- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Shibata, Y.
- Articles by Takagi, S.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Shibata, Y.
- Articles by Takagi, S.
EAT-20, a Novel Transmembrane Protein With EGF Motifs, Is Required for Efficient Feeding in Caenorhabditis elegans
Yukimasa Shibataa, Takashi Fujiia, Joseph A. Dentb, Hajime Fujisawaa,c, and Shin Takagiba Division of Biological Science, Nagoya University Graduate School of Science, Chikusa-ku, Nagoya 464-8602, Japan,
b Department of Biology, McGill University, Montreal, Quebec H3A 1B1, Canada
c Research Area CREST (Core Research for Evolutional Science and Technology), Japan Science and Technology Corporation, 2-6-15, Shiba Park, Minato-ku, Tokyo 105-0011, Japan
Corresponding author: Shin Takagi, Division of Biological Science, Nagoya University Graduate School of Science, Furo-cho, Chikusa-ku, Nagoya 464-8602, Japan., i45116a{at}nucc.cc.nagoya-u.ac.jp (E-mail)
Communicating editor: R. K. HERMAN
| ABSTRACT |
|---|
The pharynx of Caenorhabditis elegans is a neuromuscular organ responsible for feeding, concentrating food by its pumping movement. A class of mutants, the eat mutants, are defective in this behavior. We have identified a novel eat gene, eat-20, encoding a unique transmembrane protein with three EGF motifs. Staining with a specific polyclonal antibody reveals that EAT-20 is expressed predominantly in the pharyngeal muscles and a subset of neurons. Some hypodermal cells also express EAT-20. eat-20 mutant animals are starved, have smaller brood sizes, and have prolonged egg-laying periods. The starvation apparently results from pharyngeal pumping defects, including a reduced pumping rate and "slippery pumping," in which the contents of the pharynx sometimes move rostrally. However, electrical activity of eat-20 mutants appears normal by electropharyngeogram.
THE behavior of animals rests on the proper development and function of neuromuscular systems, which in turn requires the proper function of many genes in the nervous system and muscles. Genetics has been an important tool for studying the molecular basis of cell functions and for establishing correlations between cellular function and organismic function.
For understanding the molecular basis of a behavior, the pharynx of Caenorhabditis elegans offers several advantages. The behavior of the pharynx is very simple. It consists of two motions, pumping and isthmus peristalsis (![]()
![]()
![]()
The function of the pharyngeal nervous system has been examined by laser ablation experiments. A motor neuron, M4, is essential for isthmus peristalsis and, consequently, for growth (![]()
![]()
![]()
![]()
![]()
![]()
Combined with these methods, genetical analyses have revealed the functions of individual genes affecting the pharynx. Mutants that show abnormal feeding behavior have been isolated and studied. eat-4 (![]()
![]()
![]()
![]()
Here we report the identification and characterization of a novel eat gene, eat-20, encoding a unique cell membrane protein with EGF motifs. The spatio-temporal pattern of the expression of eat-20 was examined by reporter-gene expression, in situ hybridization, and immunostaining and was found to be primarily in the pharynx. eat-20 mutants showed slow and slippery pumping and a starved appearance. Defects of eat-20 mutants in tissues besides the pharynx were also examined.
| MATERIALS AND METHODS |
|---|
Strains:
Wild-type worms were C. elegans variety Bristol, strain N2. Basic methods for worm culture and genetics were performed as described by ![]()
![]()
-rays. Other strains used in this work are SP273 [mnDp1(X;V)/ +; mnDf13 X], DA572 [eat-4(ad572) III], DA467 [eat-6(ad467) V], DA599 [eat-8(ad599) III], DA606 [eat-10 (ad606)I V], DA541 [eat-11(ad541) I], DA522 [eat-13(ad522) X], DA707 [eat-17(ad707) X].
Construction and screen of the promoter trap libraries:
Promoter trap libraries were constructed and screened as described by ![]()
![]()
Cloning and sequencing of cDNA and genomic DNA of eat-20:
Partial determination of the sequence of the insert of p5E5 revealed that the 7-kb insert contains two individual genomic fragments: a 5-kb fragment from LGX and a 2-kb fragment from LGV. The 5-kb fragment at the 3' side of the insert, which was later shown to include 3-kb upstream to the translation initiation codon and exons 28 for the eat-20 gene, was used for the hybridization probe for cDNA filters. cDNA filters and cDNA clones yk6f1 and yk16h2 were provided by Dr. Yuji Kohara. The 5' end of the eat-20 cDNA was amplified by PCR using cDNAs reverse-transcribed from poly(A)+ RNA isolated from mixed-stage wild-type animals as templates. The PCR was performed using the SL1-specific primer SL1ERI (GGAATTCCGTTTAATTACCCAAGTTTGAG) and the gene-specific primer 5E5'3 (GGAATTCGCAACAAACTGCCACATA) using a Gene Amp PCR System 9600 (Perkin Elmer, Norwalk, CT) under the following conditions: 1 cycle at 94° for 20 sec and 35 cycles at 94° for 60 sec, 50° for 120 sec, 68° for 120 sec. DNA sequences were determined for both strands. The nucleotide sequence data reported in this article will appear in the DDBJ/EMBL/GenBank nucleotide sequence databases with the accession nos.
