| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Corresponding author: Marian Carlson, Departments of Genetics and Development and Microbiology, Columbia University, 701 W. 168th St., HSC 922, New York, NY 10032., mbc1{at}columbia.edu (E-mail)
Communicating editor: F. WINSTON
| ABSTRACT |
|---|
The Snf1 protein kinase is an essential component of the glucose starvation signalling pathway in Saccharomyces cerevisiae. We have used the two-hybrid system to identify a new protein, Sip5, that interacts with the Snf1 kinase complex in response to glucose limitation. Coimmunoprecipitation studies confirmed the association of Sip5 and Snf1 in cell extracts. We found that Sip5 also interacts strongly with Reg1, the regulatory subunit of the Reg1/Glc7 protein phosphatase 1 complex, in both two-hybrid and coimmunoprecipitation assays. Previous work showed that Reg1/Glc7 interacts with the Snf1 kinase under glucose-limiting conditions and negatively regulates its activity. Sip5 is the first protein that has been shown to interact with both Snf1 and Reg1/Glc7. Genetic analysis showed that the two-hybrid interaction between Reg1 and Snf1 is reduced threefold in a sip5
mutant. These findings suggest that Sip5 facilitates the interaction between the Reg1/Glc7 phosphatase and the Snf1 kinase.
THE Snf1 serine/threonine protein kinase is a member of a highly conserved family, including the mammalian AMP-activated protein kinase and various plant kinases (for review see ![]()
![]()
![]()
![]()
![]()
The conformation of the Snf1 complex is also affected by the Reg1/Glc7 protein phosphatase 1 (PP1) complex (![]()
![]()
![]()
![]()
A detailed understanding of the regulation of Snf1 kinase activity will require the identification of all of the proteins that interact with the kinase. Previously, the two-hybrid system has proved useful in identifying such proteins. Sip1 and Sip2 (for Snf1-interacting-protein) were identified in a two-hybrid screen and shown to be components of the kinase complex (![]()
![]()
![]()
![]()
![]()
![]()
| MATERIALS AND METHODS |
|---|
Strains and genetic methods:
The S. cerevisiae strains used are listed in Table 1. Standard methods for yeast genetic analysis and transformation were used (![]()
|
Plasmids:
Plasmids used in this study are listed in Table 2. pKL8, which expresses GBD-Snf11-309 from the SNF1 promoter, was constructed in several steps. First, a 1.0-kb EcoRI/HincII fragment from pCEsnf1
8 (![]()
![]()
![]()
|
To construct pKL15 (GAD-Sip5), a BamHI/XhoI fragment covering the entire coding region of SIP5 was amplified by PCR from plasmid pKB111 (![]()
![]()
![]()
pKL34, which expresses HA-Sip5 from the SIP5 promoter, was constructed in several steps. First, a 5.0-kb SacI fragment from pKB111 was subcloned into pRS424 (![]()
![]()
Oligonucleotides:
Oligonucleotides used as primers in PCR were the following: KL7: GCGCGGATCCATGAAGCTACTGTCTTCTATCGAAC (BamHI site underlined), KL8: GCGCGCGGCCGCTAATTAATCAGTCAACTTTGAACCAATCGTCTG(NotI site underlined), KL16: GACGGATCCCCATGGGTAATGTTCCAGGG (BamHI site underlined), KL17: GACTCGAGTATGGTCTCAAAGAGGTGTTTCT (XhoI site underlined), KL22: CCATGGGCCGCATCTTTTACCCATACG (NcoI site underlined), KL23: CCATGGGGCGGCCGCACTGAGCAGCC (NcoI site underlined), KL24: TCACGACATAAGAACACCTTTGGTGG, KL28: CATAAAATGTAAGCTTTCGGGGC.
Two-hybrid screen:
A two-hybrid screen (![]()
![]()
![]()
![]()
Disruption of chromosomal SIP5 locus:
To construct the sip5
::hisG mutation, we first subcloned a 1.8-kb SalI/XbaI fragment from pKB111 (![]()
![]()
::hisG allele. The same fragment was used to obtain sip5
::hisG derivatives of MCY2652 and MCY1854.
|
To construct the sip5
::HIS3 allele, we cloned the BamHI/AflIII HIS3 fragment from pPL3.1 (![]()
::HIS3 by PCR amplification of genomic DNA with oligos KL16, KL17, and the HIS3-specific oligo KL24. sip5
::HIS3 disruptants were tested for growth on YEP medium containing either 2% glucose, 3% glycerol, 3% ethanol, 2% raffinose plus antimycin A (100 µg/ml), 2% galactose plus antimycin A (100 µg/ml), or 2% sucrose plus the glucose analog 2-deoxyglucose (200 µg/ml).
