- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Sood, R.
- Articles by Wek, R. C.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Sood, R.
- Articles by Wek, R. C.
A Mammalian Homologue of GCN2 Protein Kinase Important for Translational Control by Phosphorylation of Eukaryotic Initiation Factor-2
Ruchira Sooda,
Amy C. Portera,
DeAnne Olsenb,
Douglas R. Cavenerb, and
Ronald C. Weka
a Department of Biochemistry and Molecular Biology, Indiana University School of Medicine, Indianapolis, Indiana 46202
b Department of Molecular Biology, Vanderbilt University, Nashville, Tennessee 37235
Corresponding author: Ronald C. Wek, Department of Biochemistry and Molecular Biology, Indiana University School of Medicine, Van Nuys Medical Science Bldg., Rm. 4067, 635 Barnhill Dr., Indianapolis, IN 46202-5122., rwek{at}iupui.edu (E-mail)
Communicating editor: M. JOHNSTON
| ABSTRACT |
|---|
A family of protein kinases regulates translation in response to different cellular stresses by phosphorylation of the
subunit of eukaryotic initiation factor-2 (eIF-2
). In yeast, an eIF-2
kinase, GCN2, functions in translational control in response to amino acid starvation. It is thought that uncharged tRNA that accumulates during amino acid limitation binds to sequences in GCN2 homologous to histidyl-tRNA synthetase (HisRS) enzymes, leading to enhanced kinase catalytic activity. Given that starvation for amino acids also stimulates phosphorylation of eIF-2
in mammalian cells, we searched for and identified a GCN2 homologue in mice. We cloned three different cDNAs encoding mouse GCN2 isoforms, derived from a single gene, that vary in their amino-terminal sequences. Like their yeast counterpart, the mouse GCN2 isoforms contain HisRS-related sequences juxtaposed to the kinase catalytic domain. While GCN2 mRNA was found in all mouse tissues examined, the isoforms appear to be differentially expressed. Mouse GCN2 expressed in yeast was found to inhibit growth by hyperphosphorylation of eIF-2
, requiring both the kinase catalytic domain and the HisRS-related sequences. Additionally, lysates prepared from yeast expressing mGCN2 were found to phosphorylate recombinant eIF-2
substrate. Mouse GCN2 activity in both the in vivo and in vitro assays required the presence of serine-51, the known regulatory phosphorylation site in eIF-2
. Together, our studies identify a new mammalian eIF-2
kinase, GCN2, that can mediate translational control.
AN important mechanism regulating protein synthesis involves phosphorylation of the
subunit of eukaryotic initiation factor-2 (eIF-2; ![]()
![]()
![]()
![]()
![]()
![]()
at residue serine-51 reduces the activity of the guanine exchange factor, eIF-2B, that recycles eIF-2-GDP to the GTP-bound form required for subsequent rounds of translation initiation. Two well-characterized protein kinases were found to inhibit general translation in mammalian cells in response to different stress conditions. RNA-dependent protein kinase (PKR) participates in the antiviral defense mechanism mediated by interferon and is proposed to function in the control of cell proliferation and apoptosis (![]()
![]()
![]()
![]()
![]()
![]()
![]()
In contrast to mammalian kinases PKR and HRI that repress global protein synthesis, the eIF-2
kinase in Saccharomyces cerevisiae, GCN2, enhances translation of a single species of mRNA, encoding GCN4 in response to starvation for amino acids (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
leads to reduced eIF-2-GTP levels, thereby reducing the inhibitory effects of the upstream ORFs and allowing for elevated GCN4 translation (![]()
![]()
![]()
by GCN2 during amino acid starvation appears to be important for delineating between a general or gene-specific translation response. Yeast cells expressing mammalian PKR or activated mutants of GCN2 display a severe slow growth phenotype due to hyperphosphorylation of eIF-2
(![]()
![]()
Activation of GCN2 protein kinase by amino acid limitation is mediated by a domain homologous to the entire sequence of histidyl-tRNA synthetase (HisRS) enzymes (![]()
![]()
![]()
![]()
![]()
. At the extreme carboxyl terminus of GCN2 is a second RNA-binding region that is required for association of GCN2 with ribosomes and is proposed to facilitate GCN2 dimerization (![]()
![]()
![]()
phosphorylation by yeast GCN2, and may assist in directing tRNA to the HisRS-related domain (![]()
![]()
![]()
Recent studies indicate that GCN2 protein kinase homologues function in translational control in Drosophila melanogaster and Neurospora crassa (![]()
![]()
![]()
kinase. Expression of dGCN2 mRNA is developmentally regulated and at later stages becomes restricted to the central nervous system (![]()
![]()
Mammalian cells starved for amino acids were found to phosphorylate eIF-2
concomitant with reduced initiation of protein synthesis (![]()
![]()
![]()
![]()
kinases HRI and PKR are not regulated by amino acid limitation and neither contain sequences related to aminoacyl-tRNA synthetases, implicating the presence of an additional mammalian eIF-2
kinase (![]()
In this report, we describe the identification and characterization of a mammalian homologue of yeast GCN2 (yGCN2). We have cloned three cDNAs encoding different isoforms of mouse GCN2 (mGCN2). The three isoforms share similar kinase and HisRS-related sequences but differ in their amino-terminal sequences. Northern blot analysis revealed expression of mGCN2 mRNA in all of the tissues examined. Interestingly, using reverse transcriptase (RT)-PCR analysis with oligonucleotide primers specific for each isoform, we found that the mGCN2
and mGCN2
isoforms were restricted to a subset of the characterized tissues. Mouse GCN2 expressed in yeast was found to phosphorylate eIF-2
at serine-51 and mediate the translational control system. In addition, the kinase and HisRS-related sequences were important for mGCN2 activity. However, in contrast with yGCN2, the catalytic activity of mGCN2 when expressed in yeast was independent of the endogenous GCN1 protein. Taken together, our studies identify a new mammalian eIF-2
kinase, mGCN2, that can mediate translational control.
| MATERIALS AND METHODS |
|---|
Cloning of mGCN2 cDNA:
The yeast GCN2 sequence was used as a query to search for related mammalian sequences in the GenBank database using the Blast program. Expressed sequence tags (ESTs) encoding portions of putative mammalian GCN2 homologues were obtained from Genome Systems (St. Louis, MO) and the sequences of the entire cDNA inserts were determined by the dideoxy method (![]()
Characterization of mGCN2 genomic DNA:
A pBeloBACII library containing genomic DNA of ES cells derived from mouse strain 129SVJ was screened for the mGCN2 gene. A 2-kb DNA probe encoding the kinase portion of the mGCN2 cDNA was radiolabeled with 32P by random-primed labeling and used in a hybridization screen of the BAC-based library (Genome Systems), and the isolated clone was further confirmed to contain the mGCN2 gene by Southern blot analysis and by direct dideoxy sequencing. The locations of introns were determined by comparing the cDNA and genomic sequences. While the lengths of the smaller introns were determined by direct sequencing, the size of larger introns was measured by PCR analysis using mouse genomic DNA template and oligonucleotides complementary to sequences flanking the intron boundaries.
Northern blot analysis:
A Northern blot containing 2 µg per lane of poly(A)+ RNA from different mouse tissues was purchased from Clontech. A 3-kb DNA fragment encoding sequences common to all three mouse GCN2 isoforms was radiolabeled with 32P by random-primed labeling and used as a probe in northern blot analysis (![]()
Analysis of mGCN2 isoform mRNA using RT-PCR:
Poly(A)+ RNA was purified from mouse brain, liver, skeletal muscle, and testis using a MicroPoly(A) Pure isolation kit (Ambion, Austin, TX). RT-PCR analysis was carried out using the Titan one tube system (Boehringer Mannheim, Indianapolis) with ~100 ng of mRNA from the indicated mouse tissue in a 50-µl volume reaction. RT was carried out for 30 min at 55° followed by heat inactivation of the reverse transcriptase and 35 cycles of PCR. DNA products were separated by electrophoresis on a 1% agarose gel and visualized by ethidium bromide staining. The primers used for analysis of the mGCN2 isoforms included RCW150, ATGGAGGATGTCACACGAGC C A G G A G A G ; RCW285, AAGTTGAGTCTGGTTGTTACACTGT; RCW244, ATACCCAGATGTAGTTCCCGAAA; and RCW201, GACCAGGTGGTACAGGGTT. Oligonucleotide RCW150 was the 3'-primer used in the RT-PCR analysis for each of the three mGCN2 isoforms. The 5'-primer used for RT-PCR analysis of mGCN2
was RCW285, complementary to sequences in the extended 5'-exon specific for the mGCN2
isoform. The 5'-primer RCW244 used for mGCN2ß, was complementary to sequences contiguous between exons one and two of mGCN2ß. RCW201, used in the RT-PCR analysis of mGCN2
, was complementary to a portion of the 314-bp exon unique to mGCN2
, located between exons one and two of mGCN2ß. The control ß-actin RT-PCR reaction was performed using the ß-actin control amplimer primers set (Clontech) that flanks an intron in the ß-actin gene.
