rice genomes to 5'-putapy-3' sites, duplicating the Ta sequence. Mol. Gen. Genet. 245:441-448[Medline].
TSUJIMOTO, H. and K. NIWA, 1992 DNA-structure of the B-chromosome of rye revealed by in situ hybridization using repetitive sequences. Jap. J. Genet. 67:233-241.
VERSHININ, A. V. and J. S. HESLOP-HARRISON, 1998 Comparative analysis of the nucleosomal structure of rye, wheat and their relatives. Plant Mol. Biol. 36:149-161[Medline].
VERSHININ, A. V., T. SCHWARZACHER, and J. S. HESLOP-HARRISON, 1995 The large-scale genomic organization of repetitive DNA families at the telomeres of rye chromosomes. Plant Cell 7:1823-1833[Abstract].
VERSHININ, A. V., E. G. ALKHIMOVA, and J. S. HESLOP-HARRISON, 1996 Molecular diversification of tandemly organized DNA sequences and heterochromatic chromosome regions in some Triticeae species. Chrom. Res. 4:517-525.
WALLRATH, L. L. and S. C. ELGIN, 1995 Position effect variegation in Drosophila is associated with an altered chromatin structure. Genes Dev. 9:1263-1277
WESSLER, S., A. TARPLEY, M. PURUGGANAN, M. SPELL, and R. OKAGAKI, 1990 Filler DNA is associated with spontaneous deletions in maize. Proc. Natl. Acad. Sci. USA 87:8731-8735
WILKES, T. M., M. G. FRANCKI, P. LANGRIDGE, A. KARP, and R. N. JONES et al., 1995 Analysis of rye B-chromosome structure using fluorescence in-situ hybridization (FISH). Chrom. Res. 3:466-472.
YAMADA, M., N. HAYATSU, A. MATSUURA, and F. ISHIKAWA, 1998 Y'-Help1, a DNA helicase encoded by the yeast subtelomeric Y' element, is induced in survivors defective for telomerase. J. Biol. Chem. 273:33360-33366
YOUNG, M. A., J. SRINIVASAN, I. GOLJER, S. KUMAR, D. L. BEVERIDGE, and P. H. BOLTON, 1995 Structure determination and analysis of local bending in an A-tract DNA duplex: comparison of results from crystallography, nuclear magnetic resonance, and molecular dynamics simulation on d(CGCAAAAATGCG). Methods Enzymol. 261:121-144[Medline].
YU, H. G., E. N. HIATT, A. CHAN, M. SWEENEY, and R. K. DAWE, 1997 Neocentromere-mediated chromosome movement in maize. J. Cell Biol. 139:831-840
ZHONG, X-B., P. F. FRANSZ, J. WENNEKES VAN EDEN, P. ZABEL, and A. VAN KAMMEN et al., 1996 High resolution mapping on pachytene chromosomes and extended DNA fibres by fluorescence in situ hybridisation. Plant Mol. Biol. Rep. 14:232-242.
This article has been cited by other articles:
![]() |
R. N. Jones, W. Viegas, and A. Houben A Century of B Chromosomes in Plants: So What? Ann. Bot., April 1, 2008; 101(6): 767 - 775. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Carchilan, M. Delgado, T. Ribeiro, P. Costa-Nunes, A. Caperta, L. Morais-Cecilio, R. N. Jones, W. Viegas, and A. Houben Transcriptionally Active Heterochromatin in Rye B Chromosomes PLANT CELL, June 1, 2007; 19(6): 1738 - 1749. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. L. Tek, J. Song, J. Macas, and J. Jiang Sobo, a Recently Amplified Satellite Repeat of Potato, and Its Implications for the Origin of Tandemly Repeated Sequences Genetics, July 1, 2005; 170(3): 1231 - 1238. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Pires, K. Y. Lim, A. Kovarik, R. Matyasek, A. Boyd, A. R. Leitch, I. J. Leitch, M. D. Bennett, P. S. Soltis, and D. E. Soltis Molecular cytogenetic analysis of recently evolved Tragopogon (Asteraceae) allopolyploids reveal a karyotype that is additive of the diploid progenitors Am. J. Botany, July 1, 2004; 91(7): 1022 - 1035. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Y. Lim, K. Skalicka, B. Koukalova, R. A. Volkov, R. Matyasek, V. Hemleben, A. R. Leitch, and A. Kovarik Dynamic Changes in the Distribution of a Satellite Homologous to Intergenic 26-18S rDNA Spacer in the Evolution of Nicotiana Genetics, April 1, 2004; 166(4): 1935 - 1946. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. C. Hsu, C. J. Wang, C. M. Chen, H. Y. Hu, and C. C. Chen Molecular Characterization of a Family of Tandemly Repeated DNA Sequences, TR-1, in Heterochromatic Knobs of Maize and Its Relatives Genetics, July 1, 2003; 164(3): 1087 - 1097. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Goel, Z. Chen, J. A. Conner, Y. Akiyama, W. W. Hanna, and P. Ozias-Akins Delineation by Fluorescence in Situ Hybridization of a Single Hemizygous Chromosomal Region Associated With Aposporous Embryo Sac Formation in Pennisetum squamulatum and Cenchrus ciliaris Genetics, March 1, 2003; 163(3): 1069 - 1082. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Langdon, G. Jenkins, R. Hasterok, R. N. Jones, and I. P. King A High-Copy-Number CACTA Family Transposon in Temperate Grasses and Cereals Genetics, March 1, 2003; 163(3): 1097 - 1108. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Langdon, C. Seago, M. Mende, M. Leggett, H. Thomas, J. W. Forster, H. Thomas, R. N. Jones, and G. Jenkins Retrotransposon Evolution in Diverse Plant Genomes Genetics, September 1, 2000; 156(1): 313 - 325. [Abstract] [Full Text] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Langdon, T.
- Articles by Jenkins, G.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Langdon, T.
- Articles by Jenkins, G.