The sip5
::TRP1 allele was constructed by subcloning the HIS3 fragment used above into the SpeI/NcoI sites of pKL16 to give pKL35, which then contained a PstI site 14 bp 3' to the NcoI/AflIII junction. A 0.7-kb PstI/EcoRI fragment from YDp-W (![]()
Invertase and ß-galactosidase assays:
Invertase activity was assayed in whole cells as previously described (![]()
![]()
![]()
Preparation of cell extracts by the fast boiling method:
Cells corresponding to 1 unit A600 were collected by rapid centrifugation (14,000 rpm, 1 min), resuspended in 100 µl of Laemmli sample buffer, and boiled for 3 min. Glass beads (0.3 g, 450 µm diameter) were added to the suspension, and cells were vortexed at full speed for 30 sec. The suspension was boiled again for 3 min and centrifuged at 14,000 rpm for 1 min. A total of 10 µl of the supernatant was used for immunodetection.
Coimmunoprecipitation assays:
Preparation of protein extracts and immunoprecipitation procedures were essentially as described previously (![]()
)-LexA or
-HA monoclonal antibody (1 µl) was used in each immunoprecipitation reaction, and precipitates were analyzed by Western blotting.
Immunoblot analysis:
Proteins were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and analyzed by immunoblotting using polyclonal
-Snf1 (![]()
-HA (Boehringer Mannheim), or monoclonal
-LexA (Clontech, Palo Alto, CA). Antibodies were detected by enhanced chemiluminescence with ECL or ECL Plus reagents (Amersham, Piscataway, NJ).
| RESULTS |
|---|
Identification of Sip5 in a two-hybrid screen for interaction with the kinase domain of Snf1:
A two-hybrid screen for proteins that interact with the catalytic domain of Snf1 was carried out. A fusion between GBD and the kinase domain of Snf1, GBD-Snf11-309, was used as a bait to screen a library of cDNAs fused to GAD. Of the 22 clones recovered, 1 (clone 1-24) contained an in-frame fusion to codon 242 of an open reading frame (ORF) of unknown function on chromosome XIII (YMR140w) (Fig 1). The gene, designated SIP5, encodes a protein of 489 amino acids with a predicted molecular mass of 55.9 kD. Sip5 is not homologous to any other protein encoded by the S. cerevisiae genome and shows only a weak homology with a putative zinc-finger protein from Schizosaccharomyces pombe (AL031853) of unknown function.
To examine further the interaction between Sip5 and Snf1, we expressed the full-length Sip5 protein fused in frame to GAD and tested the resulting GAD-Sip5 protein in combination with a LexA fusion to Snf1. Interaction was monitored by assaying ß-galactosidase expression from a lacZ reporter containing LexA-binding sites. GAD-Sip5 did not interact significantly with LexA-Snf1 in glucose-grown cells (Table 3). The interaction increased when cells were shifted to low (0.05%) glucose for 3 hr and was strong in cells growing in 2% galactose/2% glycerol/2% ethanol/0.05% glucose (gal/gly/EtOH) medium, indicating that the interaction between Sip5 and Snf1 is glucose regulated. No interaction was detected between GAD-Sip5 and a LexA fusion to Snf4, the activating subunit of the kinase complex. The two-hybrid assay does not always detect indirect interactions; however, this negative result also does not exclude direct interaction between Sip5 and Snf4.