Expression of mGCN2 in yeast:
To express mGCN2 in yeast, a 5.2-kb KpnI to XbaI fragment containing the mGCN2ß cDNA with an amino-terminal Flag tag was inserted between the corresponding sites of pYES2 (Invitrogen), generating plasmid p587. p587 is a URA3-marked high copy number plasmid that contains the mGCN2 cDNA downstream of the galactose-inducible GAL-CYC1 hybrid promoter. Mutant versions of this expression plasmid include p588 encoding mgcn2-K618M and p589 containing mgcn2-m2 with leucines substituted for Phe-1142 and Arg-1143. Plasmids p587, p588, p589, pYES2, p434 including human PKR in pEMBLyex4 vector (![]()
![]()
trp1
-63; ![]()
trp1
-63 p1098[SUI2-S51A LEU2]; ![]()
trp1
-63 gcd2
::hisG, pAV1033[GCD2-K627T, TRP1] containing the GCD2-K627T mutant allele; ![]()
), and H2683 (MATa ura3-52 ino1 gcn2
gcn1
; ![]()
Yeast transformants were either grown in patches on agar plates containing synthetic medium supplemented with 2% glucose, 2 mM leucine, 0.5 mM isoleucine, 0.5 mM valine, and 1 mM tryptophan (SD; ![]()
![]()
In vitro eIF-2
kinase assay:
Yeast cell lysates were prepared using glass beads and lysis buffer containing 1% Triton X-100, 25 mM Tris-HCl (pH 7.4), 300 mM NaCl, 1 mM CaCl2, and protease inhibitors (1 µM pepstatin, 1 µM leupeptin, 0.15 µM aprotinin, and 100 µM phenylmethylsulfonyl fluoride). Equal amounts of yeast cell lysates were precleared by the addition of protein G-agarose (Boehringer Mannheim) and centrifugation at 4°. Anti-Flag M2 monoclonal antibody (Sigma, St. Louis) was added to the lysate, and mGCN2 was immunoprecipitated with protein G-agarose. The mGCN2 immunocomplex was rinsed twice with lysis buffer, followed by two washes with a low salt buffer [140 mM NaCl, 25 mM Tris-HCl (pH 7.4), 1 mM CaCl2, and protease inhibitors] and a final wash with the kinase buffer [20 mM Tris-HCl (pH 7.9), 50 mM NaCl, 10 mM MgCl2, 1 mM dithiothreitol, and protease inhibitors]. Immunoprecipitated mGCN2 was incubated in a 15-µl solution of kinase buffer, recombinant wild-type or S51A version of eIF-2
substrate, and 10 µCi [
-32P]ATP in a final concentration of 10 µM ATP at 30° for 10 min (![]()
Immunoblot analysis of mGCN2 and eIF-2
:
Lysates prepared from yeast cells were separated by electrophoresis in a SDS-polyacrylamide gel and transferred to nitrocellulose filters. Filters were blocked in a Tris-buffered saline (TBS) solution containing 5% nonfat dry milk. To measure Flag-mGCN2 protein levels, we incubated the filters in a TBS solution containing Anti-Flag M2 murine monoclonal antibody (Sigma). Filters were washed in TBS and Flag-mGCN2-antibody complex was detected using horseradish peroxidase-labeled anti-mouse secondary antibody and chemiluminescent substrate. Immunoblots measuring eIF-2
phosphorylation were carried out using cell lysates prepared with lysis buffer supplemented with 50 mM NaF and 40 mM ß-glycerophosphate. Phosphorylated eIF-2
was visualized using affinity-purified antibody that specifically recognizes eIF-2
phosphorylation at serine-51 that was kindly provided by Dr. Gary Krause (Wayne State University; ![]()
in yeast lysates was detected by immunoblot using rabbit polyclonal antibody prepared against a polyhistidine-tagged version of yeast eIF-2
expressed and purified from E. coli.
| RESULTS |
|---|
Identification and characterization of cDNAs encoding mouse GCN2 protein kinase:
In both yeast and mammalian cells, starvation for amino acids was shown to increase the levels of eIF-2
phosphorylation. In yeast cells, this phosphorylation is mediated by the GCN2 protein kinase. To determine whether a similar kinase functions in mammalian cells, we used the yeast GCN2 sequence as a query to search the EST database in the GenBank using the Blast program. A human EST clone, accession no.
R19609, was found to encode sequences related to yGCN2 from kinase subdomain IX to the motif 1 region of the HisRS-related sequence. A second cDNA clone, accession no.
W57530, was identified from mouse that contained sequences highly similar to the HisRS-related domain of yGCN2. Sequencing of the insert of clone
W57530 revealed an ORF 638 residues in length similar to the entire HisRS-related domain. This cDNA included a stop codon and 3'-noncoding sequences ending with a poly(A) tract. To identify the 5'-portion of the mouse GCN2 sequence, we carried out multiple rounds of 5'-RACE using cDNAs derived from mouse brain mRNA. PCR products were cloned and characterized by dideoxy sequencing. To independently confirm 5'-RACE products, we carried out RT-PCR and generated cDNA products with identical length and sequence.
Interestingly, during the course of our characterization of the mGCN2 cDNAs, we found three variants that differed in their deduced amino-terminal sequences (Figure 1). As is discussed further below, these different cDNA forms, which we refer to as mGCN2
, ß, or
, appear to be derived in part by splicing variations of the mGCN2 mRNA. Furthermore, the isoform mRNAs may have different transcriptional start sites. The mGCN2ß cDNA sequence is 5230 bp in length and contains an ORF encoding a polypeptide 1648 residues in length with a predicted molecular weight of 186,000 (Figure 1 and Figure 2). Sequences 5' to this ORF contain an in-frame termination codon, indicating that the entire coding region was obtained in the mGCN2ß cDNA. The 3'-noncoding region spans 199 nucleotides and includes a putative poly(A) recognition sequence (AATAAA; Figure 2). The mGCN2
and mGCN2
cDNAs diverge from the ß form at their 5'-ends, resulting in different predicted amino-terminal sequences (Figure 2). The mGCN2
cDNA contains a unique 587-bp sequence at its 5'-end compared with mGCN2ß and
. An in-frame termination codon occurs at the site of the splicing variation, resulting in a mGCN2
ORF that begins with the initiation codon at residue position 279 of the mGCN2ß sequence (Figure 2). The predicted mGCN2
polypeptide is 1370 residues in length with a molecular weight of 155,000. The mGCN2
appears to be a product of alternative splicing compared with mGCN2ß. The mGCN2
contains a 314-bp sequence corresponding to nucleotide positions 120433 of mGCN2
cDNA (Figure 2), inserted prior to nucleotide position 342 of the ß isoform. This alters the predicted amino-terminal portion of the mGCN2
cDNA such that the first 86 amino acid residues of mGCN2ß are replaced with 8 residues unique to GCN2
(Figure 2). The predicted mGCN2
polypeptide is 1570 residues in length with a molecular weight of 178,000. We independently confirmed the identity and sequence of these three mGCN2 cDNA isoforms by RT-PCR using poly(A)+ RNA prepared from mouse brain and a 3'-oligonucleotide primer derived from sequences encoding the HisRS-related domain, and 5'-primers with sequences unique to each of the mGCN2 isoform cDNAs. We generated PCR products of the predicted size for each isoform and after sequencing we found complete identities with the cDNAs derived from 5'-RACE.
|
|
Protein kinase and HisRS-related domains are conserved between yeast, mouse, and Drosophila GCN2:
A defining feature of yGCN2 protein kinase is the HisRS-related sequences juxtaposed to the catalytic domain. Both regions are also found in all three isoforms of mGCN2 (Figure 1 and Figure 2). The kinase catalytic domain of mGCN2 is 420 residues in length and shares many features previously described for yGCN2. The mGCN2 and yGCN2 share 40% identity in their catalytic domains, including 11 residues previously identified as being present among eIF-2
kinases but absent in the majority of other eukaryotic protein kinases (Figure 1 Figure 2 Figure 3). The kinase domain region of mGCN2 is 50% identical to that of dGCN2. mGCN2, like the yeast and Drosophila kinases, contains a large insert, 135 residues in length, between kinase subdomains IV and V. Excluding the insert sequence, the kinase domain of mGCN2 is 48% identical to that of yGCN2 and 58% identical to the catalytic region of dGCN2. In subdomain V, mGCN2 contains the sequence LYIQMEYCE that was found to be conserved among yGCN2 and other eIF-2
kinases. In kinase subdomain VIII, mGCN2 contains residues Thr-898 and Thr-903, aligning with known autophosphorylation sites of yGCN2 (![]()
|
The HisRS-related domain of the yGCN2 protein kinase shares sequence similarity with the class II aminoacyl-tRNA synthetase family that contains 10 different synthetases including the bona fide HisRS enzymes (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
In addition to the catalytic and HisRS-related domains, yGCN2 contains amino-terminal sequences related to multiple subdomains of eukaryotic protein kinases (Figure 1 Figure 2 Figure 3). While this region of yGCN2 is required for in vivo and in vitro phosphorylation of eIF-2
, it is missing critical residues required for ATP binding and catalysis (![]()
![]()
![]()
.