AB032748 and
AB032749 for eat-20a and eat-20b, respectively.
EAT-20 antibody production and other immunological methods:
The DNA fragment corresponding to nucleotides 3591281 of the eat-20 cDNA was cloned into the maltose binding protein (MBP) bacterial expression vector, pMAL-c2 (New England Biolabs, Beverly, MA), and transformed into an Escherichia coli strain, BL21 (Figure 1D). The 75-kD fusion protein was purified four times by affinity binding to an amylose resin. A guinea pig (Chubu-kagaku-shizai, Hamamatu, Japan) was immunized primarily with the protein (2 mg) emulsified with Titermax (CytRx) and then with the same amount of the protein emulsified with Freund's incomplete adjuvant (Difco, Detroit) every 2 wk for 6 wk. The serum was absorbed with E. coli extract and MBP, and the antibodies were purified by affinity chromatography with the antigen bound to CNBr-activated Sepharose 4B (Pharmacia, Piscataway, NJ).
|
For immunostaining, worms were freeze-cracked on slides as described by ![]()
GFP expression analysis of eat-20:
We examined the GFP expression in ncIs1 hermaphrodites carrying p5E5 as a stable integrated transgenic array. Though p5E5 contains a 2-kb genomic fragment derived from LGV at the 5' side in addition to the fragment corresponding to the eat-20 gene, we confirmed that an extrachromosomal array of p5E5 and that of p5E5del, in which the 2-kb fragment was deleted, gave the same GFP expression pattern (data not shown). Thus, the fragment at the 5' part of the insert had no effects on the expression of GFP. Neurons expressing GFP were first identified in L1 larvae based on the position of their soma according to ![]()
![]()
In situ hybridization of whole-mounted worms:
Digoxigenin (DIG)-11-dUTP-labeled single strand RNA probes were synthesized by using cDNA yk6f1 as a template according to the manufacturer's instructions (Boehringer-Mannheim, Indianapolis). In situ hybridization was performed according to ![]()
Isolation of insertion and deletion mutant animals:
We performed Tc1 transposon-mediated deletion mutagenesis using the mutator strain MT3126. A Tc1-insertion mutant animal and deletion mutant animals were isolated according to the protocol of ![]()
To detect Tc1 insertion, nested PCR was performed. The first PCR was performed using the two Tc1-specific primers Tc1A (AGCCAGCTACAATGGCTTTC) and Tc1B (GATGCAAACGGATACGCGAC), and the eat-20 specific primer 5E5-1 (TCTCTTAACGGTGGCTAACC) under the following conditions: one cycle at 94° for 120 sec and 26 cycles of three temperatures (94°, 12 sec; 55°, 12 sec; 72°, 120 sec). The second PCR was performed using the Tc1-specific primers Tc1C (CCAAACAAATCCAGTGCAAC) or Tc1D (TGTCATTTCCTTGCAACCTC), and the eat-20 specific primer 5E5-2 (CTATCGCTTCGAGGAAGTCG) under the same conditions as the first PCR. To confirm Tc1 insertion, positive pools were examined by PCR, using the eat-20 specific primer 5E5-3 (TTGTGACATTCGTGGTTGGC) and Tc1A in the first PCR and primers 5E5-5 (ATCACGCTAATGTTCCAAGAAG) and Tc1C in the second PCR. After screening 40,000 animals, we detected and isolated a Tc1-insertion allele, nc2::Tc1 (Figure 1C).
Since homozygous eat-20 (nc2::Tc1) expressed EAT-20 normally as revealed by immunoblot (Figure 1F) and immunostaining analyses (data not shown), we screened nc2::Tc1 by PCR in an attempt to detect deletion mutations that arose after imprecise transposon excision (![]()
![]()
Pumping assay:
Pumping rate was assayed according to ![]()
Trapping and transport of the content of the pharynx was assayed as follows. Several drops of mineral oil were added to a nematode growth medium plate with bacteria. Ten adult worms were transferred to the plate. Pharyngeal pumping was filmed with a Zeiss Axioplan2 microscope, Zeiss 3CCD video camera system ZVS-3C75DE, and a Toshiba videocassette recorder A-J3. The specimen in which the pharynx had only a single droplet of mineral oil was chosen. The movement of a droplet was analyzed by tracing its position in each frame.
Electropharyngeograms:
Electropharyngeograms were recorded according to ![]()
Measurement of body length:
The L4 animals, staged at 40 hr of development according to their vulval morphology (![]()
Intestinal autofluorescence:
Adult animals, prepared as described in Measurement of body length, were observed under an epifluorescent microscope (Axioplan, Zeiss) with the filter system 02.