|
Sip5 coimmunoprecipitates with Snf1:
To confirm the interaction between Sip5 and Snf1 detected in the two-hybrid assay, we sought biochemical evidence for the association of these proteins. Protein extracts were prepared from wild-type cells expressing HA-Sip5 and LexA-Snf1. Immunoblot analysis detected two HA-Sip5 polypeptides migrating at 78 and 73 kD, the smaller species presumably corresponding to a degradation product (Fig 2A, middle). LexA-Snf1 was immunoprecipitated with
-LexA monoclonal antibodies, and the precipitates were analyzed by SDS-PAGE and immunoblotting with
-HA monoclonal antibodies. The 78-kD HA-Sip5 species coimmunoprecipitated with LexA-Snf1 (Fig 2A, top). In control experiments, HA-Sip5 did not coimmunoprecipitate with LexA or LexA-Mig1. Coimmunoprecipitation assays cannot be used to assess the glucose regulation of the Sip5-Snf1 interaction because even when cells are grown in high glucose, the Snf1 kinase is active in this assay (![]()
![]()
|
Because the Sip5 protein sequence contains a putative Snf1 phosphorylation consensus site (![]()
mutant cells expressing HA-Sip5 were grown in high glucose and were then shifted to low glucose. Immunoblot analysis of proteins prepared under both growth conditions showed no differences in the mobility of HA-Sip5 (data not shown). In addition, in vitro kinase assays of Snf1 immune complexes in strains disrupted for SIP5 (sip5
::HIS3, see below) or carrying a multicopy SIP5 plasmid (pKL26) showed the wild-type pattern of phosphorylated products (data not shown). Thus, these experiments provided no evidence that Snf1 phosphorylates Sip5.
Sip5 interacts with the Reg1/Glc7 protein phosphatase complex:
Previous studies showed that the Snf1 protein kinase interacts with Reg1, a regulatory subunit of the protein phosphatase complex (![]()
|
To determine whether the interaction of Sip5 with Reg1 requires the presence of Glc7 complexed to Reg1, we used a mutated form of Reg1, Reg1F468R, which has an alteration in the conserved Glc7-binding site (![]()
mutation (see below) also did not affect this interaction. These experiments do not exclude the possibility of competition for binding, because the two-hybrid partners are overexpressed, but provide no support for this idea.
Sip5 coimmunoprecipitates with Reg1:
The interaction between Sip5 and the Reg1/Glc7 phosphatase complex was confirmed by coimmunoprecipitation. Protein extracts were prepared from a sip5
::hisG strain (MCY3914; see below) expressing HA-Reg1 and LexA-Sip5. Proteins were immunoprecipitated with
-LexA, and the precipitates were analyzed by SDS-PAGE and immunoblotting with
-HA. HA-Reg1 coimmunoprecipitated with LexA-Sip5 (Fig 2B). In addition, protein extracts from wild-type transformants expressing LexA-Glc7 and HA-Sip5 were immunoprecipitated with
-HA antibodies, and the precipitated proteins were subjected to immunoblot analysis with
-LexA. LexA-Glc7 coimmunoprecipitated with HA-Sip5 (Fig 2C). This coimmunoprecipitation may be an indirect result of the association between Reg1 and Sip5, as no significant two-hybrid interaction was detected between Glc7 and Sip5, but it also remains possible that Glc7 and Sip5 interact directly.
Disruption of the SIP5 gene:
To examine the phenotype of a sip5 null mutant, the sip5
::hisG allele (see MATERIALS AND METHODS and Fig 1) was introduced into a diploid strain (MCY3015). Tetrad analysis of the heterozygous diploid yielded viable sip5 mutant segregants, which showed wild-type growth on glucose and raffinose and were unable to grow on sucrose in the presence of the glucose analog 2-deoxyglucose, indicating that both glucose repression and derepression of SUC2 expression occur normally. The mutation sip5
::HIS3 (see Fig 1) was also introduced into a haploid strain (MCY2921). The disruptant showed the same phenotype as the parent strain with respect to growth on different carbon sources, tolerance to high salt (1 M NaCl or 1 M KCl), 2 M ethylene glycol, 6% ethanol, or 3% formamide, and regulation of invertase synthesis. In addition, a diploid homozygous for sip5
(MCY3910 x MCY3918) was able to sporulate and yielded viable spores.
We also constructed the double mutants snf1
10 sip5
::hisG, snf4
2 sip5
::hisG, and reg1
::URA3 sip5
::HIS3, which behaved like the corresponding single mutant parents with respect to all the phenotypes tested above. Finally, we disrupted SIP5 in a sip1
sip2
gal83
triple mutant (MCY2728). One member of the Sip1/Sip2/Gal83 family is present in a kinase complex and interacts with both Snf1 and Snf4, and in the triple mutant about half of the cellular Snf4 protein is no longer associated with Snf1; this is not sufficient to cause any pronounced Snf1-related growth defect (![]()
::HIS3 quadruple mutant (MCY3907) resembled the parent triple mutant with respect to growth on different carbon sources, but the derepressed invertase activity was elevated 1.5-fold in comparison to the parental strain: 465 ± 54 vs. 307 ± 35 units in cells shifted to 0.05% glucose for 3 hr (values are the average of 10 quadruple mutants and 4 triple mutants, which carried the empty vector pEG202 so that the auxotrophic markers would be the same in both strains).