A region rich in basic residues centered around 1560 was previously described to be important for yGCN2 association with ribosomes (![]()
![]()
![]()
Multiple forms of mouse GCN2 mRNA:
To address the molecular basis for the different mGCN2 isoforms, we isolated the mGCN2 gene. Sequencing of the mGCN2 genomic DNA and PCR analysis using oligonucleotide primers derived from the cDNA suggests a pattern of exons contributing to unique 5' regions in the mGCN2 mRNA isoforms (Figure 4). The 5'-end of the mGCN2
mRNA contains a long exon that is abbreviated in the ß and
transcripts. Elongation of this exon in GCN2
introduces multiple stop codons into the 5'-portion of the mRNA, thereby resulting in an ORF predicted to initiate just prior to the partial kinase domain (Figure 1 and Figure 2). The mGCN2
transcript contains an additional exon sequence inserted between the first and second exons of mGCN2ß (Figure 4). This exon in isoform
is spliced out along with adjacent intron sequences on either side to generate the mGCN2ß mRNA.
|
GCN2 protein kinase homologues in other higher eukaryotes:
In addition to GCN2 protein kinases in yeast, Drosophila, and mouse, a search of the GenBank database using the Blast program revealed that there are putative GCN2 homologues in humans and rat. In humans, there are numerous EST entries with >80% identity to mouse GCN2. These human EST entries span portions of the entire length of mGCN2. In addition to
R19609, a clone mentioned earlier that overlaps part of the kinase catalytic and HisRS-related sequences, AA230276 is contiguous with the partial and full kinase sequences. In the HisRS-related domain, human clone AA316106 is 93% identical with sequences centered around motif 2 and AA376437 contains the motif 2 and the Histidine B regions. EST clone AA926944 is the only entry including homology with amino-terminal sequences of mGCN2, matching sequences from residues 19 to 157 of mGCN2ß. As this sequence overlaps sections of variable splicing for mGCN2, this EST entry indicates the presence of the GCN2ß isoform in humans.
A comparison of cDNA sequences derived from rat also supports the presence of a GCN2 homologue. Rat EST AI23468 is >90% identical with mGCN2 sequences centered around subdomain I of the kinase domain and clone AI69164 encodes sequences related to the extreme carboxyl terminus of mGCN2. In Caenorhabditis elegans, a genomic clone y81G3, accession no. AL021152, contains sequences highly similar to both the kinase and HisRS-related domains of GCN2. A cDNA entry yk323a9 encodes a portion of the kinase domain of the putative C. elegans GCN2, including sequences from subdomains V to VII.
GCN2 mRNA is expressed in a variety of mouse tissues:
Similar amounts of poly(A)+ RNA extracted from different mouse tissues were analyzed by Northern blot for mGCN2 transcript levels. A radiolabeled DNA probe containing sequences common to all three mGCN2 isoforms was found to hybridize to a transcript ~5.5 kb in length in each of the eight tissues analyzed (Figure 5). Interestingly, mRNA from skeletal muscle contained a transcript species >10 kb that also hybridized to the mGCN2 probe. Following this analysis, actin mRNA levels were measured (Figure 5) and used to normalize the total mRNA levels present in each lane. The level of mGCN2 transcript in brain, liver, kidney, and testis was found to be greatest, threefold higher when compared to that in lung. Lower amounts of mGCN2 mRNA were found in heart and spleen. Human ESTs encoding GCN2 were derived from a wide variety of tissues including prostate, uterus, and neuroepithelium in addition to those tissues found to contain mGCN2 mRNA. Taken together, mGCN2 transcripts are found in a wide variety of mammalian tissues, although their relative levels vary between different cell types.
|
To address whether the mGCN2 isoforms are differentially expressed in mouse tissues, we prepared poly(A)+ RNA from brain, liver, skeletal muscle, and testis and carried out RT-PCR using 5'-oligonucleotide primers specific for each isoform in combination with a 3'-primer common to
, ß, and
transcripts (see MATERIALS AND METHODS). DNA products synthesized by RT-PCR were analyzed by agarose gel electrophoresis and visualized by ethidium bromide staining (Figure 6). In the example of GCN2ß, a DNA product with a predicted length of 555 bp was synthesized in the reactions using mRNA purified from each of the mouse organs, indicating that the GCN2ß transcript is expressed in all four tissue types. By comparison, similar RT-PCR analysis for mGCN2
indicated that there was expression in brain as well as detectable levels in testis and liver. The mGCN2
mRNA was found to be expressed only in brain and testis. A control RT-PCR reaction using ß-actin primers produced similar amounts of 840-bp product in all four tissues analyzed. The absence of any other larger-sized RT-PCR products with the ß-actin primers indicates that the poly(A)+ preparation consists of only fully spliced mRNAs. These results indicate that mGCN2 isoform mRNAs have varied patterns of expression among different mouse tissues. Given that the three isoform cDNAs have distinct sequences at their 5'-ends, these expression variations may be the result of different transcriptional start sites as well as alternative splicing.
|
Mouse GCN2 expressed in yeast inhibits growth by hyperphosphorylation of eIF-2
at serine-51:
In response to amino acid limitation in yeast, GCN2 protein kinase stimulates GCN4 translational expression and the expression of genes subject to its transcriptional control. Loss of GCN2 function renders cells growth-sensitive to the chemical inhibitor sulfometuron methyl (SM) that blocks the synthesis of the isoleucine-valine biosynthetic pathway (Figure 7A; ![]()
yeast cells leads to hyperphosphorylation of eIF-2
, resulting in impaired translation initiation and a slow growth phenotype (![]()
![]()
![]()
![]()
![]()
). Cells expressing either mGCN2 or PKR had a severe growth defect (Figure 7A). By contrast, strain H1894 transformed with either vector alone or plasmid-encoded yGCN2 showed no growth defect in the galactose-containing media. All of the H1894 transformants grew to similar levels in synthetic medium containing glucose. In parallel with these growth studies, we measured the in vivo levels of eIF-2
phosphorylation using a polyclonal antibody specific to eIF-2
phosphorylated at serine-51 by an immunoblot assay. Levels of eIF-2
phosphorylation in H1894 cells containing mGCN2 were similar to that measured for the strain expressing PKR (Figure 7B). No phosphorylation of eIF-2
was detected in H1894 containing vector alone. Similar steady-state levels of eIF-2
protein were present in each of the lysate preparations as judged by immunoblot using a polyclonal antibody that recognizes both phosphorylated and nonphosphorylated forms of eIF-2
.
|
To determine whether mGCN2 control of translation in yeast requires the serine-51 phosphorylation site of eIF-2
, we expressed the mGCN2 cDNA in strain J82 (
gcn2 SUI2-S51A) that is isogenic to H1894 and contains an alanine substitution for serine-51 in eIF-2
. Expression of either mGCN2 or PKR kinases in J82 failed to cause a slow growth phenotype in SGal medium (Figure 7A). The eIF-2
-S51A also blocked the ability of yGCN2 to provide growth resistance in the presence of SM. Therefore, mGCN2 like the other eIF-2
kinase family members requires the regulatory site, serine-51, in eIF-2
for translational control. Furthermore, ![]()
subunit of eIF-2B, rendered the guanine nucleotide exchange factor less sensitive to inhibition by phosphorylated eIF-2
. We expressed mGCN2 or human PKR in strain GP3299 (gcn2
GCD2-K627T) and found that the eIF-2B
mutation relieved the slow growth phenotype in the galactose-inducing medium (Figure 7A). Interestingly, GP3299 cells containing mGCN2 or PKR were growth-resistant on SGal medium supplemented with SM, consistent with the idea that these cells achieved sufficient reduction in eIF-2B activity to stimulate GCN4 translational expression. These results taken together indicate that mGCN2 is an eIF-2
kinase that can control translation initiation through inhibition of eIF-2B.