Egg-laying period:
The L4 animals staged at 40 hr of development were picked individually and transferred to fresh plates at 24-hr intervals, and the fertilized eggs laid in a 24-hr period were counted.
Rescue experiments with fosmids:
Fosmid H30A04 containing the eat-20 gene (20 µg/ml) was mixed with the plasmids H20 (20 µg/ml) and Bluescript (160 µg/ml; Stratagene, La Jolla, CA), and was injected into the gonad of mutant animals. H20, which expresses GFP in the entire nervous system, was provided by Dr. Takeshi Ishihara and was used as a transformation marker. The transformants expressing GFP were picked under a fluorescent dissection microscope, MZ APO (Leica).
Complementation tests against eat-17:
The following results indicated that eat-20 is distinct from eat-17, which was mapped to a similar position on LGX (Figure 1A). First, hermaphrodites trans-heterozygous for nc4 and eat-17 (ad707), or nc6 and eat-17 (ad707) were indistinguishable from wild-type animals (data not shown). Second, fosmid H30A04 did not rescue the starved appearance of ad707 (data not shown).
Construction of nc4/mnDf13 hermaphrodite:
eat-20(nc4) males were crossed to a single hermaphrodite of genotype mnDp1(X;V)/+: mnDf13 X. From plates containing F1 males, F1 hermaphrodites younger than the F1 males were transferred individually to fresh plates and their F2 progeny were analyzed under a dissection microscope. Because worms homozygous for mnDp1 are sterile, the F1's that did not segregate sterile F2's should have the genotype +/+V; mnDf13/eat-20(nc4) X. These F1's had severely starved appearance and produced worms with severely starved appearance, worms with mildly starved appearance, and dead embryos, which are presumably homozygous for mnDf13. The phenotypes of 174 F2 progeny scored were 34 dead embryos, 61 severely starved worms, 45 mildly starved worms, and 34 worms that disappeared during the culture. The worms that disappeared may have left the agar, because some dried-up worms were observed on the wall of the plates. They may be starved worms, which are known to leave agar (![]()
| RESULTS |
|---|
Mapping of the eat-20 gene and structural analyses of eat-20 cDNA:
By promoter trapping, we identified a genomic fragment driving expression of reporter gfp in the pharynx and a subset of neurons. By sequence analysis, a 5-kb fragment in the insert of promoter trap clone p5E5 was placed on fosmid H30A04 corresponding to the right arm of the X chromosome. The fragment contained a part of a gene and its 5' flanking region (Figure 1C). We named this gene eat-20 based on the phenotype caused by the disruption of the gene (see below).
On cDNA filters, the fragment in p5E5 hybridized to cDNA clones yk6f1 and yk16h2. By 5'RACE, we were able to amplify the functional 5' end of the cDNA using a primer specific to the splicing leader SL1, but not with a primer specific to SL2 (Figure 1B). A comparison of the genomic sequence of H30A04 and the sequences of the cDNAs showed that the eat-20 gene consisted of 15 exons (including SL1; Figure 1C). eat-20 is located from nucleotide 6579 to 13,863 of H30A04. In the overlapping region, the sequences of yk6f1 and yk16h2 were identical except that yk16h2 contained 6 extra nucleotides between nucleotides 2253 and 2254. This insertion site corresponded to the 5' end of exon 13, indicating that the insertion is caused by an alternative splice junction.
The cDNA corresponding to yk6f1 had a single open reading frame encoding a unique polypeptide of 808 amino acid residues (Figure 1B), which we named EAT-20A. EAT-20A has a putative signal sequence (120) (![]()
The three EGF motifs were of a noncalcium binding type, and all conserved the 6 consensus cysteine residues. The EGF motifs of EAT-20 were most closely related to those found in Drosophila SLIT (![]()
![]()
![]()
By immunoblot analysis using a specific polyclonal antibody raised against an N-terminal fragment of EAT-20 (Figure 1D), a single band at a position corresponding to the molecular mass of 145 kD was detected in a lysate prepared from wild-type animals of mixed stages (Figure 1F). This size was higher than that predicted for the EAT-20 polypeptide (79 kD), suggesting that the product might be subject to post-translational modifications, such as glycosylation.
EAT-20 expression was observed in the pharynx, neurons, and hypodermal cells:
We examined the expression of the eat-20 gene by using a transgenic line with a gfp reporter gene, by immunostaining with the anti-EAT-20 polyclonal antibody, and by in situ hybridization against eat-20 mRNA. The predominant expression of the eat-20 gene in the pharynx was revealed by all the methods. Expression in part of the nervous system and in hypodermal cells was also detected. eat-20 was expressed in early embryonic stages and the spatial pattern of the expression changes throughout the development. Details of the expression analysis will be described below.
