Functions of Fission Yeast Orp2 in DNA Replication and Checkpoint Control

Corresponding author: Janet Leatherwood, Department of Molecular Genetics and Microbiology, Life Science, Rm. 130, SUNY, Stony Brook, NY 11794-5222., janet.leatherwood{at}sunysb.edu (E-mail)

Communicating editor: P. G. YOUNG

	ABSTRACT

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

orp2 is an essential gene of the fission yeast Schizosaccharomyces pombe with 22% identity to budding yeast ORC2. We isolated temperature-sensitive alleles of orp2 using a novel plasmid shuffle based on selection against thymidine kinase. Cells bearing the temperature-sensitive allele orp2-2 fail to complete DNA replication at a restrictive temperature and undergo cell cycle arrest. Cell cycle arrest depends on the checkpoint genes rad1 and rad3. Even when checkpoint functions are wild type, the orp2-2 mutation causes high rates of chromosome and plasmid loss. These phenotypes support the idea that Orp2 is a replication initiation factor. Selective spore germination allowed analysis of orp2 deletion mutants. These experiments showed that in the absence of orp2 function, cells proceed into mitosis despite a lack of DNA replication. This suggests either that the Orp2 protein is a part of the checkpoint machinery or more likely that DNA replication initiation is required to induce the replication checkpoint signal.

EUKARYOTIC DNA replication is initiated at many replication origins on each chromosome. In the budding yeast Saccharomyces cerevisiae, origin sequences are bound by the origin recognition complex (ORC), which is composed of six subunits, Orc1 through Orc6 (BELL and STILLMAN 1992 ). In other eukaryotes, the cis-acting sequences of replication origins are more complex and less well understood (HUBERMAN 1998 ). Nevertheless, ORC appears to be widely conserved. In the fission yeast Schizosaccharomyces pombe, genes similar in sequence to ORC1, ORC2, and ORC5 have been identified (GAVIN et al. 1995 ; MUZI-FALCONI and KELLY 1995 ; GRALLERT and NURSE 1996 ; LEATHERWOOD et al. 1996 ; ISHIAI et al. 1997 ).

The ORC2-like factor, Orp2 (Orc2 related in pombe), is particularly interesting because it interacts with proteins required for coupling DNA replication to cell cycle progression. Orp2 was first identified because it binds to the cell cycle kinase Cdc2 (LEATHERWOOD et al. 1996 ). In fission yeast, Cdc2 is the cyclin-dependent kinase governing both the G1 to S and the G2 to M transitions (NURSE and BISSET 1981 ; NURSE 1990 ). Initiation of DNA replication requires an active complex of Cdc2 and one of the B-type cyclins Cdc13, Cig1, or Cig2. (FISHER and NURSE 1996 ; MONDESERT et al. 1996 ). The same Cdc2/Cdc13 complex that can activate replication is also essential to prevent re-initiation of DNA replication during G2 (BROEK et al. 1991 ; HAYLES et al. 1994 ). The interaction of Cdc2 and Orp2 suggests that Cdc2 regulates DNA replication directly at replication origins (LEATHERWOOD et al. 1996 ).

Orp2 also binds to the replication activator Cdc18 (LEATHERWOOD et al. 1996 ). Cdc18 is similar to the Cdc6 proteins of budding yeast, Xenopus, and humans (KELLY et al. 1993 ). Cdc18/Cdc6 activity is cell cycle regulated, and this regulation is important for accurate regulation of DNA replication. In fission yeast, overexpression of Cdc18 leads to DNA rereplication (NISHITANI and NURSE 1995 ). It appears that Cdc18 activity is regulated by Cdc2 kinase (JALLEPALLI et al. 1997 ; LOPEZ-GIRONA et al. 1998 ). One attractive model is that Cdc18/Cdc6 interacts with ORC and then catalyzes association of MCM replication factors with the chromatin (J. LEATHERWOOD 1998 ).

The cis-acting sequences used for replication origins in budding yeast include a binding site for ORC and a binding site for a transcription activator; in higher eukaryotes, the sequences that direct replication initiation have remained elusive (reviewed in ROWLEY et al. 1994 ; HUBERMAN 1998 ), and in fission yeast, the determinants of origin activity appear to be more complex and possibly more redundant than those of budding yeast (WOHLGEMUTH et al. 1994 ; CLYNE and KELLY 1995 ; DUBEY et al. 1996 ). To gain a broader understanding of how replication initiates, it will be informative to learn about the functions of the putative fission yeast ORC complex in vivo. Toward this end, we isolated temperature-sensitive alleles of orp2.

To isolate orp2 mutants, we developed a plasmid-shuffle system for fission yeast. Fission yeast, like other fungi, lacks thymidine kinase. We used the thymidine kinase gene from herpes simplex virus as a new counterselectable marker by taking advantage of the fact that the presence of thymidine kinase causes sensitivity to the thymidine analogue 5-fluoro-2'-deoxyuridine (FUdR). With the flood of information from genome projects and the increasing number of genes identified by two-hybrid and other interaction screens, there is an increasing need to engineer conditional mutations. The methods used here should be widely useful in fission yeast studies. The approach is also applicable to budding yeast (S. B. HAASE, unpublished data; SCLAFANI and FANGMAN 1986 ), to Neurospora crassa, and other fungi (GRIVELL and JACKSON 1968 ). Expression of thymidine kinase in fission yeast also makes it possible to measure DNA replication by BrdU incorporation or by the use of tritiated thymidine (J. LEATHERWOOD, unpublished data). Such labeling of newly synthesized DNA is not possible in wild-type yeast that lack the thymidine salvage pathway because they cannot use thymidine or BrdU as precursors for DNA synthesis.

Our previous studies showed that orp2 is essential and that the cells lacking orp2 died with phenotypes consistent with a defect in DNA replication (LEATHERWOOD et al. 1996 ). In this study we investigate S-phase progression, chromosome stability, and replication-checkpoint control in orp2 mutants.