Mutations in the kinase domain or HisRS region impair the activity of mGCN2 expressed in yeast:
Previous studies described that mutations in either the kinase catalytic region or the HisRS-related domain of yGCN2 blocked its ability to phosphorylate eIF-2
and stimulate GCN4 translation. To delineate the importance of these sequences in mGCN2 function, we constructed two mutants, mgcn2-K618M, substituted for the invariant lysine in the kinase subdomain II, and mgcn2-m2, altered for conserved residues in motif 2 of the HisRS-related domain that were previously shown to be important for yGCN2 association with uncharged tRNA and stimulation of GCN4 expression in response to amino acid starvation. Both Flag-tagged mutant versions of mGCN2ß were expressed in yeast strain H1894 using a galactose-inducible promoter and assessed for growth as described above. No growth defect was detected in cells expressing either mGCN2 mutant grown in SGal medium, suggesting the absence of eIF-2
hyperphosphorylation as found for wild-type mGCN2 cells (Figure 7A). However, the cells expressing mgcn2-m2 were observed to grow in the galactose medium containing SM, indicating that the mgcn2-m2 mutant kinase can phosphorylate eIF-2
to levels sufficient to stimulate expression of GCN4 and its target genes. By comparison there was no growth resistance in the cells containing vector alone. As expected, the SM resistance associated with mgcn2-m2 was lost in J82 and GP3299 containing SUI2-S51A or GCD2-K627T, respectively. The mutant versions of mGCN2ß were present in the yeast cells at levels similar to that measured for wild-type kinase, as judged by an immunoblot (Figure 8).
|
To measure the in vitro eIF-2
kinase activity, lysates were prepared from the yeast strains expressing wild-type or mutant mGCN2 protein kinases or containing vector alone. The mGCN2 proteins were immunoprecipitated using Flag monoclonal antibody and protein G-agarose and incubated with recombinant yeast eIF-2
and [
-32P]ATP. Radiolabeled proteins were separated by SDS-PAGE and visualized by autoradiography. In the reaction sample containing wild-type mGCN2, we found phosphorylation of both the kinase and eIF-2
substrate (Figure 8). Phosphorylation was specific for serine-51 because we detected no phosphorylation in a similar kinase assay carried out with the eIF-2
-S51A mutant substrate. The mgcn2-K618M was defective for both autophosphorylation and eIF-2
phosphorylation. In the case of mgcn2-m2, we found lower levels of autophosphorylation compared to wild-type kinase with eIF-2
phosphorylation that was detected only in extended exposures of the X-ray film (Figure 8). This low level of kinase activity would be consistent with the ability of mgcn2-m2 to facilitate growth resistance to SM under galactose-inducing conditions. Similar levels of wild-type and the mutant versions of mGCN2 were included in the immunoprecipitation kinase assay, as measured by Coomassie staining and Flag immunoblot. We conclude that the functions of both the kinase and HisRS-related domains of mGCN2 are important for eIF-2
kinase activity and in vivo translational control.
mGCN2 functions in yeast in the absence of GCN1, a factor essential for yGCN2 stimulation of general control by eIF-2
phosphorylation:
Ancillary proteins, such as GCN1, were described to be essential for yGCN2 phosphorylation of eIF-2
in response to amino acid starvation. It was proposed that ribosome-associated GCN1 protein is involved in the interaction of yGCN2 with uncharged tRNA (![]()
![]()
gcn1
) or an isogenic strain H2511 (gcn2
) encoding wild-type GCN1. The slow growth phenotype associated with expression of mGCN2 was observed in cells grown in galactose-containing medium independent of GCN1 function (Figure 9). Additionally, the growth of mgcn2-m2-containing cells in SGalSM was also found to be similar in the presence or absence of GCN1. By comparison, deletion of GCN1 blocked the ability of yGCN2 to stimulate the general amino acid control pathway, leading to growth sensitivity to SM. These results suggest that at least in the yeast model system, the eIF-2
kinase activity of mGCN2 functions by a mechanism independent of GCN1. Elevated expression levels of mGCN2 may also contribute, in part, to the in vivo eIF-2
kinase activity that is independent of GCN1. However, the GCN1 independent phenotype is consistent with the observation that there is no sequence similarity between the ribosome association domain located in the extreme carboxyl terminus of yGCN2 and the sequences in mGCN2.
|
| DISCUSSION |
|---|
Characterization of a mammalian homologue of GCN2 protein kinase:
The protein kinase GCN2 was initially cloned from the yeast S. cerevisiae as an activator of the general amino acid control pathway in response to amino acid starvation. Previously, it was reported that nutrient deprivation in mammalian cells also alters translation initiation by elevating phosphorylation of eIF-2
. By analogy with the yeast system, this has led to the speculation that a homologue of GCN2 may carry out translational control in mammals (![]()
kinase and HisRS-related domains characteristic of the yeast GCN2 (Figure 1). Expression of mGCN2 controls translation in the yeast system by phosphorylation of eIF-2
(Figure 7). Both in vitro and in vivo analyses showed a requirement for the serine-51 regulatory site of eIF-2
for mGCN2 function. The kinase and HisRS-related domains of mGCN2 were found to be important for activity. These studies indicate that mGCN2 is a new mammalian eIF-2
kinase important for regulation of translation initiation. Additionally, conservation of the kinase catalytic domain and regulatory sequences between the yeast and mouse homologues suggests common mechanisms control eIF-2
phosphorylation by the GCN2 protein kinase. Together with PKR, HRI, and the recent characterization of pancreatic eIF-2
kinase (PEK; ![]()
![]()
. While the catalytic domains of these eIF-2
kinases share sequence and structural features distinct from other eukaryotic protein kinases, their flanking regulatory sequences are dissimilar, providing for regulation by different cellular stress signals.
Activation of mammalian eIF-2
kinases by cellular stress:
The mRNAs encoding
, ß, and
isoforms of mGCN2 were found to be differentially expressed in a variety of mouse tissues, including brain, liver, skeletal muscle, and testis (Figure 5 and Figure 6). Phosphorylation of eIF-2
and inhibition of protein synthesis was observed in many of these cell types in response to different stresses (![]()
and impaired initiation of translation (![]()
![]()
![]()
![]()
in response to purine limitation by a mechanism involving the HisRS-related sequences (![]()
Role of eIF-2
kinases in the regulation of general and gene-specific translation:
In the yeast model system, GCN2 phosphorylation of eIF-2
during amino acid limitation delays translation reinitiation but does not impact general protein synthesis (![]()
![]()
phosphorylation that occurs during starvation leads to a modest decrease in the activity of this initiation factor and reinitiation may be particularly sensitive to reductions in the levels of eIF-2 ternary complex (![]()
![]()
![]()
phosphorylation can delineate between general or gene-specific translation, yeast cells expressing constitutively active mutants of GCN2 or high levels of human PKR were found to hyperphosphorylate eIF-2
and suffer a slow growth phenotype due to reduced protein synthesis (![]()
![]()
![]()
![]()
![]()
![]()
Given our finding of a mammalian homologue for GCN2 protein kinase, it is inviting to speculate that mammalian cells may also stimulate gene-specific translation in response to phosphorylation of eIF-2
. Although a mammalian homologue of GCN4 has not yet been found, a different regulatory protein may be translationally controlled through multiple upstream ORFs in its mRNA. Numerous mammalian genes have been reported to have increased transcriptional expression in response to amino acid limitation (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Amino acid starvation also stimulates the expression of CHOP and calreticulin (![]()
![]()
. Recent work on PEK suggests that eIF-2
kinases can function as part of a larger coordinated response linking the protein synthetic and folding pathways.
In closing, GCN2 protein kinase has been identified in eukaryotic organisms, from yeast to mammals. In each of the GCN2 homologues, there is conservation of the three central regions: partial kinase, kinase catalytic, and HisRS-related sequences. We identified three isoforms of mGCN2 that result in predicted mGCN2 polypeptides with different amino-terminal sequences. While the function of the sequences in the amino terminus of GCN2 is not yet understood, the fact that the mGCN2 isoforms are differentially expressed in mouse tissues suggests a role for these sequences in the regulation of kinase activity in response to different stress conditions. An understanding of the mechanisms modulating GCN2 activity in mammalian tissues and the role of this eIF-2
kinase in the control of general and gene-specific translation awaits future genetic and biochemical analyses.
| ACKNOWLEDGMENTS |
|---|
We thank Wayne Wilson, Shuhao Zhu, and Sheree Wek for helpful discussions and comments on this manuscript, and Sherie Lewis for technical assistance. This work was supported in part by a predoctoral fellowship from the American Heart Association INN-47-409-PRER (R.S.) and U.S. Public Health Service grant GM49164 from the National Institutes of Health, and by an American Cancer Society grant RPG MBC-87806 (R.C.W.).
Manuscript received August 5, 1999; Accepted for publication October 6, 1999.
| LITERATURE CITED |
|---|
ABASTADO, J. P., P. F. MILLER, B. M. JACKSON, and A. G. HINNEBUSCH, 1991 Suppression of ribosomal reinitiation at upstream open reading frames in amino acid-starved cells forms the basis of GCN4 translational control. Mol. Cell. Biol. 11:486-496
ANDRULIS, I. L., G. W. HATFIELD, and S. M. ARFIN, 1979 Asparaginyl-tRNA aminoacylation levels and asparagine synthetase expression in cultured Chinese Hamster Ovary cells. J. Biol. Chem. 254:10629-10633
ARNEZ, J. G., D. C. HARRIS, A. MITSCHLER, B. REES, and C. S. FRANCKLYN et al., 1995 Crystal structure of histidyl-tRNA synthetase from Escherichia coli complexed with histidyl-adenylate. EMBO J. 14:4143-4155[Medline].
