Letter to the Editor

The Yeast HSM3 Gene Is Not Involved in DNA Mismatch Repair in Rapidly Dividing Cells

Corresponding author: Thomas D. Petes, Department of Biology, Curriculum in Genetics and Molecular Biology, University of North Carolina, Chapel Hill, NC 27599-3280., tompetes{at}email.unc.edu (E-mail)

FEDOROVA et al. (1998) reported that a null mutation of the Saccharomyces cerevisiae HSM3 gene (YBR272c) elevated the rate of spontaneous forward mutation (monitored at the CAN1 locus) by 30-fold and the rate of reversion of lys1-1 and his1-7 mutations by ~10-fold. In addition, in experiments in which heteroduplexes with base-base mismatches were transformed in hsm3 and wild-type cells, they found that the hsm3 strain had reduced efficiency of mismatch correction. The hsm3 mutation also elevated the frequency of mutations induced by 6-N-hydroxylaminopurine (6-HAP) and ultraviolet (UV) light. Hsm3p has weak sequence homology to several MutS homologues. On the basis of these and other results, Fedorova et al. suggested that HSM3 defined a new DNA mismatch repair pathway.

As described below, we have studied the hsm3 null mutant phenotype in two different strain backgrounds and have found no effect of hsm3 gene disruption on spontaneous mutation frequency or on microsatellite stability. We found a slight elevation of UV-induced mutation accumulation in hsm3 cells compared to wild-type controls (threefold at 5 J/m², data not shown). In our studies, hsm3 cells were also not sensitive to UV (254 nm), as was also observed by Fedorova et al. or the DNA-damaging agents methyl-methane sulfonate and hydroxyurea (data not shown). Finally, we obtained the hsm3 strains used in the study of FEDOROVA et al. 1998 and our CAN1 mutation rate analysis indicated no significant mutator phenotype.

We made hsm3 mutant strains in the different genetic backgrounds as described below. In one set of strains, complete deletions of HSM3 were generated according to the protocol described by WACH et al. 1994 . Briefly, polymerase chain reaction (PCR) primers with homology to genomic regions flanking HSM3 were used to amplify the kanMX4 module, which confers resistance to the drug geneticin (G418) in S. cerevisiae, as described in WACH et al. 1994 . The primers used included 18–19 nucleotides homologous to pFA6-kanMX4 (underlined) and 46–47 nucleotides homologous to the regions immediately upstream of the HSM3 start codon and downstream of the HSM3 stop codon (5' GTTTACAACTATAATCACCGCAAAAGAACTCAGCGAAACAGGAGCACGTACGCTGCAGGTCGAC 3', 5' CATTAAACAATCAAGGCCGCCTTTATAGTTGCGCTTATGCAACATAAATCGATGAATTCGAGCTCG 3'). Disruption PCR fragments thus generated were used to transform the strain MS71 ( ade5-1 trp1-289 ura3-52 his7-2; STRAND et al. 1995 ) to geneticin resistance. Two independent transformants, JDM7 and JDM8, were isolated and examined by PCR and Southern analysis to verify the deletion of HSM3. In the second set of strains, the HSM3 open reading frame (ORF) in an S288c-derived strain (TISHKOFF et al. 1997 ; a ura3-52 leu2- 1 trp1-63 his3-200 lys2-Bgl hom3-10 ade2-1 ade8) was replaced with a PCR-amplified product containing 50 bp of sequences from the 5' and 3' ends of the HSM3 ORF and the yeast selectable marker HIS3. The primers used to generate the disruption PCR product were 272CKOF 5' ATGAGTGAGAAAGAAACAAATTACGTGGAAAATCTCCTTACGCAATTAGAGGCCTCCTCTAGTACACTC 3' and 272CKOR 5' TCATCTGCAATCTGCAATCTTAGTTTCACTGCCTGTGGAATAATTTTTTCGCGCGCCTCGTTCAGAATG 3'. Independent yeast transformants were subsequently tested for gene disruption by PCR using flanking primers to the HSM3 ORF. The confirmed hsm3 knockout strain (RKY3589) had nucleotides 51–1393 (nucleotide 1 representing the first base in the ATG initiation codon) replaced with the yeast HIS3 gene.