	MATERIALS AND METHODS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

S. pombe strains and media:
The genetic methods and media used for S. pombe were essentially as described by MORENO et al. 1991 . YSO is rich media low in adenine (0.5% yeast extract, 0.2% casamino acids, 3% glucose; add 2% agar when making plates). Strains used in this study are listed in Table 1.

Thymidine kinase constructs:
The thymidine kinase gene from herpes simplex virus (HSV1-TK; MCKNIGHT 1980 ) was cloned so as to be expressed from the adh1 promoter in S. pombe; this is refered to as padh-TK. BamHI recognition sites were added to the coding region of HSV1-TK by PCR amplification using primers BTK5' CGGGATCCCGTATGGCTTCGTACC 3' and BTK3' CGGGATCCCGTGTTTCAGTTAGCC 3'. padh-TK expression plasmid pJL217 was constructed by cloning the 1.13-kb TK PCR product into the BamHI site 3' of the adh1 promotor in fission yeast expression plasmid pART1 (MCLEOD et al. 1987 ). The plasmid pJL217 was transformed into S. pombe (strain PR109 h^- leu1-32 ura4-D18, P. Russell) by selection for leucine prototrophy; transformants were sensitive to 25 mM FUdR (Sigma, St. Louis, cat. F-0503) indicating that functional thymidine kinase is expressed from the adh1 promotor (data not shown). The his7⁺, padh-TK plasmid pJL218 was constructed by cloning the 3.0-kb EcoRI fragment containing padh-TK from pJL217 into EcoRI-digested his7⁺ plasmid pEA13 (APOLINARIO et al. 1993 ). To integrate padh-TK at the his7 locus, pJL218 was linearized within his7⁺ by Cla1 and used to transform the his7-366 mutant strain CHP429 to histidine prototrophy. The resulting allele is designated his7⁺::padh-TK (strain JLP125 h^- leu1-32 ade6-M216 his7⁺::padh-TK) and also results in FUdR sensitivity (Figure 2).

View larger version (31K): In this window In a new window Download PPT slide   Figure 1. Map of shuttle vector porp2TKade (plasmid pJL261).

View larger version (82K): In this window In a new window Download PPT slide   Figure 2. Expression of thymidine kinase causes sensitivity to FUdR. Strain CHP429 (wild type) and thymidine kinase expression strain JLP125 (padh-TK) were grown on YES plates containing 0 µM, 1 µM, and 100 µM FUdR. (A) Cell morphology after 1 day at 32°; (B) overall growth after 2 days at 32°.

The plasmid containing orp2⁺, ade6⁺, and padh-TK was constructed in three steps: (1) padh-TK on the 1.8-kb HindIII/SmaI fragment from pJL217 was cloned into HindIII/SmaI-digested pREP3 (MAUNDRELL 1993 ) to create pJL240; (2) orp2⁺ on the 2.8-kb HindIII fragment from pER27 (LEATHERWOOD et al. 1996 ) was cloned into HindIII-digested pJL240 to create pJL243; and (3) ade6⁺ on the 3.0-kb PvuII, SpeI fragment from pAS1 (SZANKASI et al. 1988 ) was cloned into pJL243 that had been digested with NsiI, treated with T4 DNA polymerase to remove the NsiI overhang, purified, and then digested with SpeI. The resulting plasmid, pJL261, is referred to as porp2TKade throughout the text and is shown in Figure 1. orp2⁺ expression plasmid pJL207 has been described (LEATHERWOOD et al. 1996 ).

orp2 mutagenesis and identification of conditional alleles:
orp2 was amplified for 20 cycles (annealing temperature 67°) from plasmid pJL207 with primers oJL18 (nmt promotor sequence 5' TCT CAC TTT CTG ACT TAT AGT CGC T 3') and oJL19 (nmt terminator sequence 5' CTA GCA GTA CTG GCA AGG GAG AC 3') using mutagenic PCR conditions described by CADWELL and JOYCE 1992 . Reactions contained dNTPs and divalent cations specified in Table 2 and also contained 1 mM dCTP, 1 mM dTTP, 20 mM Tris pH 8.4, 50 mM KCl, 50 ng plasmid template, 1 µg each primer, and 5 units TAQ polymerase (GIBCO-BRL, Gaithersburg, MD) in final volume of 100 µl. PCR products digested with BsiWI and BamHI were cloned into BsiWI/BamHI-digested pJL207. Approximately 1000 Escherichia coli transformants were pooled for each PCR reaction condition. Plasmid DNA from the pooled colonies was transformed into yeast strain JLP166 at 25°. A total of 200–1200 yeast transformants were screened for each pool by replica printing to YES and to YES + 50 µM FUdR and growing at 25° and 36°. The percentage of nonfunctional and temperature-sensitive orp2 alleles for each PCR pool is shown in Table 2. A total of 97 temperature-sensitive candidates were picked and retested by replica printing onto FUdR plates at 25°, 32°, 35.5°, and 36°. Plasmids were rescued from 16 candidates that gave the greatest temperature dependence for growth. Five of these plasmids were retransformed into JLP166 and all had temperature-sensitive phenotypes when retested.