BARBER, G. N., R. JAGUS, E. F. MEURS, A. G. HOVANESSIAN, and M. G. KATZE, 1995 Molecular mechanisms responsible for malignant transformation by regulatory and catalytic domain variants of the interferon-induced enzyme RNA-dependent protein kinase. J. Biol. Chem. 270:17423-17428
BRANDL, C. J. and K. STRUHL, 1989 Yeast GCN4 transcriptional activator protein interacts with RNA polymerase II in vitro. Proc. Natl. Acad. Sci. USA 86:2652-2656
BRUHAT, A., C. JOUSSE, Z.-Z. WANG, D. RON, and M. FERRARA et al., 1997 Amino acid limitation induces expression of CHOP, a CCAAT/enhancer binding protein-related gene, at both transcriptional and post-transcriptional levels. J. Biol. Chem. 272:17588-17593
CESARENI, G., and J. MURRAY, 1987 Plasmid vectors carrying the replication origin of filamentous single-stranded phages, pp. 135154 in Genetic Engineering: Principles and Methods, edited by J. K. SETLOW and A. HOLLAENDER. Plenum, New York.
CHEN, J. J. and I. M. LONDON, 1995 Regulation of protein synthesis by heme-regulated eIF-2 alpha kinase. Trends Biochem. Sci. 20:105-108[Medline].
CIGAN, A. M., E. K. PABICH, L. FANG, and T. F. DONAHUE, 1989 Yeast translation initiation suppressor sui2 encodes the
subunit of eukaryotic initiation factor 2 and shares sequence identity with the human
subunit. Proc. Natl. Acad. Sci. USA 86:2784-2788
CLEMENS, M. J., 1996 Protein kinases that phosphorylate eIF2 and eIF2B, and their role in eukaryotic cell translational control, pp. 139172 in Translational Control, edited by J. W. B. HERSHEY, M. B. MATHEWS and N. SONENBERG. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
DEGRACIA, D. J., J. M. SULLIVAN, R. W. NEUMAR, S. S. ALOUSI, and K. R. HIKADE et al., 1997 Effect of brain ischemia and reperfusion on the localization of phosphorylated eukaryotic initation factor 2
. J. Cereb. Blood Flow Metab. 17:1291-1302[Medline].
DE HARO, C., R. MENDEZ, and J. SANTOYO, 1996 The eIF-2
kinases and the control of protein synthesis. FASEB J. 10:1378-1388[Abstract].
DEVER, T. E., L. FENG, R. C. WEK, A. M. CIGAN, and T. F. DONAHUE et al., 1992 Phosphorylation of initiation factor 2 alpha by protein kinase GCN2 mediates gene-specific translational control of GCN4 in yeast. Cell 68:585-596[Medline].
DEVER, T. E., J. J. CHEN, G. N. BARBER, A. M. CIGAN, and L. FENG et al., 1993 Mammalian eukaryotic initiation factor 2 alpha kinases functionally substitute for GCN2 protein kinase in the GCN4 translational control mechanism of yeast. Proc. Natl. Acad. Sci. USA 90:4616-4620
DRYSDALE, C. M., B. M. JACKSON, R. MCVEIGH, E. R. KLEBANOW, and Y. BAI et al., 1998 The GCN4p activation domain interacts specifically in vitro with RNA polymerase II holoenzyme, TFIID, and the Adap-Gcn5p coactivator complex. Mol. Cell. Biol. 18:1711-1724
FENG, G. S., K. CHONG, A. KUMAR, and B. R. WILLIAMS, 1992 Identification of double-stranded RNA-binding domains in the interferon-induced double-stranded RNA-activated p68 kinase. Proc. Natl. Acad. Sci. USA 89:5447-5451
GONG, S. S., L. GUERRINI, and C. BASILICO, 1991 Regulation of asparagine synthetase gene expression by amino acid starvation. Mol. Cell. Biol. 11:6059-6066
GUERRINI, L., S. S. GONG, K. MANGASARIAN, and C. BASILICO, 1993 cis- and trans-acting elements involved in amino acid regulation of asparagine synthetase gene expression. Mol. Cell. Biol. 13:3203-3212.
HANKS, S. K. and T. HUNTER, 1995 The eukaryotic protein kinase superfamily: kinase (catalytic) domain structure and classification. FASEB J. 9:576-596[Abstract].
HARDING, H. P., Y. ZHANG, and D. RON, 1999 Protein translation and folding are coupled by an endoplasmic-reticulum-resident kinase. Nature 397:271-274[Medline].
HEAL, R. and J. MCGIVAN, 1998 Induction of calreticulin expression in response to amino acid deprivation in Chinese hamster ovary cells. Biochem. J. 329:389-394.
HINNEBUSCH, A. G., 1992 General and pathway-specific regulatory mechanisms controlling the synthesis of amino acid biosynthetic enzymes in Saccharomyces cerevisiae, pp. 319414 in The Molecular and Cellular Biology of the Yeast Saccharomyces, edited by E. W. JONE, J. R. PRINGLE and J. R. BROACH. Cold Spring Harbor Laboratory Press, Plainview, NY.
HINNEBUSCH, A. G., 1996 Translational control of GCN4: gene-specific regulation by phosphorylation of eIF-2, pp. 199244 in Translational Control, edited by J. W. B. HERSHEY, M. B. MATHEWS and N. SONENBERG. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
HINNEBUSCH, A. G., 1997 Translational regulation of yeast GCN4. A window on factors that control initiator-tRNA binding to the ribosome. J. Biol. Chem. 272:21661-21664
HOPE, I. A. and K. STRUHL, 1986 Functional dissection of a eukaryotic transcriptional activator protein, GCN4 of yeast. Cell 46:885[Medline].
HUTSON, R. G. and M. S. KILBERG, 1994 Cloning of rat asparagine synthetase and specificity of the amino acid-dependent control of its mRNA content. Biochem. J. 304:745-750.
KAISER, C., S. MICHAELIS and A. MITCHELL, 1994 pp. 207217 in Methods in Yeast Genetics, Cold Spring Harbor Laboratory Press, Plainview, NY.
KILBERG, M. S., R. G. HUTSON, and R. O. LAINE, 1994 Amino acid-regulated gene expression in eukaryotic cells. FASEB J. 8:13-19. [Review][Abstract].
KIMBALL, S. R., D. A. ANTONETTI, R. M. BRAWLEY, and L. S. JEFFERSON, 1991 Mechanism of inhibition of peptide chain initiation by amino acid deprivation in perfused rat liver. J. Biol. Chem. 266:1969-1976
KOROMILAS, A. E., S. ROY, G. N. BARBER, M. G. KATZE, and N. SONENBERG, 1992 Malignant transformation by a mutant of the IFN-inducible dsRNA-dependent protein kinase. Science 257:1685-1689
LEE, S. B., D. RODRIGUEZ, J. R. RODRIGUEZ, and M. ESTEBAN, 1997 The apoptosis pathway triggered by the interferon-induced protein kinase PKR requires the third basic domain, initiates upstream of Bcl-2, and involves ICE-like proteases. Virology 231:81-88[Medline].
MARTON, M. J., D. CROUCH, and A. G. HINNEBUSCH, 1993 GCN1, a translational activator of GCN4 in Saccharomyces cerevisiae, is required for phosphorylation of eukaryotic translation initiation factor 2 by protein kinase GCN2. Mol. Cell. Biol. 13:3541-3556
MARTON, M. J., C. R. VAZQUEZ DE ALDANA, H. QIU, K. CHAKRABURTTY, and A. G. HINNEBUSCH, 1997 Evidence that GCN1 and GCN20, translational regulators of GCN4, function on elongating ribosomes in activation of eIF-2alpha kinase GCN2. Mol. Cell. Biol. 17:4474-4489
MCGIVAN, J. D. and M. PASTOR-ANGLADA, 1994 Regulatory and molecular aspects of mammalian amino acid transport. Biochem. J. 299:321-334. [Review].
MERRICK, W. C., and J. W. B. HERSHEY, 1996 The pathway and mechanism of eukaryotic protein synthesis, pp. 3170 in Translational Control, edited by J. W. B. HERSHEY, M. B. MATHEWS and N. SONENBERG. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
MEURS, E. F., J. GALABRU, G. N. BARBER, M. G. KATZE, and A. G. HOVANESSIAN, 1993 Tumor suppressor function of the interferon-induced double-stranded RNA-activated protein kinase. Proc. Natl. Acad. Sci. USA 90:232-236
MORAS, D., 1992 Structural and functional relationships between aminoacyl-tRNA synthetases. Trends Biochem. Sci. 17:159-164[Medline].