First, we examined the expression of the eat-20 gene by using a transgenic line carrying ncIs1 in which p5E5 was integrated into a chromosome. In embryos, the GFP expression was first detected at the twofold stage. Sometimes eight cells in the anterior half of the body expressed GFP. At the threefold stage, several cells around the pharynx expressed GFP in most embryos. About half of the embryos also expressed GFP weakly in the pharynx. At the first larval stage (L1), GFP was detected in a subset of neurons. About half of the larvae also expressed GFP in the pharynx; expression in the terminal bulb was the most intense. At the adult stage, GFP was detected in the pharyngeal muscles, m3, m4, and m6 (Figure 2D). In addition, GFP was detected in a subset of neurons: IL1, OLQ, BAG, and ALN (Figure 2, AC), several circumpharyngeal cells (Figure 2D), and coelomocytes (data not shown). Very faint GFP fluorescence was detected in the pharyngeal neurons including I4 and I5 in L1 larvae (Figure 2E).
|
Next, we examined EAT-20 expression with the anti-EAT-20 polyclonal antibody. Neither immunoblotting (Figure 1F) nor immunostaining analysis (Figure 3E) with the anti-EAT-20 polyclonal antibody detected any signal in eat-20 mutants (see below), indicating that the following staining is EAT-20 specific. At the 16-cell stage, patches of staining on the entire surface of embryos were first detected. From the comma stage on, staining was detected in coelomocytes, the nervous tissues, hypodermal cells, and the pharynx. At the comma stage, the apical surface of the alimentary canal was stained intensely (Figure 4B) and the basal surface of presumptive pharynx was moderately stained. The staining in the presumptive pharynx gradually weakened thereafter and disappeared completely at the late threefold stage. The staining of the apical surface of the pharynx and pharyngeal intestinal valve remained intense throughout the rest of the embryogenesis stage (Figure 3A). Granular staining in the region surrounding the pharyngeal lumen was observed from the L2 stage on and spread to the external surface (Figure 3B). Staining of the entire surface of the pharyngeal muscle was observed in the late L3 or L4 stage (Figure 3C). The inner linings of the intestine and anus were intensely stained until the twofold stage, and then the staining became weak and disappeared completely at the threefold stage. The anterior-most intestinal cell became stained from the L3 stage (data not shown).
|
|
Staining was also observed in the nervous tissues. At the rostral end of the head, staining that seemed to correspond to the distal segments of labial process bundles was seen from the comma stage (Figure 4C) up to the adult stage. In larvae, the staining sometimes extended posteriorly to the level of the isthmus. A pair of cells, which might be support cells of sensory neurons posterior to the distal structures, were stained from the L1 stage up to the adult stage (Figure 4J). The motor neurons in the ventral cord, which sometimes expressed GFP in the promoter trap line, were stained at the early L1 stage (Figure 4F). This staining disappeared at the late L1 stage and, in the later stages, was replaced by segmental staining of the ventral nerve cord. The nerve ring and the nerve bundles that connect the nerve ring and the ventral nerve cord had dots of very faint staining. On the lateral body wall at the base of the tail spike, staining was detected from the L2 stage up to the adult stage, which may correspond to the axon of ALN neuron that expressed reporter GFP in the promoter trap lines (Figure 4H). In the adult male tail, sensory rays were intensely stained (Figure 4I).
There was also extensive hypodermal staining. Weak staining of the seam cells began at the threefold stage and the staining became intense from the L3 stage up to the adult stage (Figure 4D). Thin longitudinal bands were stained along the dorsal and ventral midline from the rostral end of the body to the base of the tail spike, which corresponds to the position of the dorsal and ventral hypodermal ridges (Figure 4G). The hypodermal staining co-localizing with the position of the ventral nerve cord was the most intense. The hypodermal cells at the opening and inside of the vulva were stained from the L4 stage up to the adult stage (Figure 4G). The hypodermis around the anus was stained from the L2 stage up to the adult stage (Figure 4H). The EAT-20 expression in the seam cells and hypodermal cells is inconsistent with the absence of GFP expression in those cells in the promoter trap lines, suggesting that p5E5 may not contain all the cis-regulatory elements necessary for the expression of the eat-20 gene.
The coelomocytes were continuously stained from the comma stage (Figure 4C) up to the adult stage.
Finally, we examined the expression of the mRNA for eat-20 by in situ hybridization. The signal was first detected in a few cells at the midline of the 1.5-fold stage embryo (Figure 2F). At the twofold stage and thereafter, the signal was detected in the presumptive pharynx (Figure 2G). At the L1 stage, the entire pharynx stained. In the older larvae and adults the entire pharynx stained in some animals though the staining was rather inconsistent. Cells around the metacorpus and the procorpus sometimes stained (Figure 2H).
Screen for mutations of eat-20:
To analyze the function of EAT-20 in vivo, we isolated deletion mutations by using transposon-mediated mutagenesis. First we isolated a Tc1-insertion allele, nc2::Tc1, in which a Tc1 inserted in the intron between exons 7 and 8 of eat-20. Then we isolated four deletion alleles, nc3, nc4, nc5, and nc6 (Figure 1C). nc3, nc4, nc5, and nc6 are expected to lack the C-terminal half of EAT-20 including the EGF motifs. We have detected no abnormality in animals homozygous for nc2::Tc1 or nc3, or in animals of genotype nc4/+, nc5/+, or nc6/+.