To assess the effects of Sip5 on protein-protein interactions within and between the Snf1 and Reg1/Glc7 complexes we introduced sip5
::TRP1 into strain CTY10-5d and assayed ß-galactosidase activity resulting from two-hybrid interactions (Fig 4). In the sip5
mutant, the interaction between LexA-Snf1 and Snf4-GAD in low glucose increased 1.5-fold, suggesting that the absence of Sip5 slightly favors the active conformation of the kinase complex. The sip5
mutation did not affect the interaction between LexA-Reg1 and GAD-Glc7. However, the interaction between LexA-Reg1 and VP16-Snf1 in low glucose was reduced 3-fold. We also assayed the interaction between LexA-Reg1 and VP16-Snf1K84R, an inactive mutant with a substitution of the invariant lysine in the ATP-binding site (![]()
![]()
|
Various other assays revealed no phenotype. The N terminus of Reg1 (LexA-Reg11-400) is rapidly phosphorylated, dependent on Snf1, when cells are shifted to medium containing low glucose, and then it is dephosphorylated when glucose is added back (P. SANZ and M. CARLSON, unpublished results). In a sip5
mutant, this phosphorylation and dephosphorylation followed the same kinetics as in wild type (data not shown). Finally, we detected no mutant phenotype in cells overexpressing Sip5.
| DISCUSSION |
|---|
We have used the two-hybrid system to identify a new protein, Sip5, that interacts with the Snf1 protein kinase complex in response to glucose limitation. Coimmunoprecipitation studies confirmed the association of Sip5 with Snf1. Previously, Snf1 was shown to interact with Reg1, the regulatory subunit of the Reg1/Glc7 protein phosphatase complex, under glucose-limiting conditions, and we therefore tested for interaction between Sip5 and Reg1. We show that Sip5 interacts strongly with Reg1 in the two-hybrid assay and that this interaction is not inhibited by glucose. Coimmunoprecipitation studies confirmed the association of Sip5 with Reg1/Glc7. Thus, Sip5 is the first protein that has been shown to interact with both the Snf1 kinase complex and the Reg1/Glc7 phosphatase complex.
Two lines of evidence suggest that Sip5 interacts primarily with the Reg1 component of the phosphatase complex. Sip5 did not interact with the catalytic subunit Glc7 in the two-hybrid system, and Sip5 interacted better with the Reg1F468R mutant protein, which is defective in binding Glc7 (![]()
Genetic analysis of sip5
mutants revealed no striking phenotypic differences from the wild type with respect to growth on different carbon sources, tolerance to different stress conditions, sporulation, or germination. No synergy nor synthetic lethal phenotypes were observed in mutants carrying sip5
in combination with snf1
, snf4
, or reg1
. However, evidence suggests that Sip5 has a modest role as a negative regulator of the Snf1 kinase. First, the introduction of sip5
into the sip1
sip2
gal83
triple mutant caused a 1.5-fold increase in derepression of invertase activity; the absence of the Sip1/Sip2/Gal83 component may make the Snf1 kinase complex more sensitive to loss of Sip5. The two-hybrid interaction between Snf1 and Snf4 in glucose-limited cells, which is an indicator of an open, active conformation of the kinase complex, was also 1.5-fold higher in a sip5
mutant than in the wild type. Finally, the most significant phenotype detected was an effect of sip5
on the interaction of Reg1 and Snf1. The two-hybrid interaction between Reg1 and Snf1 was reduced 3-fold in a sip5
mutant relative to the wild type.