NATARAJAN, K., B. M. JACKSON, E. RHEE, and A. G. HINNEBUSCH, 1998 yTAFII61 has a general role in RNA polymerase II transcription and is required by GCN4p to recruit the SAGA coactivator complex. Mol. Cell 2:683-692[Medline].
OLSEN, D. S., B. JORDAN, D. CHEN, R. C. WEK, and D. R. CAVENER, 1998 Isolation of the gene encoding the Drosophila melanogaster homolog of the S. cerevisiae GCN2 eIF-2
kinase. Genetics 149:1495-1509
PAIN, V. M., 1994 Translational control during amino acid starvation. Biochimie 76:718-728. [Review][Medline].
PAVITT, G. D., W. YANG, and A. G. HINNEBUSCH, 1997 Homologous segments in three subunits of the guanine nucleotide exchange factor eIF2B mediate translational regulation by phosphorylation of eIF2. Mol. Cell. Biol. 17:1298-1313
PHOJANPELTO, P. and E. HOLTTA, 1990 Deprivation of a single amino acid induces protein synthesis-dependent increases in c-jun, c-myc, and ornithine decarboxylase mRNAs in Chinese hamster ovary cells. Mol. Cell. Biol. 10:5814-5821
POLLARD, J. W., A. R. GALPINE, and M. J. CLEMENS, 1989 A novel role for aminoacyl-tRNA synthetases in the regulation of polypeptide chain initiation. Eur. J. Biochem. 182:1-9[Medline].
PROUD, C. G., 1995 PKR: a new name and new roles. Trends Biochem. Sci. 20:217-256[Medline].
QIU, H., M. T. GARCIA-BARRIO, and A. G. HINNEBUSCH, 1998 Dimerization by translation initiation factor 2 kinase GCN2 is mediated by interactions of the C-terminal ribosome binding region and the protein kinase domain. Mol. Cell. Biol. 18:2697-2711
RAMIREZ, M., R. C. WEK, and A. G. HINNEBUSCH, 1991 Ribosome association of GCN2 protein kinase, a translational activator of the GCN4 gene of Saccharomyces cerevisiae.. Mol. Cell. Biol. 11:3027-3036
RAMIREZ, M., R. C. WEK, C. R. VAZQUEZ DE ALDANA, B. M. JACKSON, and B. FREEMAN et al., 1992 Mutations activating the yeast eIF-2 alpha kinase GCN2: isolation of alleles altering the domain related to histidyl-tRNA synthetases. Mol. Cell. Biol. 12:5801-5815
ROLFES, R. J. and A. G. HINNEBUSCH, 1993 Translation of the yeast transcriptional activator GCN4 is stimulated by purine limitation: implications for activation of the protein kinase GCN2. Mol. Cell. Biol. 13:5099-5111
ROMANO, P. R., S. R. GREEN, G. N. BARBER, M. B. MATHEWS, and A. G. HINNEBUSCH, 1995 Structural requirements for double-stranded RNA binding, dimerization, and activation of the human eIF-2 alpha kinase DAI in Saccharomyces cerevisiae.. Mol. Cell. Biol. 15:365-378
ROMANO, P. R., M. T. GARCIA-BARRIO, X. ZHANG, Q. WANG, and D. R. TAYLOR et al., 1998a Autophosphorylation in the activation loop is required for full kinase activity in vivo of human and yeast eukaryotic initiation factor 2
kinases PKR and GCN2. Mol. Cell. Biol. 18:2282-2297
ROMANO, P. R., F. ZHANG, S. L. TAN, M. T. GARCIA-BARRIO, and M. G. KATZE et al., 1998b Inhibition of double-stranded RNA-dependent protein kinase PKR by vaccinia virus E3: role of complex formation and the E3 N-terminal domain. Mol. Cell. Biol. 18:7304-7316
SAMBROOK, J., E. F. FRITSCH and T. MANIATIS, 1989 Molecular Cloning: A Laboratory Manual, pp. 7.377.52. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
SAMUEL, C. E., 1993 The eIF-2 alpha protein kinases, regulators of translation in eukaryotes from yeasts to humans. J. Biol. Chem. 268:7603-7606. [Review]
SANGER, F., S. NICKLEN, and A. R. COULSON, 1977 DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463-5467
SANTOYO, J., J. ALCALDE, R. MENDEZ, D. PULIDO, and C. DE HARO, 1997 Cloning and characterization of cDNA encoding a protein synthesis initiation factor-2
(eIF-2
) kinase from Drosophila melanogaster. J. Biol. Chem. 272:12544-12550
SATTLEGGER, E., A. G. HINNEBUSCH, and I. B. BARTHELMESS, 1998 cpc-3, the Neurospora crassa homologue of yeast GCN2, encodes a polypeptide with juxtaposed eIF-2 kinase and histidyl-tRNA synthetase-related domains required for general amino acid control. J. Biol. Chem. 273:20404-20416
SCORSONE, K. A., R. PANNIERS, A. G. ROWLANDS, and E. C. HENSHAW, 1987 Phosphorylation of eukaryotic initiation factor 2 during physiological stresses which affect protein synthesis. J. Biol. Chem. 262:14538-14543
SHI, Y., K. M. VATTEM, R. SOOD, J. AN, and J. LIANG et al., 1998 Identification and characterization of pancreatic eukaryotic initiation factor 2
-subunit kinase, PEK, involved in translation control. Mol. Cell. Biol. 18:7499-7509
SRIVASTAVA, S. P., K. U. KUMAR, and R. J. KAUFMAN, 1998 Phosphorylation of eukaryotic initiation factor 2 mediates apoptosis in response to activation of the double-stranded RNA-dependent protein kinase. J. Biol. Chem. 273:2416-2423
VAZQUES DE ALDANA, C. R., M. J. MARTON, and A. G. HINNEBUSCH, 1995 GCN20, a novel ATP binding cassette protein, and GCN1 reside in a complex that mediates activation of the eIF-2
kinase GCN2 in amino acid-starved cells. EMBO J. 14:3184-3199[Medline].
VOGT, P. K., T. J. BOS, and R. F. DOOLITTLE, 1987 Homology between the DNA-binding domain of the GCN4 regulatory protein of yeast and the carboxyl-terminal region of a protein coded for by the oncogene jun. Proc. Natl. Acad. Sci. USA 84:3316
WEK, R. C., 1994 eIF-2 kinases: regulators of general and gene-specific translation initiation. Trends Biochem. Sci. 19:491-496. [Review][Medline].