We first analyzed the forward mutation rates at the CAN1 locus (canavanine sensitivity to canavanine resistance; MARSISCHKY et al. 1996 ; SIA et al. 1997 ; TISHKOFF et al. 1997 ) and reversion rates at the lys-Bgl and hom3-10 loci (TISHKOFF et al. 1997 ) using standard methods. The frequencies of mutants were determined in experimental sets using 10–20 independent cultures and these values were converted into mutation rates (Table 1) using the method of the median (LEA and COULSON 1949 ). Confidence intervals (95%) were calculated according to the method described previously (WIERDL et al. 1996 ). The hsm3 strains JDM7, JDM8, and RKY3589 had approximately the same rate of forward mutation at the CAN1 locus as observed in the wild-type strains (Table 1). Compared to wild-type rates, we also found no significant increases in the reversion rates at lys2-Bgl and hom3-10 sites (Table 1).

Mutations in most of the yeast DNA mismatch repair genes result in elevated rates of instability for simple repetitive DNA sequences (microsatellites; STRAND et al. 1993 ). In previous studies, we monitored microsatellite stability using the plasmid pSH44 (HENDERSON and PETES 1992 ). This plasmid contains a 33-bp in-frame insertion within the coding sequence of URA3. Yeast strains transformed with pSH44 are phenotypically Ura⁺ and, therefore, sensitive to 5-fluoroorotate (5-FOA). We demonstrated previously, by DNA sequence analysis, that most 5-FOA^R derivatives with pSH44 contain poly(GT) tracts that are altered in length (HENDERSON and PETES 1992 ). Thus, the rate of appearance of 5-FOA^R derivatives is equivalent to the rate of tract alterations. Consequently, we measured the frequencies of 5-FOA^R colonies in 16–20 independent cultures for each strain and calculated a rate of tract alterations. The hsm3 mutation had no significant effect (Table 1). The lack of effect of the hsm3 mutation on microsatellite instability and the lack of mutator phenotypes as determined by forward mutation rates at the CAN1 locus and reversion rates at lys-Bgl and hom3-10 loci are in contrast to the strong effects observed in strains with a mutation in the mismatch repair gene MSH2 (strain EAS74 and RKY2706; Table 1). Particularly noteworthy is the lack of mutator phenotypes for hsm3 cells in the hom3-10 assay, since high reversion rates at this locus are strongly correlated with mismatch repair defects (Table 1; MARSISCHKY et al. 1996 ; TISHKOFF et al. 1997 ).

To resolve the apparent contradictions in hsm3 mutator phenotypes between our study and the published data, we examined forward mutation rates at the CAN1 locus in wild-type (11D-3031) and hsm3 (2LMG-316) strains (provided by V. Korolev) used in the study of FEDOROVA et al. 1998 . We found only a small (1.6-fold) elevation in the rate of forward mutation (Table 1), much less than the 30-fold effect originally reported.

We suggest that the differences between our measurements of forward mutation rates and those of FEDOROVA et al. 1998 reflect differences in the methods used. Our experiments followed established protocols that have been used numerous times in the past for mutation studies with the CAN1 marker (MARSISCHKY et al. 1996 ; SIA et al. 1997 ; TISHKOFF et al. 1997 ). Briefly, cells were plated at high concentrations (~5 x 10⁸ cells/plate) on solid medium with concentrations of canavanine (60 µg/ml for MS71-derived and RKY2672-derived strains and 120 µg/ml for 11D-3031 and 2LMG-316 strains) that greatly reduced or eliminated residual growth of canavanine-sensitive cells; the medium was Synthetic Complete (SC; SHERMAN 1991 ) lacking arginine. Canavanine-resistant colonies were counted after 3 days of growth at 30°. In contrast, FEDOROVA et al. 1998 plated a small number of cells (2000) in small patches on plates containing concentrations of canavanine that allowed residual growth (50 µg/ml); canavanine-resistant colonies were counted after 14–15 days of incubation. One interpretation of the results obtained by FEDOROVA et al. 1998 using their methodology is that the hsm3 mutation results in a mutator phenotype in cells growing suboptimally or in stationary-phase cells. This interpretation is also consistent with the observation that hsm3 strains had elevated rates of reversion of lys1-1 and his1-7 mutations when grown in limiting amounts of lysine and histidine, respectively (FEDOROVA et al. 1998 ). Alternatively, since the media used in our experiments and those of Fedorova et al. had differences in composition in addition to the concentrations of canavanine, lysine, and histidine (V. KOROLEV, personal communication), other effects of the media could be relevant to the observed differences in the results.

In summary, we suggest that the HSM3 gene is not likely to be involved in regulating DNA mismatch repair under standard growth conditions. This gene could be involved, however, in regulating the accuracy of DNA replication or the efficiency of DNA repair in yeast cells growing under suboptimal conditions.

ACKNOWLEDGMENTS

We thank V. Korolev for providing strains used in this study. The research was supported by National Institutes of Health grants GM-50006 (R.D.K.) and GM-52319 (T.D.P.).

Manuscript received April 28, 1999; Accepted for publication August 27, 1999.

LITERATURE CITED

FEDOROVA, I. V., L. M. GRACHEVA, S. V. KOVALTZOVA, T. A. EVSTUHINA, and S. Y. ALEKSEEV et al., 1998  The yeast HSM3 gene acts in one of the mismatch repair pathways. Genetics 148:963-973[Abstract/Full Text].

HENDERSON, S. T. and T. D. PETES, 1992  Instability of simple sequence DNA in Saccharomyces cerevisiae.. Mol. Cell. Biol. 12:2749-2757[Abstract].

KOKOSKA, R. J., L. STEFANOVIC, H. T. TRAN, M. A. RESNICK, and D. A. GORDENIN et al., 1998  Destabilization of yeast micro- and minisatellite DNA sequences by mutations affecting a nuclease involved in Okazaki fragment processing (rad27) and DNA polymerase (pol3-t). Mol. Cell. Biol. 18:2779-2788[Abstract/Full Text].

LEA, D. E. and C. A. COULSON, 1949  The distribution of the number of mutants in bacterial populations. J. Genet. 49:264-285.

MARSISCHKY, G. T., N. FILOSI, M. F. KANE, and R. KOLODNER, 1996  Redundancy of Saccharomyces cerevisiae MSH3 and MSH6 in MSH2-dependent mismatch repair. Genes Dev. 10:407-420[Abstract].

SHERMAN, F., 1991 Getting started with yeast, pp. 12–18 in Guide to Yeast Genetics and Molecular Biology, edited by C. GUTHRIE and G. R. FINK. Academic Press, San Diego.

SIA, E. A., R. J. KOKOSKA, M. DOMINSKA, P. GREENWELL, and T. D. PETES, 1997  Microsatellite instability in yeast: dependence on repeat unit size and DNA mismatch repair genes. Mol. Cell. Biol. 17:2851-2858[Abstract].

STRAND, M., T. A. PROLLA, R. M. LISKAY, and T. D. PETES, 1993  Destabilization of simple repetitive DNA in yeast by mutations affecting DNA mismatch repair. Nature 365:274-276[Medline].

STRAND, M., M. C. EARLEY, G. F. CROUSE, and T. D. PETES, 1995  Mutations in the MSH3 gene preferentially lead to deletions within tracts of simple repetitive DNA in Saccharomyces cerevisiae.. Proc. Natl. Acad. Sci. USA 92:10418-10421[Abstract].

TISHKOFF, D. X., N. FILOSI, G. M. GAIDA, and R. D. KOLODNER, 1997  A novel mutation avoidance mechanism dependent on S. cerevisiae RAD27 is distinct from DNA mismatch repair. Cell 88:253-263[Medline].

WACH, A., A. BRACHAT, R. POHLMANN, and P. PHILIPPSEN, 1994  New heterologous modules for classical or PCR-based gene disruptions in Saccharomyces cerevisiae.. Yeast 10:1793-1808[Medline].

WIERDL, M., C. N. GREENE, A. DATTA, S. JINKS-ROBERTSON, and T. D. PETES, 1996  Destabilization of simple repetitive DNA sequences by transcription in yeast. Genetics 143:713-721[Abstract].