Integration of orp2 mutants:
To experiment further with the thymidine kinase gene, a thymidine kinase-based approach was devised to integrate selected orp2* mutants. We reasoned that integration of orp2* into the plasmid shuffle strain JLP164 (orp2::ura4, porp2TKade) would allow the cells to grow at permissive temperature without the porp2TKade plasmid and therefore be viable on media containing FUdR. Integrants were selected on the basis of this idea. orp2* linear DNA was introduced into strain JLP164 by LiOAc transformation and the cells were grown for 2 days at 25° in rich media to allow loss of the porp2TKade plasmid. Transformations were then plated directly on rich media (YES) containing 100 µM FUdR and incubated at 25° for 3 days. Colonies were screened by replica printing to plates lacking uracil (if orp2::ura4 has been replaced, they will fail to grow without uracil), to plates low in adenine (if porp2TKade is lost, colonies will be red on low adenine plates), and finally to rich media at 25° and 36° to screen for a temperature-sensitive phenotype. Ura^-, Ade^-, temperature-sensitive colonies were analyzed by Southern blotting to confirm that orp2::ura4 was replaced. By this method the temperature-sensitive orp2-2 and orp2-7 alleles were isolated as stable integrants (allele numbers indicate the PCR pools from which the mutants were obtained).

Selective spore germination and FACS analysis:
Diploid strain JLP46 (h⁺/h^- ade6-M210/ade6-M216 leu1-32/leu1-32 ura4-D18/ura4-D18 orp2⁺/orp2::ura4) has been described (LEATHERWOOD et al. 1996 ). A haploid orp2::ura4 derived from JLP46 was kept alive by orp2 expressed from plasmid pJL207 (LEATHERWOOD et al. 1996 ). This haploid was mated with an orp2-2 temperature-sensitive strain to create a diploid from which an isolate lacking the pJL207 plasmid was obtained; this is JLP242 (h⁺/h^- ade6-M210/ade6-M216 leu1-32/leu1-32 ura4-D18/ura4-D18 his7-366/his7-366 orp2-2/orp2::ura4). Selective spore germination and FACS analysis was performed as previously described for JLP46; note that ungerminated spores are removed from the final data presented by gating out small objects based on forward scatter and that assignment of the gate parameters was determined by analysis of a pure population of ungerminated spores (LEATHERWOOD et al. 1996 ). For the hydroxyurea (HU)-treated samples, 15 mM HU was added to the media at the beginning of the germination.

	RESULTS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Isolation of orp2 mutants:
Fission yeast orp2 is essential; therefore recessive orp2 mutants were identified using a plasmid shuffle. A haploid deleted for orp2 was kept alive by wild-type orp2 on a plasmid, which also carried the gene for HSV thymidine kinase. Mutagenized orp2 on a second plasmid was introduced. Cells that had lost the wild-type orp2 plasmid were isolated by selecting against the thymidine kinase activity. Recessive phenotypes of the mutant orp2 alleles were then scored, plasmids were recovered and retested, and selected mutants were integrated into the genome for further study.

Selection against the thymidine kinase gene:
Fungi including S. pombe, S. cerevisiae, and N. crassa lack thymidine kinase and thus cannot use thymidine as a precursor for DNA synthesis (reviewed in KORNBERG and BAKER 1992 ). Thymidine kinase phosphorylates thymidine, but also phosphorylates halogenated thymidine derivates such as FUdR. Phosphorylated FUdR is a potent inhibitor of thymidylate synthetase and so prevents de novo synthesis of dTTP (reviewed in KORNBERG and BAKER 1992 ). Without dTTP, cells cannot replicate DNA and eventually die. It has previously been shown that budding yeast expressing thymidine kinase can be selectively killed by FUdR (SCLAFANI and FANGMAN 1986 ; S. B. HAASE and S. REED, unpublished data).

We reasoned that fission yeast might also be sensitive to killing by FUdR. Wild-type fission yeast and the thymidine kinase expression strain JLP125 (MATERIALS AND METHODS) were grown on media containing FUdR. This treatment caused cell cycle arrest of the thymidine kinase strain JLP125: cells failed to divide but continued to grow in length (Figure 2). This cell cycle arrest is similar to that seen when DNA replication is blocked by hydroxyurea or by replication mutants. JLP125 cells were arrested by 1 µM FUdR, the lowest concentration tested, whereas the wild-type strain grows normally on media containing 100 µM FUdR and shows only a slight decrease in growth rate with no cell cycle delay on 600 µM FUdR.

A plasmid shuffle based on thymidine kinase:
The goal is to have a plasmid with the wild-type allele of your favorite gene (i.e., orp2⁺) and to be able to select cells that lose this plasmid to uncover a mutant allele of this gene so the function of the mutant can be determined. For our case, this system requires a special orp2 shuttle plasmid. This plasmid is named porp2TKade and has three important features: (1) wild-type orp2⁺, (2) counterselectable marker thymidine kinase (padh-TK) so that loss of the plasmid can be selected for by growth on FUdR, and (3) selectable marker ade6⁺ for yeast transformation; ade6⁺ can also be detected by colony color. On low adenine medium, ade6^- mutants form red colonies, but ade6^- mutants containing porp2TKade are Ade⁺ and form white colonies. In this case, colony color is a convenient way to identify FUdR resistance due to plasmid loss.

The orp2 shuttle plasmid is the sole source of orp2 in the strains JLP164 and JLP166; the chromosomal gene has been deleted and replaced by ura4⁺ (orp2::ura4⁺). To test the feasibility of the plasmid shuffle, the JLP166 haploid was transformed with either the LEU2 orp2⁺ expression plasmid pJL207 or the LEU2 vector pRep1. As expected, cells that received the orp2⁺ plasmid can lose the shuttle plasmid porp2TKade and grow on FUdR medium whereas those transformed with the vector control require the porpTKade plasmid and fail to grow on FUdR medium (Figure 3).

View larger version (67K): In this window In a new window Download PPT slide   Figure 3. Characterization of thymidine kinase-based plasmid shuffle. Cells contain LEU2 selectable vector (middle, control) or LEU2, orp2+ expression plasmid pJL207 (left and right). In the middle and right, cells also contain the shuttle vector porp2TKade. All cells lack chromosomal orp2 (orp2 ::ura4+) and are ade6 mutants (ade6-m210). (Top) Cells are grown on YSO media so that cells lacking porp2TKade are red. (Bottom) Cells are grown on YSO plus 50 µM FUdR so that cells containing porp2TKade are killed, and only cells with an additional source of functional orp2 (pJL207) can grow.