WEK, R. C., B. M. JACKSON, and A. G. HINNEBUSCH, 1989 Juxtaposition of domains homologous to protein kinases and histidyl-tRNA synthetases in GCN2 protein suggests a mechanism for coupling GCN4 expression to amino acid availability. Proc. Natl. Acad. Sci. USA 86:4579-4583
WEK, R. C., M. RAMIREZ, B. M. JACKSON, and A. G. HINNEBUSCH, 1990 Identification of positive-acting domains in GCN2 protein kinase required for translational activation of GCN4 expression. Mol. Cell. Biol. 10:2820-2831
WEK, S. A., S. ZHU, and R. C. WEK, 1995 The histidyl-tRNA synthetase-related sequence in eIF-2 alpha protein kinase GCN2 interacts with tRNA and is required for activation in response to starvation for different amino acids. Mol. Cell. Biol. 15:4497-4506
ZHU, S. and R. C. WEK, 1998 Ribosome binding domain of eukaryotic initiation factor-2 kinase GCN2 facilitates translation control. J. Biol. Chem. 273:1808-1814
ZHU, S., A. Y. SOBOLEV, and R. C. WEK, 1996 Histidyl-tRNA synthetase-related sequences in GCN2 protein kinase regulate in vitro phosphorylation of eIF-2. J. Biol. Chem. 271:24989-24994
ZHU, S., P. R. ROMANO, and R. C. WEK, 1997 Ribosome targeting of PKR is mediated by two double-stranded RNA-binding domains and facilitates in vivo phosphorylation of eukaryotic initiation factor-2. J. Biol. Chem. 272:14434-14441
This article has been cited by other articles:
![]() |
W. Lu, C. F. Laszlo, Z. Miao, H. Chen, and S. Wu The Role of Nitric-oxide Synthase in the Regulation of UVB Light-induced Phosphorylation of the {alpha} Subunit of Eukaryotic Initiation Factor 2 J. Biol. Chem., September 4, 2009; 284(36): 24281 - 24288. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. N. Dang Do, S. R. Kimball, D. R. Cavener, and L. S. Jefferson eIF2{alpha} kinases GCN2 and PERK modulate transcription and translation of distinct sets of mRNAs in mouse liver Physiol Genomics, August 7, 2009; 38(3): 328 - 341. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. B. DuRose, D. Scheuner, R. J. Kaufman, L. I. Rothblum, and M. Niwa Phosphorylation of Eukaryotic Translation Initiation Factor 2{alpha} Coordinates rRNA Transcription and Translation Inhibition during Endoplasmic Reticulum Stress Mol. Cell. Biol., August 1, 2009; 29(15): 4295 - 4307. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. P. Cobbold, E. Adams, C. A. Farquhar, K. F. Nolan, D. Howie, K. O. Lui, P. J. Fairchild, A. L. Mellor, D. Ron, and H. Waldmann Infectious tolerance via the consumption of essential amino acids and mTOR signaling PNAS, July 21, 2009; 106(29): 12055 - 12060. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. M. Tsoi, A. G. Beckhouse, C. L. Gelling, M. J. Raftery, J. Chiu, A. M. Tsoi, L. Lauterbach, P. J. Rogers, V. J. Higgins, and I. W. Dawes Essential Role of One-carbon Metabolism and Gcn4p and Bas1p Transcriptional Regulators during Adaptation to Anaerobic Growth of Saccharomyces cerevisiae J. Biol. Chem., April 24, 2009; 284(17): 11205 - 11215. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Carra, J. F. Brunsting, H. Lambert, J. Landry, and H. H. Kampinga HspB8 Participates in Protein Quality Control by a Non-chaperone-like Mechanism That Requires eIF2{alpha} Phosphorylation J. Biol. Chem., February 27, 2009; 284(9): 5523 - 5532. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Su and M. S. Kilberg C/EBP Homology Protein (CHOP) Interacts with Activating Transcription Factor 4 (ATF4) and Negatively Regulates the Stress-dependent Induction of the Asparagine Synthetase Gene J. Biol. Chem., December 12, 2008; 283(50): 35106 - 35117. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Wang, B. D. Fonseca, H. Tang, R. Liu, A. Elia, M. J. Clemens, U.-A. Bommer, and C. G. Proud Re-evaluating the Roles of Proposed Modulators of Mammalian Target of Rapamycin Complex 1 (mTORC1) Signaling J. Biol. Chem., November 7, 2008; 283(45): 30482 - 30492. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Gjymishka, S. S. Palii, J. Shan, and M. S. Kilberg Despite Increased ATF4 Binding at the C/EBP-ATF Composite Site following Activation of the Unfolded Protein Response, System A Transporter 2 (SNAT2) Transcription Activity Is Repressed in HepG2 Cells J. Biol. Chem., October 10, 2008; 283(41): 27736 - 27747. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Dardevet, S. R Kimball, L. S Jefferson, A. D Cherrington, D. Remond, C. A DiCostanzo, and M. C. Moore Portal infusion of amino acids is more efficient than peripheral infusion in stimulating liver protein synthesis at the same hepatic amino acid load in dogs Am. J. Clinical Nutrition, October 1, 2008; 88(4): 986 - 996. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Niknejad, M. Morley, and J. Dimitroulakos Activation of the Integrated Stress Response Regulates Lovastatin-induced Apoptosis J. Biol. Chem., October 12, 2007; 282(41): 29748 - 29756. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Chaturvedi, M. Asim, N. D. Lewis, H. M. S. Algood, T. L. Cover, P. Y. Kim, and K. T. Wilson L-Arginine Availability Regulates Inducible Nitric Oxide Synthase-Dependent Host Defense against Helicobacter pylori Infect. Immun., September 1, 2007; 75(9): 4305 - 4315. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Silva, D. Wang, A. A. Komar, B. A. Castilho, and B. R. G. Williams Salicylates Trigger Protein Synthesis Inhibition in a Protein Kinase R-like Endoplasmic Reticulum Kinase-dependent Manner J. Biol. Chem., April 6, 2007; 282(14): 10164 - 10171. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. K. Padyana, H. Qiu, A. Roll-Mecak, A. G. Hinnebusch, and S. K. Burley Structural Basis for Autoinhibition and Mutational Activation of Eukaryotic Initiation Factor 2{alpha} Protein Kinase GCN2 J. Biol. Chem., August 12, 2005; 280(32): 29289 - 29299. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Pereira, E. Sattlegger, H.-Y. Jiang, B. M. Longo, C. B. Jaqueta, A. G. Hinnebusch, R. C. Wek, L. E. A. M. Mello, and B. A. Castilho IMPACT, a Protein Preferentially Expressed in the Mouse Brain, Binds GCN1 and Inhibits GCN2 Activation J. Biol. Chem., August 5, 2005; 280(31): 28316 - 28323. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Hao, J. W. Sharp, C. M. Ross-Inta, B. J. McDaniel, T. G. Anthony, R. C. Wek, D. R. Cavener, B. C. McGrath, J. B. Rudell, T. J. Koehnle, et al. Uncharged tRNA and Sensing of Amino Acid Deficiency in Mammalian Piriform Cortex Science, March 18, 2005; 307(5716): 1776 - 1778. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Inoki, H. Ouyang, Y. Li, and K.-L. Guan Signaling by Target of Rapamycin Proteins in Cell Growth Control Microbiol. Mol. Biol. Rev., March 1, 2005; 69(1): 79 - 100. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Boyce, K. F. Bryant, C. Jousse, K. Long, H. P. Harding, D. Scheuner, R. J. Kaufman, D. Ma, D. M. Coen, D. Ron, et al. A Selective Inhibitor of eIF2{alpha} Dephosphorylation Protects Cells from ER Stress Science, February 11, 2005; 307(5711): 935 - 939. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Gomez, M. L. Powell, I. C. Greenman, and T. P. Herbert Glucose-stimulated Protein Synthesis in Pancreatic {beta}-Cells Parallels an Increase in the Availability of the Translational Ternary Complex (eIF2-GTP{middle dot}Met-tRNAi) and the Dephosphorylation of eIF2{alpha} J. Biol. Chem., December 24, 2004; 279(52): 53937 - 53946. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Zhan, J. Narasimhan, and R. C. Wek Differential Activation of eIF2 Kinases in Response to Cellular Stresses in Schizosaccharomyces pombe Genetics, December 1, 2004; 168(4): 1867 - 1875. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. G. Anthony, B. J. McDaniel, R. L. Byerley, B. C. McGrath, D. R. Cavener, M. A. McNurlan, and R. C. Wek Preservation of Liver Protein Synthesis during Dietary Leucine Deprivation Occurs at the Expense of Skeletal Muscle Mass in Mice Deleted for eIF2 Kinase GCN2 J. Biol. Chem., August 27, 2004; 279(35): 36553 - 36561. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Wu, M. Tan, Y. Hu, J.-L. Wang, D. Scheuner, and R. J. Kaufman Ultraviolet Light Activates NF{kappa}B through Translational Inhibition of I{kappa}B{alpha} Synthesis J. Biol. Chem., August 13, 2004; 279(33): 34898 - 34902. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Anderson, K. Phillips, G. Stoecklin, and N. Kedersha Post-transcriptional regulation of proinflammatory proteins J. Leukoc. Biol., July 1, 2004; 76(1): 42 - 47. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Klann, M. D. Antion, J. L. Banko, and L. Hou Synaptic Plasticity and Translation Initiation Learn. Mem., July 1, 2004; 11(4): 365 - 372. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. W. Gietzen, C. M. Ross, S. Hao, and J. W. Sharp Phosphorylation of eIF2{alpha} Is Involved in the Signaling of Indispensable Amino Acid Deficiency in the Anterior Piriform Cortex of the Brain in Rats J. Nutr., April 1, 2004; 134(4): 717 - 723. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-Y. Jiang, S. A. Wek, B. C. McGrath, D. Lu, T. Hai, H. P. Harding, X. Wang, D. Ron, D. R. Cavener, and R. C. Wek Activating Transcription Factor 3 Is Integral to the Eukaryotic Initiation Factor 2 Kinase Stress Response Mol. Cell. Biol., February 1, 2004; 24(3): 1365 - 1377. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Fernandez, A. B. Lopez, C. Wang, R. Mishra, L. Zhou, I. Yaman, M. D. Snider, and M. Hatzolgou Transcriptional Control of the Arginine/Lysine Transporter, Cat-1, by Physiological Stress J. Biol. Chem., December 12, 2003; 278(50): 50000 - 50009. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. B. Cullinan, D. Zhang, M. Hannink, E. Arvisais, R. J. Kaufman, and J. A. Diehl Nrf2 Is a Direct PERK Substrate and Effector of PERK-Dependent Cell Survival Mol. Cell. Biol., October 15, 2003; 23(20): 7198 - 7209. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-Y. Jiang, S. A. Wek, B. C. McGrath, D. Scheuner, R. J. Kaufman, D. R. Cavener, and R. C. Wek Phosphorylation of the {alpha} Subunit of Eukaryotic Initiation Factor 2 Is Required for Activation of NF-{kappa}B in Response to Diverse Cellular Stresses Mol. Cell. Biol., August 15, 2003; 23(16): 5651 - 5663. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. S. Jefferson and S. R. Kimball Amino Acids as Regulators of Gene Expression at the Level of mRNA Translation J. Nutr., June 1, 2003; 133(6): 2046S - 2051. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. van Huizen, J. L. Martindale, M. Gorospe, and N. J. Holbrook P58IPK, a Novel Endoplasmic Reticulum Stress-inducible Protein and Potential Negative Regulator of eIF2alpha Signaling J. Biol. Chem., April 25, 2003; 278(18): 15558 - 15564. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Shi, S. I. Taylor, S.-L. Tan, and N. Sonenberg When Translation Meets Metabolism: Multiple Links to Diabetes Endocr. Rev., February 1, 2003; 24(1): 91 - 101. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Zhang, B. C. McGrath, J. Reinert, D. S. Olsen, L. Lei, S. Gill, S. A. Wek, K. M. Vattem, R. C. Wek, S. R. Kimball, et al. The GCN2 eIF2{alpha} Kinase Is Required for Adaptation to Amino Acid Deprivation in Mice Mol. Cell. Biol., October 1, 2002; 22(19): 6681 - 6688. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. Bain, R. LeBlanc-Chaffin, H. Chen, S. S. Palii, K. M. Leach, and M. S. Kilberg The Mechanism for Transcriptional Activation of the Human ATA2 Transporter Gene by Amino Acid Deprivation is Different than That for Asparagine Synthetase J. Nutr., October 1, 2002; 132(10): 3023 - 3029. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Garcia-Barrio, J. Dong, V. A. Cherkasova, X. Zhang, F. Zhang, S. Ufano, R. Lai, J. Qin, and A. G. Hinnebusch Serine 577 Is Phosphorylated and Negatively Affects the tRNA Binding and eIF2alpha Kinase Activities of GCN2 J. Biol. Chem., August 16, 2002; 277(34): 30675 - 30683. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Y. Wu, D. C. Tkachuck, R. S. Roberson, and W. H. Schubach The Human SNF5/INI1 Protein Facilitates the Function of the Growth Arrest and DNA Damage-inducible Protein (GADD34) and Modulates GADD34-bound Protein Phosphatase-1 Activity J. Biol. Chem., July 26, 2002; 277(31): 27706 - 27715. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. S. Kilberg and I. P. Barbosa-Tessmann Genomic Sequences Necessary for Transcriptional Activation by Amino Acid Deprivation of Mammalian Cells J. Nutr., July 1, 2002; 132(7): 1801 - 1804. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Zhang, B. McGrath, S.'a. Li, A. Frank, F. Zambito, J. Reinert, M. Gannon, K. Ma, K. McNaughton, and D. R. Cavener The PERK Eukaryotic Initiation Factor 2{alpha} Kinase Is Required for the Development of the Skeletal System, Postnatal Growth, and the Function and Viability of the Pancreas Mol. Cell. Biol., June 1, 2002; 22(11): 3864 - 3874. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Ma, K. M. Vattem, and R. C. Wek Dimerization and Release of Molecular Chaperone Inhibition Facilitate Activation of Eukaryotic Initiation Factor-2 Kinase in Response to Endoplasmic Reticulum Stress J. Biol. Chem., May 17, 2002; 277(21): 18728 - 18735. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. Kimball Regulation of Global and Specific mRNA Translation by Amino Acids J. Nutr., May 1, 2002; 132(5): 883 - 886. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kebache, D. Zuo, E. Chevet, and L. Larose Modulation of protein translation by Nck-1 PNAS, April 16, 2002; 99(8): 5406 - 5411. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Fernandez, B. Bode, A. Koromilas, J. A. Diehl, I. Krukovets, M. D. Snider, and M. Hatzoglou Translation Mediated by the Internal Ribosome Entry Site of the cat-1 mRNA Is Regulated by Glucose Availability in a PERK Kinase-dependent Manner J. Biol. Chem., March 29, 2002; 277(14): 11780 - 11787. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. G. Hinnebusch and K. Natarajan Gcn4p, a Master Regulator of Gene Expression, Is Controlled at Multiple Levels by Diverse Signals of Starvation and Stress Eukaryot. Cell, February 1, 2002; 1(1): 22 - 32. [Full Text] [PDF] |
||||
![]() |
F. Siu, C. Chen, C. Zhong, and M. S. Kilberg CCAAT/Enhancer-binding Protein-beta Is a Mediator of the Nutrient-sensing Response Pathway That Activates the Human Asparagine Synthetase Gene J. Biol. Chem., December 14, 2001; 276(51): 48100 - 48107. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Lu, A.-P. Han, and J.-J. Chen Translation Initiation Control by Heme-Regulated Eukaryotic Initiation Factor 2alpha Kinase in Erythroid Cells under Cytoplasmic Stresses Mol. Cell. Biol., December 1, 2001; 21(23): 7971 - 7980. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. G. Anthony, A. K. Reiter, J. C. Anthony, S. R. Kimball, and L. S. Jefferson Deficiency of dietary EAA preferentially inhibits mRNA translation of ribosomal proteins in liver of meal-fed rats Am J Physiol Endocrinol Metab, September 1, 2001; 281(3): E430 - E439. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. S. Jefferson and S. R. Kimball Amino Acid Regulation of Gene Expression J. Nutr., September 1, 2001; 131(9): 2460S - 2466. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Novoa, H. Zeng, H. P. Harding, and D. Ron Feedback Inhibition of the Unfolded Protein Response by GADD34-Mediated Dephosphorylation of eIF2{alpha} J. Cell Biol., May 28, 2001; 153(5): 1011 - 1022. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. L. Erickson, J. Nika, S. Rippel, and E. M. Hannig Minimum Requirements for the Function of Eukaryotic Translation Initiation Factor 2 Genetics, May 1, 2001; 158(1): 123 - 132. [Abstract] [Full Text] |
||||
![]() |
A. J. Entingh, B. K. Law, and H. L. Moses Induction of the C/EBP Homologous Protein (CHOP) by Amino Acid Deprivation Requires Insulin-Like Growth Factor I, Phosphatidylinositol 3-Kinase, and Mammalian Target of Rapamycin Signaling Endocrinology, January 1, 2001; 142(1): 221 - 228. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Crosby, P. J. Chefalo, I. Yeh, S. Ying, I. M. London, P. Leboulch, and J.-J. Chen Regulation of hemoglobin synthesis and proliferation of differentiating erythroid cells by heme-regulated eIF-2alpha kinase Blood, November 1, 2000; 96(9): 3241 - 3248. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Yang, S. A. Wek, and R. C. Wek Glucose Limitation Induces GCN4 Translation by Activation of Gcn2 Protein Kinase Mol. Cell. Biol., April 15, 2000; 20(8): 2706 - 2717. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kubota, Y. Sakaki, and T. Ito GI Domain-mediated Association of the Eukaryotic Initiation Factor 2alpha Kinase GCN2 with Its Activator GCN1 Is Required for General Amino Acid Control in Budding Yeast J. Biol. Chem., June 30, 2000; 275(27): 20243 - 20246. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. K. Tyzack, X. Wang, G. J. Belsham, and C. G. Proud ABC50 Interacts with Eukaryotic Initiation Factor 2 and Associates with the Ribosome in an ATP-dependent Manner J. Biol. Chem., October 27, 2000; 275(44): 34131 - 34139. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Nika, W. Yang, G. D. Pavitt, A. G. Hinnebusch, and E. M. Hannig Purification and Kinetic Analysis of eIF2B from Saccharomyces cerevisiae J. Biol. Chem., August 18, 2000; 275(34): 26011 - 26017. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. D. Williams, G. D. Pavitt, and C. G. Proud Characterization of the Initiation Factor eIF2B and Its Regulation in Drosophila melanogaster J. Biol. Chem., February 2, 2001; 276(6): 3733 - 3742. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. J. Smith, I. Marie, A. Prakash, A. Garcia-Sastre, and D. E. Levy IRF3 and IRF7 Phosphorylation in Virus-infected Cells Does Not Require Double-stranded RNA-dependent Protein Kinase R or Ikappa B Kinase but Is Blocked by Vaccinia Virus E3L Protein J. Biol. Chem., March 16, 2001; 276(12): 8951 - 8957. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Fernandez, I. Yaman, W. C. Merrick, A. Koromilas, R. C. Wek, R. Sood, J. Hensold, and M. Hatzoglou Regulation of Internal Ribosome Entry Site-mediated Translation by Eukaryotic Initiation Factor-2alpha Phosphorylation and Translation of a Small Upstream Open Reading Frame J. Biol. Chem., January 11, 2002; 277(3): 2050 - 2058. [Abstract] [Full Text] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Sood, R.
- Articles by Wek, R. C.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Sood, R.
- Articles by Wek, R. C.




