Both hermaphrodites and males of eat-20 mutants were fertile and their locomotion and defecation cycle were normal. They showed no gross morphological defects. Coelomocytes were located in the normal position. When a fluorescent dye, DiI, was injected into the pseudocoelom, they accumulated the dye, indicating that they retained phagocytic activity (data not shown). We could not detect any abnormality in the gross morphology of the nervous system of nc4 visualized with GFP (data not shown). The pattern of GFP expression by p5E5 in nc4 was indistinguishable from that in wild-type animals (data not shown).
However, a close examination revealed that animals homozygous for nc4, nc5, and nc6 appeared starved (Figure 5A and Figure B). Compared with wild-type animals, these three alleles exhibited the following phenotypes with similar strength: (1) shorter body length, (2) pale intestine, (3) smaller brood sizes and extended egg-laying periods. The short body length and pale intestine of eat-20 (nc4) were rescued by introduction of fosmid H30A04 containing the wild-type eat-20 gene (Figure 5D).
|
Neither immunoblotting (Figure 1F) nor immunostaining analysis (Figure 3E) with the anti-EAT-20 polyclonal antibody detected any signal in animals homozygous for nc4, nc5, and nc6. For nc3 mutants, a protein was detected by both immunoblotting (Figure 1F) and immunostaining (data not shown), suggesting that nc3 encodes a truncated EAT-20 protein initiated at a cryptic start site or translated from mRNAs spliced in an abnormal manner, for example by exon-skipping.
To examine the nature of the mutations genetically, we constructed a worm with eat-20 mutation in trans to a deficiency. mnDf13/nc4 hermaphrodites showed more severe starved appearance than nc4 homozygous animals (Figure 5C). Body length of mnDf13/nc4 was about half of that of wild-type animals. Adult mnDf13/nc4 animals had only a few eggs, whereas most adult nc4 homozygous animals had >10 eggs. The results raised the possibility that nc4 is not a null allele (see DISCUSSION).
eat-20 mutants showed starved appearance:
It was reported that abnormal feeding generally causes starved appearance, including a pale intestine and a short and thin body (![]()
The opacity of the intestine is also an indicator of starvation. When viewed under a dissection microscope, the intestine of wild-type animals and eat-20 larvae looked dark, whereas that of nc4 adult animals looked pale. The intestine of eat-20 L4 animals also sometimes looked pale. We presumed that the opacity of the intestine may be related to the quantity of intestinal granules and therefore we examined autofluorescence of intestinal granules by UV irradiation. In wild-type animals, just after the final molt, the intensity of autofluorescence of the intestine increased, whereas in nc4 animals, autofluorescence was little intensified in the adults (Figure 6A and Figure B). In weak Eat mutants, such as eat-4 and eat-11, intestinal autofluorescence is indistinguishable from that of wild-type animals, whereas intestinal autofluorescence of medium to strong Eat mutants, such as eat-6, eat-8, eat-10, and eat-13, is weak (Figure 6E and data not shown). The adult eat-20 mutant intestine contained fewer and smaller fluorescent granules than the adult wild-type intestine. The intestinal autofluorescence of starved wild-type animals was weak, lacked bright white granular fluorescence, and looked similar to that of nc4 animals (Figure 6C). However, the intestines of starved wild-type animals and nc4 animals were not the same. nc4 animals had intestines with a normal shape whereas starved wild-type animals had shrunken intestines (Figure 6C and Figure D).
|
eat-20 mutants have abnormal eating behavior:
Though we could not detect any morphological defect in the pharynx by light microscopic observation (data not shown), the starved appearance, which is characteristic of previously isolated Eat mutants defective in feeding (![]()
When worms ingested mineral oil added on the surface of culture, we also found that the posterior transfer of oil droplets in the pharynx was inefficient in eat-20 mutant animals, a defect similar to what ![]()
![]()
Brood size is reduced and egg-laying period is prolonged in eat-20 mutants:
We found that the brood size of nc4 animals is 15% smaller than that of wild-type animals (Figure 7A). In addition to reduced brood size, the egg-laying period of eat-20 mutants was prolonged. Wild-type hermaphrodites start laying eggs after they have reached adulthood. We have counted the number of self-fertilized eggs laid by hermaphrodites at 24-hr intervals by setting the time of the final molt between the L4 stage and the adult stage as day 0. The egg-laying curve showed that wild-type animals laid most of their eggs within the first 3 days with a peak at the second day (Figure 7B). nc4 animals laid a smaller number of eggs during the period, but kept laying significant numbers of eggs for another several days. Whereas the wild-type egg-laying curves were very stereotypic, those for the mutants showed significant variation among individuals (Figure 7C and Figure D).
|
| DISCUSSION |
|---|
By a reverse genetic approach we have identified a novel gene expressed in the pharynx, eat-20. The structure of EAT-20 shows that it is a unique example of a cell surface protein encoded by an eat gene. We have also characterized the intestinal and reproductive defects of eat-20 mutants.
eat-20 encodes a novel protein that acts on the cell surface:
We have revealed that EAT-20 is a novel protein consisting of three EGF motifs, a transmembrane region and an N-terminal signal sequence. The structure indicates that EAT-20 is a cell membrane protein or a secreted protein. The presence of EGF motifs suggests that EAT-20 may interact with other proteins. The EGF motifs of EAT-20 closely resemble those of SLIT (![]()
![]()
![]()
Although neither immunoblotting nor immunostaining analyses with the anti-EAT-20 polyclonal antibody detected any signal in nc4, nc5, and nc6, there is a possibility that they may not be null alleles because mnDf13/nc4 animals showed more severe phenotypes than nc4 homozygous animals. The product of nc4 might not bind to the anti-EAT-20 antibody, or nc4 homozygous animals might produce such a small amount of EAT-20 that it was not detected by the antibody. Another possibility is that nc4 is a null allele, but deletion of unknown genes within mnDf13 might enhance the starved appearance of eat-20 mutants because of haploinsufficiency. The isolation and analysis of eat-20 mutants that have a larger deletion would provide a clue to this problem.
Expression of eat-20 in the pharynx is likely to be required for proper pumping:
We have revealed that pharyngeal pumping is slow and bacterial transport in the isthmus is inefficient in eat-20 mutants. The reporter gene expression, in situ hybridization, and immunostaining all showed that eat-20 is expressed in the pharynx. The expression of EAT-20 on the entire surface of the pharyngeal muscle was observed from the L3 or L4 stage. The starved appearance of eat-20 mutants was first noted in L4 or adult stages, which corresponds to the timing of the pharyngeal expression of EAT-20, indicating that EAT-20 expression in the pharynx from late larval stages on might be important.
The finding that the transport of an oil droplet from the metacorpus to the posterior isthmus in eat-20 mutants takes ~2.4 times as long as that in wild-type animals indicates that the eat-20 metacorpus can transport only two-fifths of the food that wild type can transport. This inefficient eating may cause the starved appearance of the eat-20 mutant, including the reduction in body length.
It has been shown that both neural input and autonomous muscle contractions are required for the proper pumping of the pharynx (![]()
![]()
Alternatively, the eat-20 mutations might affect pharyngeal neurons. eat-20 mutants showed slippery pumping in the isthmus, which was also observed in worms whose I5 neuron was killed (I5- worms) and was even more apparent in I5- M3- worms (![]()
![]()
eat-20 mutants also showed slow pumping. Previous reports showed that MC, M2, M3, M4, and NSM are required for maintaining the proper pumping rate (![]()
![]()
![]()
Another possibility is that EAT-20 is required in pharyngeal cells other than neurons and muscles whose roles in feeding have been little examined. In summary, at present, the cellular and molecular mechanisms explaining how eat-20 mutations lead to defective feeding remain open to speculation. Genetic analysis using mosaics or molecular analysis using a cDNA under control of a heterologous promoter to rescue the mutant phenotype would be necessary to determine the primary target of the mutation.
A feeding defect may affect reproduction of eat-20 mutants:
The finding that eat-20 mutants have a smaller body and a pale intestine is yet another example of the previous observation that the starved appearance is common to mutants affecting pharyngeal function (![]()
![]()
We have revealed that eat-20 mutants have a smaller brood size and a prolonged egg-laying period. A previous report showed that lower progeny production rates were generally observed in eat mutants (![]()
![]()
Note added in proof: Because eat-20(nc4) may not be a null allele, we have examined the possibility that nc4 would be a hypomorphic allele of a known gene. As mnDf43 complemented nc4, nc4 was placed in the interval between the right bleak point of mnDf43 and lin-15. We have performed a complementation test against the known let mutations mapped to the region. let-15(m127), let-18(mn122), let-38(mn141), and let-40(mn150) all complemented nc4, suggesting that nc4 is not an allele of these genes.
| ACKNOWLEDGMENTS |
|---|
We are grateful to Dr. Yoshiki Andachi and Dr. Takeshi Ishihara for advice on targeting, Dr. Siegfried Hekimi for critically reading an early version of the manuscript and helpful comments, especially for suggesting that our mutants are Eat, and Mr. Yasunori Murakami for help with antibody analyses. We thank the C. elegans Sequencing Consortium for the genomic sequence of H30A04, Dr. Alan Coulson for YAC polytene grids, fosmid H30A04 and H13N06, Dr. Martin Chalfie for TU#61, Dr. Andrew Fire for pPD95.75, Dr. Takeshi Ishihara for H20, Dr. Yuji Kohara for yk6f1, yk16h2g and cDNA filters, Dr. Robert H. Waterston for MH27, and past and present members of our laboratories for advising throughout this work. We appreciate comments of the anonymous reviewers that have improved the manuscript. Some strains were provided by the Caenorhabditis Genetic Center, which is funded by the National Institute for Health National Center for Research Resources. This work was supported by grants from the Ministry of Education, Science, and Culture, Japan (H.F., S.T.) and from the special coordination funds of the Science and Technology Agency of the Japanese Government (H.F., S.T.) and was partly supported by Research Fellowships of the Japan Society for the Promotion of Science for Young Scientist (Y.S.).
Manuscript received June 28, 1999; Accepted for publication November 1, 1999.
| LITERATURE CITED |
|---|
ALBERTSON, D. G. and J. N. THOMSON, 1976 The pharynx of C. elegans.. Philos. Trans. R. Soc. Lond. B Biol. Sci. 275:299-325[Medline].
AVERY, L., 1993a The genetics of feeding in Caenorhabditis elegans.. Genetics 133:897-917[Abstract].
AVERY, L., 1993b Motor neuron M3 controls pharyngeal muscle relaxation timing in Caenorhabditis elegans.. J. Exp. Biol. 175:283-297[Abstract].
AVERY, L. and H. R. HORVITZ, 1987 A cell that dies during wild-type C. elegans development can function as a neuron in a ced-3 mutant. Cell 51:1071-1078[Medline].
AVERY, L. and H. R. HORVITZ, 1989 Pharyngeal pumping continues after laser killing of the pharyngeal nervous system of C. elegans.. Neuron 3:473-485[Medline].
AVERY, L., and J. H. THOMAS, 1997 Feeding and defecation, pp. 679716 in C. elegans II, edited by D. L. RIDDLE, T. BLUMENTHAL, B. J. MAYER and J. R. PRIESS. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
BABU, P., 1974 Biochemical genetics of C. elegans.. Mol. Gen. Genet. 135:39-44.
BRENNER, S., 1974 The genetics of Caenorhabditis elegans.. Genetics 77:71-94
CHALFIE, M., Y. TU, G. EUSKIRCHEN, W. W. WARD, and D. C. PRASHER, 1994 Green fluorescent protein as a marker for gene expression. Science 263:802-805
DAVIS, M. W., D. SOMERVILLE, R. Y. LEE, S. LOCKERY, and L. AVERY et al., 1995 Mutations in the Caenorhabditis elegans Na,K-ATPase alpha-subunit gene, eat-6, disrupt excitable cell function. J. Neurosci. 15:8408-8418[Abstract].
DENT, J. A., M. W. DAVIS, and L. AVERY, 1997 avr-15 encodes a chloride channel subunit that mediates inhibitory glutamatergic neurotransmission and ivermectin sensitivity in Caenorhabditis elegans.. EMBO J. 16:5867-5879[Medline].
HOPE, I. A., 1991 Promoter trapping in Caenorhabditis elegans.. Development 113:399-408[Abstract].
HRESKO, M. C., B. D. WILLIAMS, and R. H. WATERSTON, 1994 Assembly of body wall muscle and muscle cell attachment structures in Caenorhabditis elegans.. J. Cell Biol. 124:491-506
KIMBLE, J. and W. J. SHARROCK, 1983 Tissue-specific synthesis of yolk proteins in Caenorhabditis elegans.. Dev. Biol. 96:189-196[Medline].
KYTE, J. and R. F. DOOLITTLE, 1982 A simple method for displaying the hydropathic character of a protein. J. Mol. Biol. 157:105-132[Medline].
LEE, R. Y. N., E. R. SAWIN, M. CHALFIE, H. R. HORVITZ, and L. AVERY, 1999 EAT-4, a homolog of a mammalian sodium-dependent inorganic phosphate cotransporter, is necessary for glutamatergic neurotransmission in Caenorhabditis elegans.. J. Neurosci. 19:159-167
MELLO, C. C., J. M. KRAMER, D. STINCHCOMB, and V. AMBROS, 1991 Efficient gene transfer in C. elegans: extrachromosomal maintenance and integration of transforming sequences. EMBO J. 10:3959-3970[Medline].
NELSON, L. S., M. L. ROSOFF, and C. LI, 1998 Disruption of a neuropeptide gene, flp-1, causes multiple behavioral defects in Caenorhabditis elegans.. Science 281:1686-1690
OKAMOTO, H. and J. N. THOMSON, 1985 Monoclonal antibodies which distinguish certain classes of neuronal and supporting cells in the nervous tissue of the nematode Caenorhabditis elegans.. J. Neurosci. 5:643-653[Abstract].
PLASTERK, R. H. A., 1995 Reverse genetics: from gene sequence to mutant worm, pp. 5980 in Methods in Cell Biology. Caenorhabditis elegans: Modern Biological Analysis of an Organism, edited by H. F. EPSTEIN and D. C. SHAKES. Academic Press, San Diego.
RAIZEN, D. M. and L. AVERY, 1994 Electrical activity and behavior in the pharynx of Caenorhabditis elegans.. Neuron 12:483-495[Medline].
RAIZEN, D. M., R. Y. LEE, and L. AVERY, 1995 Interacting genes required for pharyngeal excitation by motor neuron MC in Caenorhabditis elegans.. Genetics 141:1365-1382[Abstract].
ROTHBERG, J. M., J. R. JAKOBS, C. S. GOODMAN, and S. ARTAVANIS-TSAKONAS, 1990 slit: an extracellular protein necessary for development of midline glia and commissural axon pathways contains both EGF and LRR domains. Genes Dev. 4:2169-2187
STARICH, T. A., R. Y. LEE, C. PANZARELLA, L. AVERY, and J. E. SHAW, 1996 eat-5 and unc-7 represent a multigene family in Caenorhabditis elegans involved in cell-cell coupling. J. Cell Biol. 134:537-548
SULSTON, J. E. and H. R. HORVITZ, 1977 Post-embryonic cell lineages of the nematode, Caenorhabditis elegans.. Dev. Biol. 56:110-156[Medline].
SULSTON, J. E., E. SCHIERENBERG, J. G. WHITE, and J. N. THOMSON, 1983 The embryonic cell lineage of the nematode Caenorhabditis elegans.. Dev. Biol. 100:64-119[Medline].
TABARA, H., T. MOTOHASHI, and Y. KOHARA, 1996 A multi-well version of in situ hybridization on whole mount embryos of Caenorhabditis elegans.. Nucleic Acids Res. 24:2119-2124
VON HEIJNE, G., 1986 A new method for predicting signal sequence cleavage site. Nucleic Acids Res. 14:4683-4690
WHITE, J. G., E. SOUTHGATE, J. N. THOMSON, and S. BRENNER, 1986 The structure of the nervous system of the nematode C. elegans.. Philos. Trans. R. Soc. Lond. B Biol. Sci. 314:1-340.
YOCHEM, J. and I. GREENWALD, 1989 glp-1 and lin-12, genes implicated in distinct cell-cell interactions in C. elegans, encode similar transmembrane proteins. Cell 58:553-563[Medline].
YOCHEM, J., K. WESTON, and I. GREENWALD, 1988 The Caenorhabditis elegans lin-12 gene encodes a transmembrane protein with overall similarity to Drosophila Notch. Nature 335:547-550[Medline].
ZWAAL, R. R., A. BROEKS, J. VAN MEURS, J. T. GROENEN, and R. H. PLASTERK, 1993 Target-selected gene inactivation in Caenorhabditis elegans by using a frozen transposon insertion mutant bank. Proc. Natl. Acad. Sci. USA 90:7431-7435
This article has been cited by other articles:
![]() |
D. L. Miller and M. B. Roth Hydrogen sulfide increases thermotolerance and lifespan in Caenorhabditis elegans PNAS, December 18, 2007; 104(51): 20618 - 20622. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Nakao, M. L. Hudson, M. Suzuki, Z. Peckler, R. Kurokawa, Z. Liu, K. Gengyo-Ando, A. Nukazuka, T. Fujii, F. Suto, et al. The Plexin PLX-2 and the Ephrin EFN-4 Have Distinct Roles in MAB-20/Semaphorin 2A Signaling in Caenorhabditis elegans Morphogenesis Genetics, July 1, 2007; 176(3): 1591 - 1607. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Richard, R. Roepman, W. M. Aartsen, A. G.S.H. van Rossum, A. I. den Hollander, E. Knust, J. Wijnholds, and F. P.M. Cremers Towards understanding CRUMBS function in retinal dystrophies Hum. Mol. Genet., October 15, 2006; 15(suppl_2): R235 - R243. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. A. Cox, C. Tuskey, and J. Hardin Cell adhesion receptors in C. elegans J. Cell Sci., April 15, 2004; 117(10): 1867 - 1870. [Full Text] [PDF] |
||||
![]() |
E. A. Cox and J. Hardin Sticky worms: adhesion complexes in C. elegans J. Cell Sci., April 15, 2004; 117(10): 1885 - 1897. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Gaudet and S. E. Mango Regulation of Organogenesis by the Caenorhabditis elegans FoxA Protein PHA-4 Science, February 1, 2002; 295(5556): 821 - 825. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Fujii, F. Nakao, Y. Shibata, G. Shioi, E. Kodama, H. Fujisawa, and S. Takagi Caenorhabditis elegans PlexinA, PLX-1, interacts with transmembrane semaphorins and regulates epidermal morphogenesis Development, January 5, 2002; 129(9): 2053 - 2063. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. I. den Hollander, K. Johnson, Y. J. M. de Kok, A. Klebes, H. G. Brunner, E. Knust, and F. P. M. Cremers CRB1 has a cytoplasmic domain that is functionally conserved between human and Drosophila Hum. Mol. Genet., November 1, 2001; 10(24): 2767 - 2773. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Fares and I. Greenwald Genetic Analysis of Endocytosis in Caenorhabditis elegans: Coelomocyte Uptake Defective Mutants Genetics, September 1, 2001; 159(1): 133 - 145. [Abstract] [Full Text] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Shibata, Y.
- Articles by Takagi, S.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Shibata, Y.
- Articles by Takagi, S.