Generation of orp2* mutants:
The orp2 open reading frame was mutagenized by PCR and cloned into the LEU2⁺ orp2 expression vector pJL207 to produce orp2* mutant libraries. Amplified library pools were transformed into fission yeast strain JLP166 selecting for Leu⁺. To determine which transformants received functional orp2, colonies were replica printed to FUdR plates to select against the porp2TKade plasmid. Transformants grew on FUdR only when the orp2/LEU2 plasmid provided the essential functions of orp2. Temperature-sensitive mutants were identified as transformants that could grow on FUdR plates at 25° but not at 36° (see MATERIALS AND METHODS for details). Sixteen temperature-sensitive alleles of orp2 were obtained. Two of these, orp2-2 and orp2-7, were integrated into the genome (replacing orp2::ura4⁺ allele with orp2*) for further study (MATERIALS AND METHODS).

Analysis of orp2-2 and orp2-7 temperature sensitive mutants:
As expected for mutations that interfere with DNA replication, the orp2 mutants show cell cycle defects at restrictive temperature. At 36.5°, strains JLP208 (orp2-2) and JLP216 (orp2-7) stop dividing, elongate, and lose viability. The division arrest of orp2-7 is heterogeneous and not all cells remain arrested, so most experiments use orp2-2. The temperature-sensitive phenotypes of both JLP208 (orp2-2) and JLP216 (orp2-7) can be complemented by orp2⁺ on plasmid pJL207. Finally, heterozygous orp2-2/orp2⁺ or orp2-7/orp2⁺ diploids grow and divide at the restrictive temperature of 36.5° indicating that both alleles are recessive.

Because we are studying a replication protein, the fact that we used plasmid-borne alleles in the original screen may have allowed selection of only slightly defective alleles. The idea is that a cell dependent on a partially defective replication protein would have lower efficiency of plasmid replication leading to less of the protein as well as significant plasmid loss. In other cases where the mutagenized gene's normal function will not affect plasmid copy number or stability, screening for mutant alleles on plasmids might yield severely defective mutants because the plasmid-borne gene will be present in many copies; as a result, defective proteins would be overexpressed, which could mask subtle defects in function.

FACS analysis shows that orp2-2 arrests in S-phase at restrictive temperature (Figure 4A). Unlike cdc10-129, which arrests with 1C DNA content, orp2-2 appears to arrest in S-phase with between 1C and 2C DNA content. By 3.5 hr after shift to restrictive temperature, cell division has ceased in the orp2-2 population; the septation index is <1%, and cells are elongated. This indicates a first cycle arrest in S-phase for the orp2-2 allele.

View larger version (37K): In this window In a new window Download PPT slide   Figure 4. Phenotypic analysis of orp2-2. (A) FACS analysis of DNA replication in orp2-2 mutants: cells were grown to mid-log phase and shifted to 36.5° for 0, 2, or 3.5 hr. Wild-type and cdc10-129 mutant strains were included as controls. (B) Checkpoint dependence of orp2-2 cell cycle arrest. (a) Wild-type, (b) rad1-1, (c) orp2-2, and (d) rad1-1 orp2-2 strains were grown in liquid media to mid-log phase (25°), then shifted to restrictive temperature for orp2-2 (36.5°) for 3.5 hr, fixed, and stained with 4',6-diamidino-2-phenylindole (DAPI). (C) Chromosome loss assay: wild-type or orp2-2 mutants containing a nonessential fourth chromosome (Ch16) were grown for 5 hr at restrictive temperature (36°), then plated on YSO media at permissive temperature (25°); 10-fold more mutant cells were plated than wild type to compensate for the loss of viability of the mutant. Red (dark) colonies are formed when the fourth chromosome Ch16 is lost.

If the cell division arrest is a result of incomplete DNA replication, cell cycle arrest should require replication checkpoint functions. To test this, the orp2-2 mutant was crossed to the replication checkpoint mutants rad1-1 and rad3. At 36°, the single mutant orp2-2 becomes highly elongated, indicative of cell cycle arrest. This arrest is checkpoint dependent because at 36°, the orp2-2 rad1-1 or orp2-2 rad3 double mutants continue to divide. These divisions are aberrant and result in "cut" cells and loss of viability as expected for cells that enter mitosis with incompletely replicated chromosomes (Figure 4B).

Even when checkpoint functions are intact, the orp2-2 mutation results in genetic instability. To measure chromosome stability, we used Ch16, a small derivative of chromosome III that is stably maintained as a fourth chromosome (NIWA et al. 1986 ). Ch16 is monitored by intragenic complementation between ade6-M216 on Ch16 and ade6-M210 on chromosome III. Cells with Ch16 are Ade⁺ and form white colonies on media low in adenine (YSO) whereas loss of Ch16 results in a red sector or colony. Ch16 was crossed into the orp2-2 mutant, and the cells were incubated at 36° for 5 hr, and then plated on YSO at 25°. Most cells died; ~10% survived and formed white or red colonies depending on the maintenance of Ch16 (Figure 4C). In this experiment, ~50% of surviving orp2-2 mutants lost Ch16 compared with only 1 in 1000 loss events in wild type. Chromosome loss readily accounts for the loss of viability of orp2-2 at restrictive temperature. Finally, plasmid maintenance and transformation efficiency are poor in the orp2-2 mutant even at the permissive temperature.

Analysis of cells lacking orp2 that inherit mutant orp2-2 product:
Previously, the orp2::ura4 deletion allele of orp2 was analyzed using selective spore germination. Unexpectedly, we found that nearly two complete cycles of DNA replication were achieved by the orp2::ura4 cells. We hypothesized that this was due to wild-type protein inherited by the spores. We have now used the orp2-2 mutant to ask directly whether cycles of DNA replication are carried out using orp2 protein inherited from the parent.

To create a population of cells with the orp2 gene deleted, we selectively germinated spores containing orp2::ura4. The diploid strain orp2-2/orp2::ura4 (JLP242) was constructed for comparison with the previously studied diploid orp2⁺/orp2::ura4 (JLP46). Both diploids were grown and sporulated at permissive temperature (27°), and spores were germinated in media lacking uracil at either 29° or 34°. The restrictive temperature of 34° was chosen because preliminary experiments had shown that germination is poor at 36.5° in the strains used.

If DNA replication in orp2::ura4 germinating spores depends on inherited protein, then spores that inherit mutant protein may show more severe DNA replication defects than cells inheriting wild-type protein. FACS analysis of the germinating spore population shows that initial DNA replication is slow in spores that inherit mutant protein compared to the spores that inherited wild-type protein. Indeed, there is a clear difference between these two populations even at 29°, the permissive temperature for replication and growth of orp2-2 strains (Figure 5). It appears that inherited mutant Orp2-2 protein does not support replication as well as similarly inherited wild-type protein. We had shown that spores inheriting wild-type orp2 product were able to replicate their genome approximately twice (LEATHERWOOD et al. 1996 ). This strongly suggests that the protein is stable and functional through successive cell cycles. Such stable inheritance of Orp2 is consistent with a role for ORC in epigenetic inheritence.

View larger version (63K): In this window In a new window Download PPT slide   Figure 5. Selective spore germination of orp2 deletion spores. (A) orp2+/orp2::ura4+ parent JLP46 and (B) orp2-2/orp2::ura4+ parent JLP242. Spores were germinated in media lacking uracil so that only the orp2::ura4 spores germinate. (Left) FACS analysis; (right) the cells fixed and stained with DAPI from the 14-hr, 34° sample.

In the spore germination experiment using spores from strain orp2-2/orp2::ura4 (JLP242), nearly 50% of cells entered mitosis but failed nuclear division (Figure 7). This resulted in anucleate daughter cells and unequally divided nuclei often cut by septum formation as well as cells with multiple aberrant septa. These mitotic phenotypes suggest that orp2 function is important for proper replication checkpoint control of mitosis. We had observed similar events at a low frequency in orp2::ura4 cells that inherited wild-type protein, but the effect is much more pronounced when the spores inherit mutant protein. At the time when nearly 50% of cells that inherit mutant protein have abnormal divisions, ~5% of the cells that inherit wild-type protein show this phenotype. Thus, when Orp2 is most defective, there is no checkpoint arrest in many cells and aberrant mitoses occur.

View larger version (79K): In this window In a new window Download PPT slide   Figure 6. Selective spore germination in the presence of hydroxyurea at 34°. Spores from wild-type/orp2::ura4+ parent JLP46 and orp2-2/orp2::ura4+ parent JLP242 were germinated in 15 mM HU media lacking uracil so that only the orp2::ura4+ spores germinate. (Left) FACS analysis; (right) the cells fixed and stained with DAPI.

View larger version (17K): In this window In a new window Download PPT slide   Figure 7. Selective spore germination of orp2 deletion spores; quantitation of normal and aberrant divisions by microscopic analysis of DAPI stained cells (100–300 cells were counted for each sample). Cells from the 34° experiments shown in Figure 5 and Figure 6 were analyzed. (A) Septation index counting morphologically normal divisions, "normal" being cells with a single septum in the middle of a wild-type-length cell (~8–12 µm long) with clearly divided nuclei. Cells that inherit wild-type orp2 product proceed through one apparently normal division, which is blocked when these cells are treated with HU. (B) Septation index counting aberrant divisions, "aberrant" being cells with multiple septa, unequally divided nuclear masses, and cut nuclei in which the septum bisects the nuclear mass.

We tested whether the checkpoint response to HU was affected by loss of orp2 function (Figure 6 and Figure 7). We repeated the selective spore germination in the presence of HU at 34°. FACS data confirm that the HU treatment largely blocked DNA replication in all populations in this experment (Figure 6). orp2 deletion spores from the orp2⁺ diploid synthesized small amounts of DNA in HU and did not enter mitosis. By contrast, when orp2 deletion spores from the orp2-2 diploid were germinated in HU, they often went on to an aberrant mitosis. These results show that a minimal level of Orp2 function is required for the restraint of mitosis by the replication checkpoint.

	DISCUSSION

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Temperature-sensitive alleles of orp2 were isolated by a new method that uses thymidine kinase as a counterselectable marker. This method will be applicable to many other situations where a counterselection is required. The two orp2 alleles studied in detail were recessive and resulted in cell division cycle arrest. The orp2-2 mutant is unable to progress through S-phase as judged by FACS analysis, it requires replication checkpoint function for cell cycle arrest, and the orp2-2 defect results in genomic instability in an otherwise wild-type strain. These phenotypes provide strong evidence that orp2 has an essential function in DNA replication.

At restrictive temperature, orp2-2 mutants arrest before mitosis. However, a further reduction in orp2 function compromises this checkpoint control. A selective spore germination experiment was used to obtain cells deleted for the orp2 gene. When spores lacking orp2 were germinated and analyzed, we found that the replication and division fates of the cells depended greatly on the orp2 product inherited from the diploid parent. When only mutant product was inherited, DNA replication was more severely impaired, and many cells were unable to arrest at the replication checkpoint and instead proceeded into an aberrant mitosis. Such cells were also unable to arrest in response to HU treatment. From this we conclude that a minimal level of orp2 function is necessary to establish DNA replication checkpoint control.