These genetic findings suggest that Sip5 negatively regulates the Snf1 kinase by promoting the interaction of Reg1/Glc7 with the kinase. When taken together with the physical interaction of Sip5 with both Snf1 and Reg1, these results suggest that Sip5 directly facilitates the interaction between the Reg1/Glc7 phosphatase and the Snf1 kinase when glucose is limiting (Fig 5). Reg1/Glc7 functions to promote the transition of the active complex back to the autoinhibited state. The Snf1 kinase plays a central role in a regulatory response that is crucial to the yeast cell, and evidence indicates that the activity of this kinase is highly regulated, by multiple regulatory mechanisms. Sip5 appears to contribute to one of these mechanisms.
|
| FOOTNOTES |
|---|
1 These authors contributed equally to this work. ![]()
| ACKNOWLEDGMENTS |
|---|
We thank Steve Elledge for generously providing strains and the cDNA library. We thank Peter Sherwood and Olivier Vincent for useful discussion. P.S. was supported by a Formacion de Profesorado Universitario program fellowship from the Spanish Ministry of Education and Culture. This work was supported by grant GM-34095 from the National Institutes of Health to M.C.
Manuscript received July 20, 1999; Accepted for publication September 15, 1999.
| LITERATURE CITED |
|---|
ALANI, E. and N. KLECKNER, 1987 A new type of fusion analysis applicable to many organisms: protein fusions to the URA3 gene of yeast. Genetics 117:5-12
ALMS, G. R., P. SANZ, M. CARLSON, and T. A. HAYSTEAD, 1999 Reg1p targets protein phosphatase 1 to dephosphorylate hexokinase PII in Saccharomyces cerevisiae: characterizing the effects of a phosphatase subunit on the yeast proteome. EMBO J. 18:4157-4168[Medline].
BERBEN, G., J. DUMONT, V. GILLIQUET, P. A. BOLLE, and F. HILGER, 1991 The YDp plasmids: a uniform set of vectors bearing versatile gene disruption cassettes for Saccharomyces cerevisiae.. Yeast 7:475-477[Medline].
BOWDISH, K. S., H. E. YUANG, and A. P. MITCHELL, 1994 Analysis of RIM11, a yeast protein kinase that phosphorylates the meiotic activator IME1.. Mol. Cell. Biol. 14:7909-7919
CELENZA, J. L. and M. CARLSON, 1986 A yeast gene that is essential for release from glucose repression encodes a protein kinase. Science 233:1175-1180
CELENZA, J. L. and M. CARLSON, 1989 Mutational analysis of the Saccharomyces cerevisiae SNF1 protein kinase and evidence for functional interaction with the SNF4 protein. Mol. Cell. Biol. 9:5034-5044
CHRISTIANSON, T. W., R. S. SIKORSKI, M. DANTE, J. H. SHERO, and P. HIETER, 1992 Multifunctional yeast high-copy-number shuttle vectors. Gene 110:119-122[Medline].
DALE, S., W. WILSON, A. EDELMAN, and D. G. HARDIE, 1995 Similar substrate recognition motifs for mammalian AMP-activated protein kinase, higher plant HMG-CoA reductase kinase-A, yeast SNF1, and mammalian calmodulin-dependent protein kinase I. FEBS Lett. 361:191-195[Medline].
DURFEE, T., K. BECHERER, P.-L. CHEN, S.-H. YEH, and Y. YANG et al., 1993 The retinoblastoma protein associates with the protein phosphatase type 1 catalytic subunit. Genes Dev. 7:555-569
ELLEDGE, S. J., J. T. MULLIGAN, S. W. RAMER, M. SPOTTSWOOD, and R. W. DAVIS, 1991
YES: a multifunctional cDNA expression vector for the isolation of genes by complementation of yeast and Escherichia coli mutations. Proc. Natl. Acad. Sci. USA 88:1731-1735
ESTRUCH, F., M. A. TREITEL, X. YANG, and M. CARLSON, 1992 N-Terminal mutations modulate yeast SNF1 protein kinase function. Genetics 132:639-650[Abstract].
FIELDS, S. and O. SONG, 1989 A novel genetic system to detect protein-protein interactions. Nature 340:245-246[Medline].
GOLEMIS, E. A., I. SERBRIISKII, J. GYURIS and R. BRENT, 1997 Interaction trap/two-hybrid system to identify interacting proteins, Chapter 20.1 in Current Protocols in Molecular Biology, Vol. 4, edited by F. M. AUSUBEL, R. BRENT, R. E. KINGSTON, D. D. MOORE, J. G. SEIDMAN et al. John Wiley and Sons, New York.
HARDIE, D. G., D. CARLING, and M. CARLSON, 1998 The AMP-activated/SNF1 protein kinase subfamily: metabolic sensors of the eukaryotic cell? Annu. Rev. Biochem. 67:821-855[Medline].