One unexplained oddity in the data is that there were two populations of cells in the spore germination experiments: cells of ~1N DNA (i.e., cells that synthesized little or no DNA) and cells of ~2N DNA (Figure 5A and Figure B). The 1N cells were not ungerminated spores (MATERIALS AND METHODS). We do not know why there were two populations of cells. However, we were interested in whether the ~1N cells had synthesized any DNA at all. As a preliminary test, we treated germinating spores with hydroxyurea (Figure 6), with the idea that if cells were replicating even a small amount of DNA, then the presence of hydroxyurea would induce a damage response and cause a checkpoint arrest. However, we found that about half of the orp2 cells that inherit orp2-2 product went on to an aberrant mitosis whether hydroxyurea was present or not. This result encourages us to speculate that perhaps the cells appearing to be 1N truly are 1N and have not replicated any DNA at all.

Furthermore, there is a good correlation between the number of cells that appear to be 1N and the number that go on to an aberrant mitosis. In Figure 5A, ~5% of the orp2 cells that inherit orp2⁺ product remain at 1N, and ~5% of the cells undergo aberrant mitosis (Figure 7). In Figure 5B, about half of the opr2 cells that inherit orp2-2 product remain at 1N, and about half of the cells undergo aberrant mitosis (Figure 7).

There are several possible interpretations of these results, but we favor the idea that the role of Orp2 in checkpoint signaling is to establish replication forks, which in turn initiate checkpoint signals that prevent mitosis. That is, we propose that there is no checkpoint for a lack of DNA replication; rather, the checkpoint is activated by ongoing (or aberrant) DNA replication. Thus, in a cell completely lacking replication, no checkpoint is triggered and mitosis occurs.

There is now a long list of genes that affect both DNA replication and the replication checkpoint. In fission yeast, these genes include orp2 (this article), orp1, cdc18, cdt1, pol1 (DNA polymerase ), rad11 (RPA), rfc2 (RFC), and cut5 (KELLY et al. 1993 ; SAKA and YANAGIDA 1993 ; SAKA et al. 1994 ; HOFMANN and BEACH 1994 ; D'URSO et al. 1995 ; GRALLERT and NURSE 1996 ; CARLSON et al. 1997 ; PARKER et al. 1997 ; REYNOLDS et al. 1999 ). In budding yeast, these genes include CDC6 (a homolog of cdc18), CDC7, DBF4, and RFC5 (RFC) (PIATTI et al. 1995 ; TOYN et al. 1995 ; SUGIMOTO et al. 1996 ; TAVORMINA et al. 1997 ; NOSKOV et al. 1998 ). In general, it has been found that alleles of these genes that allow little or no replication also fail to give a checkpoint arrest. That mutations in so many different factors have such similar defects leads us to favor the model that all of these mutants are checkpoint defective because they fail in a common event, namely the formation of replication forks.

The cut5 mutant may be in a special class, since cut5 cells are checkpoint defective even after replication forks have been initiated (SAKA et al. 1994 ). Thus Cut5 may directly link the replication machinery with checkpoint machinery or may be part of the checkpoint machinery. Dbp11, the budding yeast homolog of Cut5, is similarly required for replication and for checkpoint responses. The function of Dbp11 appears related to that of polymerase (ARAKI et al. 1995 ), consistent with the idea that replication forks generate checkpoint signals (NAVAS et al. 1995 ).

An alternative model is that prereplication complexes themselves mark the DNA as unreplicated and thereby signal that replication is not completed. In the context of this model, one might imagine that, e.g., the Orp2-2 protein is defective in forming the prereplication complex and therefore triggers neither replication nor the checkpoint. The existence in budding yeast of alleles of orc5 and orc2 that can inhibit mitosis after replication has been completed (DILLIN and RINE 1998 ) is consistent with this idea; these might be alleles that form the aberrant prereplicative complex-like structures that can continue to inhibit mitosis even after replication is completed and normal prereplication complexes have been dissassembled. The fission yeast orp2-2 allele that we have characterized does not inhibit mitosis after replication is complete, but it should be possible to screen for this type of mutant in fission yeast.

	ACKNOWLEDGMENTS

We thank Christine Alfano for provocative discussions on the nature of replication checkpoints. This work was supported by grants from the American Cancer Society and the Sidney Kimmel Foundation to J.L. and National Institutes of Health grant GM46006 to P.R.

Manuscript received February 1, 1999; Accepted for publication October 21, 1999.

	LITERATURE CITED

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

APOLINARIO, E., M. NOCERO, M. JIN, and C. S. HOFFMAN, 1993  Cloning and manipulation of the Schizosaccharomyces pombe his7⁺ gene as a new selectable marker for molecular genetic studies. Curr. Genet. 24:491-495[Medline].

ARAKI, H., S. H. LEEM, A. PHONGDARA, and A. SUGINO, 1995  Dpb11, which interacts with DNA polymerase II(epsilon) in Saccharomyces cerevisiae, has a dual role in S-phase progression and at a cell cycle checkpoint. Proc. Natl. Acad. Sci. USA 92:11791-11795[Abstract/Free Full Text].

BELL, S. P. and B. STILLMAN, 1992  ATP-dependent recognition of eukaryotic origins of DNA replication by a multiprotein complex. Nature 357:128-134[Medline].

BROEK, D., R. BARTLETT, K. CRAWFORD, and P. NURSE, 1991  Involvement of p34cdc2 in establishing the dependency of S phase on mitosis. Nature 349:388-393[Medline].

CADWELL, R. C. and G. F. JOYCE, 1992  Randomization of genes by PCR mutagenesis. PCR Methods Appl. 2:28-33[Medline].

CARLSON, C. R., B. GRALLERT, R. BERNANDER, T. STOKKE, and E. BOYE, 1997  Measurement of nuclear DNA content in fission yeast by flow cytometry. Yeast 13:1329-1335[Medline].

CLYNE, R. K. and T. J. KELLY, 1995  Genetic analysis of an ARS element from the fission yeast Schizosaccharomyces pombe. EMBO J. 14:6348-6357[Medline].

D'URSO, G., B. GRALLERT, and P. NURSE, 1995  DNA polymerase alpha, a component of the replication initiation complex, is essential for the checkpoint coupling S phase to mitosis in fission yeast. J. Cell Sci. 108:3109-3118[Abstract].

DILLIN, A. and J. RINE, 1998  Roles for ORC in M phase and S phase. Science 279:1733-1737[Abstract/Free Full Text].

DUBEY, D. D., S. M. KIM, I. T. TODOROV, and J. A. HUBERMAN, 1996  Large, complex modular structure of a fission yeast DNA replication origin. Curr. Biol. 6:467-473[Medline].

FISHER, D. L. and P. NURSE, 1996  A single fission yeast mitotic cyclin B p34cdc2 kinase promotes both S-phase and mitosis in the absence of G1 cyclins. EMBO J. 15:850-860[Medline].

GAVIN, K. A., M. HIDAKA, and B. STILLMAN, 1995  Conserved initiator proteins in eukaryotes. Science 270:1667-1671[Abstract/Free Full Text].

GRALLERT, B. and P. NURSE, 1996  The Orc1 homolog Orp1 in fission yeast plays a key role in regulating onset of S phase. Genes Dev. 10:2644-2654[Abstract/Free Full Text].

GRIVELL, A. R. and J. F. JACKSON, 1968  Thymidine kinase: evidence for its absence from Neurospora crassa and some other micro-organisms, and the relevance of this to the specific labeling of deoxyribonucleic acid. J. Gen. Microbiol. 54:307-317[Abstract/Free Full Text].

HAYLES, J., D. FISHER, A. WOOLLARD, and P. NURSE, 1994  Temporal order of S phase and mitosis in fission yeast is determined by the state of the p34cdc2-mitotic B cyclin complex. Cell 78:813-822[Medline].

HOFMANN, J. F. and D. BEACH, 1994  cdt1 is an essential target of the Cdc10/Sct1 transcription factor: requirement for DNA replication and inhibition of mitosis. EMBO J. 13:425-434[Medline].

HUBERMAN, J. A., 1998  DNA replication: choosing a place to begin. Science 281:929-930[Free Full Text].

ISHIAI, M., F. B. DEAN, K. OKUMURA, M. ABE, and K. Y. MOON et al., 1997  Isolation of human and fission yeast homologues of the budding yeast origin recognition complex subunit ORC5: human homologue (ORC5L) maps to 7q22. Genomics 46:294-298[Medline].

JALLEPALLI, P. V., G. W. BROWN, M. MUZI-FALCONI, D. TIEN, and T. J. KELLY, 1997  Regulation of the replication initiator protein p65cdc18 by CDK phosphorylation. Genes Dev. 11:2767-2779[Abstract/Free Full Text].

KELLY, T. J., G. S. MARTIN, S. L. FORSBURG, R. J. STEPHEN, and A. RUSSO et al., 1993  The fission yeast cdc18+ gene product couples S phase to START and mitosis. Cell 74:371-382[Medline].

KORNBERG, A., and T. A. BAKER, 1992 DNA Replication. W. H. Freeman, New York.

LEATHERWOOD, J., 1998  Emerging mechanisms of eukaryotic DNA replication initiation. Curr. Opin. Cell Biol. 10:742-748[Medline].

LEATHERWOOD, J., A. LOPEZ-GIRONA, and P. RUSSELL, 1996  Interaction of Cdc2 and Cdc18 with a fission yeast ORC2-like protein. Nature 379:360-363[Medline].

LOPEZ-GIRONA, A., O. MONDESERT, J. LEATHERWOOD, and P. RUSSELL, 1998  Negative regulation of Cdc18 DNA replication protein by Cdc2. Mol. Biol. Cell. 9:63-73[Abstract/Free Full Text].

MAUNDRELL, K., 1993  Thiamine-repressible expression vectors pREP and pRIP for fission yeast. Gene 123:127-130[Medline].

MCKNIGHT, S. L., 1980  The nucleotide sequence and transcript map of the herpes simplex virus thymidine kinase gene. Nucleic Acids Res. 8:5949-5964[Abstract/Free Full Text].

MCLEOD, M., M. STEIN, and D. BEACH, 1987  The product of the mei3⁺ gene, expressed under the control of the mating-type locus, induces meiosis and sporulation in fission yeast. EMBO J. 6:729-736[Medline].

MONDESERT, O., C. H. MCGOWAN, and P. RUSSELL, 1996  Cig2, a B-type cyclin, promotes the onset of S in Schizosaccharomyces pombe. Mol. Cell. Biol. 16:1527-1533[Abstract].

MORENO, S., A. KLAR, and P. NURSE, 1991  Molecular genetic analysis of fission yeast Schizosaccharomyces pombe.. Methods Enzymol. 194:795-823[Medline].

MUZI-FALCONI, M. and T. J. KELLY, 1995  Orp1, a member of the Cdc18/Cdc6 family of S-phase regulators, is homologous to a component of the origin recognition complex. Proc. Natl. Acad. Sci. USA 92:12475-12479[Abstract/Free Full Text].

NAVAS, T. A., Z. ZHOU, and S. J. ELLEDGE, 1995  DNA polymerase epsilon links the DNA replication machinery to the S phase checkpoint. Cell 80:29-39[Medline].

NISHITANI, H. and P. NURSE, 1995  p65cdc18 plays a major role controlling the initiation of DNA replication in fission yeast. Cell 83:397-405[Medline].

NIWA, O., T. MATSUMOTO, and M. YANAGIDA, 1986  Construction of a mini-chromosome by deletion and its mitotic and meiotic behavior in fission yeast. Mol. Gen. Genet. 203:397-405.

NOSKOV, V. N., H. ARAKI, and A. SUGINO, 1998  The RFC2 gene, encoding the third-largest subunit of the replication factor C complex, is required for an S-phase checkpoint in Saccharomyces cerevisiae. Mol. Cell. Biol. 18:4914-4923[Abstract/Free Full Text].

NURSE, P., 1990  Universal control mechanism regulating onset of M-phase. Nature 344:503-508[Medline].

NURSE, P. and Y. BISSET, 1981  Gene required in G1 for commitment to the cell cycle and G2 for control of mitosis in fission yeast. Nature 292:558-560[Medline].

PARKER, A. E., R. K. CLYNE, A. M. CARR, and T. J. KELLY, 1997  The Schizosaccharomyces pombe rad11+ gene encodes the large subunit of replication protein A. Mol. Cell. Biol. 17:2381-2390[Abstract].

PIATTI, S., C. LENGAUER, and K. NASMYTH, 1995  Cdc6 is an unstable protein whose de novo synthesis in G1 is important for the onset of S phase and for preventing a `reductional' anaphase in the budding yeast Saccharomyces cerevisiae. EMBO J. 14:3788-3799[Medline].

REYNOLDS, N., P. A. FANTES, and S. A. MACNEILL, 1999  A key role for replication factor C in DNA replication checkpoint function in fission yeast. Nucleic Acids Res. 27:462-469[Abstract/Free Full Text].

ROWLEY, A., S. J. DOWELL, and J. F. DIFFLEY, 1994  Recent developments in the initiation of chromosomal DNA replication: a complex picture emerges. Biochim. Biophys. Acta 1217:239-256[Medline].

SAKA, Y. and M. YANAGIDA, 1993  Fission yeast cut5+, required for S phase onset and M phase restraint, is identical to the radiation-damage repair gene rad4+. Cell 74:383-393[Medline].

SAKA, Y., P. FANTES, T. SUTANI, C. MCINERNY, and J. CREANOR et al., 1994  Fission yeast cut5+ links nuclear chromatin and M phase regulator in the replication checkpoint control. EMBO 13:5319-5329[Medline].

SCLAFANI, R. A. and W. L. FANGMAN, 1986  Thymidine utilization by TUT mutants and facile cloning of mutant alleles by plasmid conversion in S. cerevisiae.. Genetics 114:753-767[Abstract/Free Full Text].

SUGIMOTO, K., T. SHIMOMURA, K. HASHIMOTO, H. ARAKI, and A. SUGINO et al., 1996  Rfc5, a small subunit of replication factor C complex, couples DNA replication and mitosis in budding yeast. Proc. Natl. Acad. Sci. USA 93:7048-7052[Abstract/Free Full Text].

SZANKASI, P., W.-D. HEYER, P. PSHUCHERT, and J. KOHLI, 1988  DNA sequence analysis of the ade6 gene of Schizosaccharomyces pombe.. J. Mol. Biol. 204:917-925[Medline].

TAVORMINA, P. A., Y. WANG, and D. J. BURKE, 1997  Differential requirements for DNA replication in the activation of mitotic checkpoints in Saccharomyces cerevisiae. Mol. Cell. Biol. 17:3315-3322[Abstract].

TOYN, J. H., A. L. JOHNSON, and L. H. JOHNSTON, 1995  Segregation of unreplicated chromosomes in Saccharomyces cerevisiae reveals a novel G1/M-phase checkpoint. Mol. Cell. Biol. 15:5312-5321[Abstract].

WOHLGEMUTH, J. G., G. H. BULBOACA, M. MOGHADAM, M. S. CADDLE, and M. P. CALOS, 1994  Physical mapping of origins of replication in the fission yeast Schizosaccharomyces pombe. Mol. Biol. Cell 5:839-849[Abstract].

This article has been cited by other articles:

				T. M. Calonge and M. J. O'Connell Antagonism of Chk1 Signaling in the G2 DNA Damage Checkpoint by Dominant Alleles of Cdr1 Genetics, September 1, 2006; 174(1): 113 - 123. [Abstract] [Full Text] [PDF]

				M. A. Marchetti, M. Weinberger, Y. Murakami, W. C. Burhans, and J. A. Huberman Production of reactive oxygen species in response to replication stress and inappropriate mitosis in fission yeast J. Cell Sci., January 1, 2006; 119(1): 124 - 131. [Abstract] [Full Text] [PDF]

				J. A. Hodson, J. M. Bailis, and S. L. Forsburg Efficient labeling of fission yeast Schizosaccharomyces pombe with thymidine and BUdR Nucleic Acids Res., November 1, 2003; 31(21): e134 - e134. [Abstract] [Full Text] [PDF]

				M. Synnes, E. A. Nilssen, E. Boye, and B. Grallert A novel chk1-dependent G1/M checkpoint in fission yeast J. Cell Sci., September 15, 2002; 115(18): 3609 - 3618. [Abstract] [Full Text] [PDF]

				A. D. Fung, J. Ou, S. Bueler, and G. W. Brown A Conserved Domain of Schizosaccharomyces pombe dfp1+ Is Uniquely Required for Chromosome Stability following Alkylation Damage during S Phase Mol. Cell. Biol., July 1, 2002; 22(13): 4477 - 4490. [Abstract] [Full Text] [PDF]

				A. Vas, W. Mok, and J. Leatherwood Control of DNA Rereplication via Cdc2 Phosphorylation Sites in the Origin Recognition Complex Mol. Cell. Biol., September 1, 2001; 21(17): 5767 - 5777. [Abstract] [Full Text] [PDF]

				C. H. Haering, T. M. Nakamura, P. Baumann, and T. R. Cech Analysis of telomerase catalytic subunit mutants in vivo and in vitro in Schizosaccharomycespombe PNAS, June 6, 2000; 97(12): 6367 - 6372. [Abstract] [Full Text] [PDF]