JIANG, R. and M. CARLSON, 1996 Glucose regulates protein interactions within the yeast SNF1 protein kinase complex. Genes Dev. 10:3105-3115
JIANG, R. and M. CARLSON, 1997 The Snf1 protein kinase and its activating subunit, Snf4, interact with distinct domains of the Sip1/Sip2/Gal83 component in the kinase complex. Mol. Cell. Biol. 17:2099-2106[Abstract].
LEGRAIN, P., M.-C. DOKHELAR, and C. TRANSY, 1994 Detection of protein-protein interactions using different vectors in the two-hybrid system. Nucleic Acids Res. 22:3241-3242
LESAGE, P., X. YANG, and M. CARLSON, 1994 Analysis of the SIP3 protein identified in a two-hybrid screen for interaction with the SNF1 protein kinase. Nucleic Acids Res. 22:597-603
LESAGE, P., X. YANG, and M. CARLSON, 1996 Yeast SNF1 protein kinase interacts with SIP4, a C6 zinc cluster transcriptional activator: a new role for SNF1 in the glucose response. Mol. Cell. Biol. 16:1921-1928[Abstract].
LUDIN, K., R. JIANG, and M. CARLSON, 1998 Glucose-regulated interaction of a regulatory subunit of protein phosphatase 1 with the Snf1 protein kinase in Saccharomyces cerevisiae.. Proc. Natl. Acad. Sci. USA 95:6245-6250
MILLER, J. H., 1972 Experiments in Molecular Genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
ROSE, M. D., F. WINSTON and P. HIETER, 1990 Methods in Yeast Genetics: A Laboratory Course Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
RUDEN, D. M., J. MA, Y. LI, K. WOOD, and M. PTASHNE, 1991 Generating yeast transcriptional activators containing no yeast protein sequences. Nature 350:250-252[Medline].
SONG, W. and M. CARLSON, 1998 Srb/mediator proteins interact functionally and physically with transcriptional repressor Sfl1. EMBO J. 17:5757-5765[Medline].
TREITEL, M. A., S. KUCHIN, and M. CARLSON, 1998 Snf1 protein kinase regulates phosphorylation of the Mig1 repressor in Saccharomyces cerevisiae.. Mol. Cell. Biol. 18:6273-6280
TU, J. and M. CARLSON, 1995 REG1 binds to protein phosphatase type 1 and regulates glucose repression in Saccharomyces cerevisiae.. EMBO J. 14:5939-5946[Medline].
TYERS, M., G. TOKIWA, and B. FUTCHER, 1993 Comparison of the Saccharomyces cerevisiae G1 cyclins: Cln3 may be an upstream activator of Cln1, Cln2 and other cyclins. EMBO J. 12:1955-1968[Medline].
VINCENT, O. and M. CARLSON, 1998 Sip4, a Snf1 kinase-dependent transcriptional activator, binds to the carbon source-responsive element of gluconeogenic genes. EMBO J. 17:7002-7008[Medline].
WILSON, W. A., S. A. HAWLEY, and D. G. HARDIE, 1996 Glucose repression/derepression in budding yeast: SNF1 protein kinase is activated by phosphorylation under derepressing conditions, and this correlates with a high AMP:ATP ratio. Curr. Biol. 6:1426-1434[Medline].
WOODS, A., M. R. MUNDAY, J. SCOTT, X. YANG, and M. CARLSON et al., 1994 Yeast SNF1 is functionally related to mammalian AMP-activated protein kinase and regulates acetyl-CoA carboxylase in vivo. J. Biol. Chem. 269:19509-19516
YANG, X., E. J. A. HUBBARD, and M. CARLSON, 1992 A protein kinase substrate identified by the two-hybrid system. Science 257:680-682
YANG, X., R. JIANG, and M. CARLSON, 1994 A family of proteins containing a conserved domain that mediates interaction with the yeast SNF1 protein kinase complex. EMBO J. 13:5878-5886[Medline].
This article has been cited by other articles:
![]() |
G. M. Santangelo Glucose Signaling in Saccharomyces cerevisiae Microbiol. Mol. Biol. Rev., March 1, 2006; 70(1): 253 - 282. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. Cullen and G. F. Sprague Jr. The Glc7p-Interacting Protein Bud14p Attenuates Polarized Growth, Pheromone Response, and Filamentous Growth in Saccharomyces cerevisiae Eukaryot. Cell, December 1, 2002; 1(6): 884 - 894. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |