Genetics, Vol. 154, 413-420, January 2000, Copyright © 2000

Sequence and Structural Diversity of the S Locus Genes From Different Lines With the Same Self-Recognition Specificities in Brassica oleracea

Makoto Kusabaa, Masanori Matsushita1,a, Keiichi Okazaki2,a, Yoko Sattab, and Takeshi Nishioc
a Institute of Radiation Breeding, National Institute of Agrobiological Resources, Ministry of Agriculture, Forestry and Fisheries, Ohmiya-machi, Naka-gun, Ibaraki, 319-2293, Japan,
b Graduate University of Advanced Studies, Hayama, Kanagawa, 240-01, Japan
c Graduate School of Agricultural Science, Tohoku University Aoba-ku, Sendai, 981-8555, Japan

Corresponding author: Makoto Kusaba, Institute of Radiation Breeding, National Institute of Agrobiological Resources, P.O. Box 3, Ohmiya-machi, Naka-gun, Ibaraki-ken, 319-2293, Japan., kusaba{at}irb.affrc.go.jp (E-mail)

Communicating editor: M. K. UYENOYAMA


*  ABSTRACT
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Self-incompatibility (SI) is a mechanism for preventing self-fertilization in flowering plants. In Brassica, it is controlled by a single multi-allelic locus, S, and it is believed that two highly polymorphic genes in the S locus, SLG and SRK, play central roles in self-recognition in stigmas. SRK is a putative receptor protein kinase, whose extracellular domain exhibits high similarity to SLG. We analyzed two pairs of lines showing cross-incompatibility (S2 and S2-b; S13 and S13-b). In S2 and S2-b, SRKs were more highly conserved than SLGs. This was also the case with S13 and S13-b. This suggests that the SRKs of different lines must be conserved for the lines to have the same self-recognition specificity. In particular, SLG2-b showed only 88.5% identity to SLG2, which is comparable to that between the SLGs of different S haplotypes, while SRK2-b showed 97.3% identity to SRK2 in the S domain. These findings suggest that the SLGs in these S haplotypes are not important for self-recognition in SI.


MANY flowering plants show self-incompatibility (SI), which prevents self-fertilization. In Brassicaceae, pollen tube development from self-pollen is specifically inhibited on the stigma (NASRALLAH and NASRALLAH 1993 Down). This inhibition is controlled by a single multi-allelic locus, S. The S locus in fact comprises a number of genes, including SLG (the S-glycoprotein gene) and SRK (the S-locus receptor kinase gene). SRK is a highly polymorphic gene that encodes a putative transmembrane receptor protein kinase. SLG shows high similarity to the putative ligand-binding domain of SRK (the S domain). SLG and the S domain of SRK have basically the same structure, including 12 conserved cysteine residues and three regions that are hypervariable between different S haplotypes (KUSABA et al. 1997 Down).

It is believed that SLG and SRK play central roles in the recognition event in stigmas. Both SLG and SRK are expressed predominantly in stigmas just before flowering, the stage of expression of SI. MATTON et al. 1997 Down suggested that the hypervariable regions of S-RNase, a determinant of the self-recognition specificity in the style of the Solanaceae (LEE et al. 1994 Down; MURFETT et al. 1994 Down), are responsible for the determination of the specificity. Similarly, the hypervariable regions of SLG and SRK may be determinants of self-recognition in Brassica. An unknown pollen gene in the S locus, encoding a ligand for SLG and SRK, is thought to function in the recognition event. A physiological experiment has suggested that the pollen product is a small molecule in the pollen coating (STEPHENSON et al. 1997 Down). In this context, the hypervariable regions of SLG and SRK may be ligand binding sites.

SLG and SRK alleles are assigned, on the basis of sequence similarity, to class I and class II. Class I SLGs and SRKs exhibit ~65% similarity in amino acid sequence to class II SLGs and SRKs (NASRALLAH et al. 1991 Down), compared to the ~80% similarity typical of within-class comparisons. Class I S haplotypes, which comprise a class I SLG and a class I SRK, constitute most of the known Brassica S haplotypes (HATAKEYAMA et al. 1998 Down; OKAZAKI et al. 1999 Down). All class II S haplotypes are recessive in pollen to all class I S haplotypes and are thought to express weak SI. These characteristics of class II S haplotypes are considered to be related to a structural feature unique to a class II SLG, the transmembrane domain (TANTIKANJANA et al. 1993 Down).

Several observations are consistent with the view that both SLG and SRK function in SI. Transgenic experiments showed that transformation with anti-sense SLG (SHIBA et al. 1995 Down) or sense-cosuppression of SLG or SRK (CONNER et al. 1997 Down; STAHL et al. 1998 Down) reduced expression of SLG and SRK and caused conversion to the self-compatible phenotype. NASRALLAH et al. 1992 Down demonstrated that the expression of SLG, but not SRK, is reduced in a self-compatible mutant, while another self-compatible line was found to have a nonfunctional SRK and a normal SLG (NASRALLAH et al. 1994A Down). However, some contradictory observations also have been reported. KUSABA et al. 1997 Down and KUSABA and NISHIO 1999 Down showed that some S haplotypes with very similar SLG alleles do not have the same self-recognition specificity. GAUDE et al. 1995 Down showed that the strength of SI is not related to the expression level of SLG in the class II haplotypes. Furthermore, the S24 haplotype of B. oleracea shows normal SI even though it seems to be lacking SLG (OKAZAKI et al. 1999 Down). These observations challenge the view that SLG is one of the key molecules in self-recognition (NASRALLAH et al. 1994B Down).

We identified a broccoli line that is incompatible with the S2 line in the B. oleracea S tester lines, a standard collection for S haplotypes (BRACE et al. 1994 Down). The DNA banding pattern of this line using a class II SLG probe clearly differed from the S2 line and was designated S2-b (OKAZAKI et al. 1999 Down). S2-b is found to be widely distributed in commercial cultivars of broccoli and cabbage (SAKAMOTO et al. 1999 Down). Furthermore, an S13 haplotype, which showed a banding pattern different from the S13 haplotype of the S tester lines, was also found in broccoli cultivars and designated S13-b (OKAZAKI et al. 1999 Down). S2 and S2-b have different PCR-restriction fragment length polymorphisms (RFLPs) in the SLG alleles (SAKAMOTO et al. 1999 Down), suggesting sequence differences in SLG; S13, and S13-b also have different SLG PCR-RFLPs. In this article, we describe sequence differences of SLG and SRK between S2 and S2-b and between S13 and S13-b and report that among S haplotypes with the same self-recognition specificity, SLG has accumulated more amino acid substitutions than the S domain of SRK. The implications of these results for the recognition mechanism of Brassica SI are discussed.


*  MATERIALS AND METHODS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Plant materials and pollination analysis:
The S2 and S13 S tester lines of B. oleracea were kindly provided by Dr. D. Ockendon. The S2-b and S13-b lines were derived from selfed progeny of cv. "Marimidori." Pollen tube development in stigmas after pollination was observed as described in NAKANISHI and HINATA 1973 Down. To examine the ability to set selfed seeds, seven open flowers from one individual were selfed and the resulting seeds were counted 1 month after pollination. In this experiment, the S2 S tester line and an S2-b line of kale were used (OKAZAKI et al. 1999 Down).

Isolation of genomic and cDNA clones:
Genomic DNA was isolated from young leaves according to ROGERS and BENDICH 1985 Down. Genomic libraries for S13, S13-b, and S2-b were constructed on {lambda} Dash II (Stratagene, La Jolla, CA) according to KUSABA and NISHIO 1999 Down. The genomic clones for SRK13 and SRK13-b were isolated by a PCR-based method (KUSABA and NISHIO 1999 Down). All PCR experiments were conducted under the conditions described by NISHIO et al. 1996 Down. An SRK-specific primer set, PK1 and PK4 (NISHIO et al. 1997 Down), was used for the screening. Poly(A)+ RNA was isolated from stigmas 1 or 2 days before flowering using a Fast-track kit (Promega, Madison, WI), and a stigma cDNA library of S2-b was constructed on {lambda}ZAP (Stratagene) according to the manufacturer's instructions. The genomic and cDNA clones of SLG2-b and SRK2-b were isolated by a hybridization-based method using a Dig-labeled PCR product amplified from the S2-b haplotype with the PS3 and PS21 primer set (NISHIO et al. 1996 Down). This PCR product corresponds to SLG2-b (see text). SLA, an anther-expressed S-locus gene, was amplified, using primers CAAGCGCCCGCAAAGCAGGAAAA and CAGTACATGACCAAATCGACATC, from genomic DNA of the S2 homozygote S tester line and cloned into the pCR2 vector using a TA cloning kit (Invitrogen, Carlsbad, CA).

DNA and protein gel blot analysis:
DNA gel blot analyses were carried out as described by KUSABA and NISHIO 1999 Down, using the Dig labeling and detection system (Boehringer Mannheim, Indianapolis) using CSPD as a substrate or the ECL system (Amersham Pharmacia Biotech, Piscataway, NJ). Protein gel blot analysis was performed as described by OKAZAKI et al. 1999 Down. Protein was extracted from 30 stigmas with 0.15 ml of 0.02 M phosphate buffer, pH 7.0, and, after centrifugation, glycerol was added to the supernatant to a final concentration of 5%. An aliquot of the supernatant (15 µl) was subjected to nonequilibrium pH gradient electrophoresis. After transfer to a PVDF membrane, SLG and SLG-like proteins were detected with anti-SLG22 antiserum.

DNA sequencing and sequence analysis:
Sequencing was carried out by the dye-terminator method using PRISM 377 (Perkin-Elmer, Norwalk, CT) as described by KUSABA and NISHIO 1999 Down. SLG13 and SLG13-b were amplified with the class I-SLG-specific primer set, PS22 and PS15 (SAKAMOTO et al. 1998 Down). The PCR products were purified with a QIAquick PCR purification kit (QIAGEN) and their DNA sequences were directly determined. Sequence analyses were performed using Genetyx v. 10.0 (Software Kaihatsu, Tokyo). Sequences reported in this article correspond to DDBJ accession nos. AB024415–AB024422.


*  RESULTS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Characterization of the S2-b and S13-b haplotypes by test crossing:
Class I S haplotype S13 is dominant in pollen and codominant in stigmas to a class II S haplotype S2 (THOMPSON and TAYLOR 1966 Down). S13-b was incompatible with S13 in reciprocal pollinations, dominant to S2 in pollen, and codominant with S2 in stigmas (Fig 1A and Fig B), suggesting that S13-b has the same dominance-recessiveness relationship as S13 of the S tester lines. Like S2 of the S tester lines, S2-b was incompatible with S2 in reciprocal pollinations and was found to be recessive to S13-b in pollen and codominant with S13-b in stigmas (Fig 1C and Fig D). To compare the strength of SI of the S2-b haplotype to that of the S2 haplotype, the ability of the plants to set selfed seeds was examined. S2 homozygotes set 0.71 seeds/pod by selfing and S2-b homozygotes set 1.0 seeds/pod, suggesting that the strengths of their SIs are comparable.



View larger version (35K):
In this window
In a new window
Download PPT slide
 
Figure 1. Dominance-recessiveness relationship between S2, S2-b, and S13-b. Test crossing between (A) the S13 and S13-b, (B) the S13-b and S2, (C) the S2 and S2-b, and (D) the S2-b and S13-b haplotypes. In experiments A and C, the S25 (class I) haplotype was used as a control. -, incompatible; +, compatible.

Isolation of SLG and SRK clones from the S13 and S13-b haplotypes:
An SRK13 genomic clone was isolated from a genomic library constructed from the leaves of S13 homozygotes derived from the S tester lines (Fig 2A). An SRK13-b genomic clone was isolated from a genomic library constructed from the leaves of S13-b homozygotes derived from selfed progeny of the broccoli F1 hybrid cultivar Marimidori (Fig 2A). Both clones contained the entire coding region of SRK gene and showed similar restriction maps. SLG13 and SLG13-b were amplified by genomic PCR using a class I SLG-specific primer set, PS22 and PS15 (SAKAMOTO et al. 1998 Down). Both SLGs have the 12 conserved cysteine residues (Fig 2C). Our SLG13 sequence is slightly different from the published SLG13 sequence (DWYER et al. 1991 Down): there is one amino acid substitution in the signal sequence and one in hypervariable region I. These differences probably reflect genetic differences in the lines studied. A DNA gel blot analysis using the SLG13 probe of an F2 population segregating for S13-b and S2-b revealed two HindIII fragments, which were determined by test crossing to be perfectly linked to the S13-b genotype (Fig 3A). The two bands were thought to correspond to SLG13-b and SRK13-b. The PCR-amplified product of SLG13-b was also perfectly linked to the S13-b genotype in 18 segregating plants (Fig 3B), confirming that the PCR products were derived from SLG13-b. In a previous study (OKAZAKI et al. 1999 Down), a DNA gel blot analysis of S13 showed only two bands detected after HindIII digestion; those bands apparently correspond to SLG13 and SRK13.



View larger version (28K):
In this window
In a new window
Download PPT slide
 
Figure 2. Sequence diversity of SLG and SRK between the S13 and S13-b haplotypes. (A) Restriction maps of the SRK13 and SRK13-b genomic clones. Thick lines indicate exons. H, HindIII; X, XhoI. (B) Comparison of the amino acid sequences of SRK13 and SRK13-b. (C) Comparison of the amino acid sequences of SLG13 and SLG13-b. Boxed N residues show the positions of potential N-linked glycosylation sites. Solid circles show the positions of conserved cysteine residues. The three larger boxes represent the three hypervariable regions (I, II, and III): hypervariable regions I and III are separated into two parts by conserved amino acid residues. The signal sequence and the transmembrane domain are underlined. Open circles show the positions of the conserved amino acid residues among the protein kinases. Closed circles indicate identical amino acid residues.



View larger version (86K):
In this window
In a new window
Download PPT slide
 
Figure 3. Linkage analysis of the SLG and SRK alleles of the S2-b and S13-b haplotypes. (A) DNA gel blot analysis of selfed progeny of cv. Marimidori segregating for S2-b and S13-b using the SLG13-b PCR product as a probe. Genomic DNA (5 µg/lane) was digested by HindIII and separated on a 0.8% agarose gel. The DNA was detected by the Dig detection system. The hybridization and wash were carried out at 68°. The S genotype determined by pollination analysis is shown above each lane. (B) PCR analysis of the same plants using the class I-SLG-specific primer set, PS22 and PS15. (C) The same blot used in A was reprobed with the SLG2-b PCR product under the same conditions as in A. (D) PCR analysis of the same plants using the class II-specific primer set, PS3 and PS21.

Sequence comparison of SLG and SRK of the S13 and S13-b haplotype:
Both SRK13 and SRK13-b showed high similarity to the class I SRKs reported so far, including the 12 conserved cysteine residues in the S domain and the conserved amino acid residues in their kinase domain, which are important for kinase activity (Fig 2B). These characteristics suggest that both SRK13 and SRK13-b are functional alleles. The S domains of SRK13 and SRK13-b exhibited a very high similarity in their amino acid sequence (99.8%). There was only one amino acid difference in hypervariable region II. On the other hand, the signal sequences and the transmembrane-kinase domains showed lower amino acid identities (96.8 and 97.6%, respectively). The much higher similarity in the S domain suggests that maintenance of the same self-recognition specificity requires conservation of the S domain.

SLG13 and SLG13-b also showed high similarity to class I SLGs that have been reported so far, including the 12 cysteine residues (Fig 2C). Protein gel blot analysis of soluble stigma proteins using an anti-SLG22 antibody revealed that the positions of S-haplotype-specific bands for S13-b are the same as those for S13 (Fig 4). Consistent with this observation, the pIs estimated from the deduced amino acid sequences in the mature protein region (pI 8.12) and potential N-linked glycosylation sites are identical in SLG13 and SLG13-b. However, direct sequencing of SLG13 and SLG13-b revealed a number of nonsynonymous differences (98.3% identity in amino acid sequence in the mature protein region), particularly in hypervariable region I, which is thought to be involved in the determination of self-recognition specificity: 6 of 11 amino acid residues in hypervariable region I are substituted.



View larger version (48K):
In this window
In a new window
Download PPT slide
 
Figure 4. Protein gel blot analysis of water-soluble stigma proteins from the S2, S2-b, S13, and S13-b haplotypes. Stigma proteins were separated by nonequilibrium pH gradient electrophoresis and detected with an anti-SLG22 antibody. The non-S-haplotype specific bands are thought to be derived from SLG-like genes unlinked to the S locus, such as SLR1 (LALONDE et al. 1989 Down). +, anode; -, cathode.

The base substitutions observed between SLG13 and SLG13-b were clustered in hypervariable region I (data not shown). Interestingly, on the nucleotide sequence level, SLG13-b in this region is identical to SRK13-b and very similar to SRK13 (data not shown), suggesting that the evolution of S13 and S13-b has involved gene conversion between SLG and SRK or recombination between different SLG alleles. This is consistent with previous evidence that gene conversion between and recombination in SLG and SRK alleles has occurred in the evolution of S haplotypes (GORING et al. 1993 Down; KUSABA et al. 1997 Down; SUZUKI et al. 1997 Down; KUSABA and NISHIO 1999 Down).

Isolation of SLG and SRK clones of the S2-b haplotype:
A genomic library was constructed from leaves of S2-b homozygotes derived from the selfed progeny of broccoli cv. Marimidori. The PCR product amplified from S2-b with class II-specific primer set PS3 and PS21 was used as a probe to screen the library. Three classes of clones with sequences highly similar to the class II SLG alleles were isolated. On the basis of nucleotide sequence similarity (97.8%; data not shown), the first class is thought to be SLR2, an SLG-like gene unlinked to the S locus (BOYES et al. 1991 Down). However, clones within this class presumably encode only a truncated protein, due to a frame-shifting 14-bp deletion in the coding region. These observations suggest that the clones represent a nonfunctional allele of SLR2. The second class is identical in nucleotide sequence to the PCR product amplified with PS3 and PS21 (data not shown) and was designated as GS2b-1. The third class was designated as GS2b-2.

A DNA gel blot analysis of the selfed progeny of broccoli cv. Marimidori using the GS2b-1 clone as a probe revealed two HindIII bands (5.8 and 6.8 kb) that were determined by test crossing to be completely linked to the S2-b genotype (Fig 3C). The GS2b-1 clones contain a 5.8-kb HindIII fragment and GS2b-2 clones contain a 6.8-kb HindIII fragment, both of which hybridized to the class II SLG probe (Fig 5A). This result indicates that the two bands in the DNA gel blot correspond to GS2b-1 and GS2b-2. The PCR product amplified by the primer set of PS3 and PS21, corresponding to GS2b-1, was also perfectly linked to the S2-b genotype (Fig 3D). The 8.5-kb band, which is common to all segregating plants, was thought to correspond to SLR2. cDNA clones corresponding to the GS2b-1 and GS2b-2 genomic clones were isolated from an S2-b stigma library using the GS2b-1 probe. Sequence analysis of the clone corresponding to GS2b-2 revealed that it has a kinase domain, suggesting that GS2b-2 is SRK. This gene was designated as SRK2-b. The cDNA clone corresponding to GS2b-1 did not have a kinase domain, suggesting that it encodes SLG of the S2-b haplotype (SLG2-b).



View larger version (28K):
In this window
In a new window
Download PPT slide
 
Figure 5. Sequence diversity of SLG and SRK between the S2 and S2-b haplotypes. (A) Restriction maps of GS2b-1 (SLG2-b) and GS2b-2 (SRK2-b). Thick lines indicate exons. H, HindIII; B, BamHI. (B) Comparison of the amino acid sequences of SLG2 and SLG2-b. (C) Comparison of the amino acid sequences of SRK2 and SRK2-b. For explanation of symbols, see Fig 3. Arrowheads in B show the positions of introns.

Sequence and structural diversity of SLG and SRK in S2 and S2-b:
While class I SLG alleles have no intron and produce only soluble proteins, SLG2 has an intron and a second exon, which encodes a transmembrane domain (TANTIKANJANA et al. 1993 Down). SLG2 produces alternative mRNA molecules: the spliced mRNA produces a membrane-anchored protein and the unspliced mRNA a soluble protein. Sequence analyses of the genomic and cDNA clones of SLG2-b revealed that like SLG2, the SLG2-b gene also contains an intron and a second exon; however, the second exon cannot encode a transmembrane domain as it encodes only four amino acid residues (Fig 5A and Fig B).

In addition to these structural differences, SLG2 and SLG2-b showed significant sequence differences in the first exon. Amino acid sequence identity between SLG2-b and SLG2 was only 88.5% in the mature protein region and a number of differences were observed in the hypervariable regions (Fig 5B). The divergence between SLG2 and SLG2-b is comparable to that between SLGs of different S haplotypes. For example, SLG2 and SLG2-b exhibit 88.7 and 92.9% identity to SLG5 (SCUTT and CROY 1992 Down), respectively. Protein gel blot analysis revealed multiple S-haplotype-specific bands in the S2-b haplotype, unlike S2, which shows a single band (Fig 4). All of these bands are thought to be SLG. SLG2-b was produced at a level much higher than that of SLG2. Low production of SLG by the S2 haplotype was also reported by GAUDE et al. 1995 Down.

SRK2-b has retained the 12 conserved cysteine residues in the S domain and the conserved amino acid residues important for protein kinase activity in the kinase domain (Fig 5C). In the S domain, SRK2 and SRK2-b showed 97.3% identity. Hypervariable regions I and II were identical and hypervariable region III had one amino acid substitution at the end of the region. In the transmembrane-kinase domain, SRK2 and SRK2-b showed a similarity slightly lower (96.1%) than that in the S domain. The much higher similarity in the SRKs than in the SLGs indicates that SI recognition specificity is less sensitive to amino acid substitutions in SLG than in SRK. This suggests that SLG is not as important as SRK for the determination of self-recognition specificity.

Absence of SLA in the S2-b haplotype:
SLA is an anther-expressed S-locus gene specific to the S2 haplotype (BOYES and NASRALLAH 1995 Down) that was once thought to be a candidate for the pollen ligand gene. A DNA gel blot analysis was performed using SLA as a probe (Fig 6). No signal was detected in the class I haplotypes (S12, S13-b, S18) or the S5 (class II) haplotype. Unexpectedly, no band was detected in the S2-b haplotype. It is considered that S2-b haplotype does not harbor a sequence that is highly similar to that of SLA. The absence of SLA and the transmembrane-anchored SLG in the S2-b haplotype indicates that the S2-b haplotype has features that are quite different from the S2 haplotype in the S tester lines.



View larger version (23K):
In this window
In a new window
Download PPT slide
 
Figure 6. Absence of SLA in the S2-b haplotype. DNA gel blot analysis using SLA as a probe. Genomic DNA (5 µg/lane) was digested by HindIII and separated on a 0.8% agarose gel. The blot was detected by the ECL detection system. The hybridization and wash were carried out at 42° in hybridization buffer containing 6 M urea.


*  DISCUSSION
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Uniqueness of the S2 haplotype of B. oleracea among the class II S haplotypes:
Among Brassica S haplotypes, the S2 haplotype of B. oleracea has been intensively investigated and has been regarded as an exemplar of the class II S haplotypes. It has an SLG allele with a second exon encoding a transmembrane domain and SLA, an anther-expressed S locus gene (TANTIKANJANA et al. 1993 Down; BOYES and NASRALLAH 1995 Down). Certain genetic and physiological features of the S2 haplotype, including its recessiveness and relative weakness of SI, have been attributed to the existence of the membrane-anchored SLG. In this study, we have shown that the S2-b haplotype, which is incompatible in reciprocal crosses with the S2 haplotype, does not encode an SLG having a transmembrane domain, although its genetic and physiological properties are similar to those of the S2 haplotype: both are recessive to the class I haplotype S13-b in pollen and codominant with it in stigmas, and the difference between S2-b and S2 in the rate of seed set by selfing in homozygotes was not significant. These results suggest that the membrane-anchored SLG neither influences the dominance/recessiveness relationship nor has a remarkable effect on the strength of SI. This is consistent with a recent report that S5, which is recessive and shows relatively weak SI, also lacks a membrane-anchored SLG (GAUDE et al. 1995 Down; CABRILLAC et al. 1999 Down).

Because S2 and S2-b have the same self-recognition specificity, their self-recognition genes in pollen would be expected to show high similarity to each other. DNA gel blot analysis using SLA as a probe revealed that the S2-b haplotype does not possess any gene showing high homology to SLA, suggesting that SLA is not involved in SI recognition. PASTUGLIA et al. 1997 Down showed that self-incompatible lines of B. oleracea var. botrytis as well as the self-compatible p57Sc (a pollen-part mutant of the S15 haplotype; CABRILLAC et al. 1999 Down) have a nonfunctional SLA allele (interrupted by a retrotransposon) and claimed that SLA is not involved in SI. Our observation supports their claim.

With respect to structural features, SLG2-b is less similar to SLG2 than it is to SLG5 of B. oleracea (SCUTT and CROY 1992 Down) and SLG40 and SLG44 of B. rapa (HATAKEYAMA et al. 1998 Down): those genes also lack a transmembrane domain, and their C-terminal amino acid sequences encoded in the second exons are identical. Other than S2, only the S15 haplotype and its pollen-part mutant P57Sc possibly produce a membrane-anchored SLG, which was designated SLGA15 (PASTUGLIA et al. 1997 Down; CABRILLAC et al. 1999 Down). However, the very high sequence similarity of SLGA15 to SLG2 (99.0% in nucleic acid sequence) and the existence of an SLA-like sequence may indicate that SLGA15 and the SLA-like sequence were recently transmitted from the S2 haplotype as a segment. Furthermore, the S15 haplotype has another SLG gene (SLGB15) (CABRILLAC et al. 1999 Down), suggesting that SLGB15 could represent the original SLG. Interestingly, SLGB15 also has the same four amino acid residues as SLG2-b in its C-terminal end. The unique features of S2, particularly the existence of a transmembrane domain and SLA, indicate that the S2 haplotype is not a typical class II S haplotype.

Is SLG important for self-recognition specificity?
It has generally been believed that SLG and SRK play central roles in self-recognition in stigmas. However, accumulating data question the role of SLG in SI. GAUDE et al. 1995 Down showed that the amount of SLG was not correlated with seed set by self-pollination of class II homozygotes, a measure of the strength of SI. On the basis of protein and DNA gel blot analyses, OKAZAKI et al. 1999 Down suggested that SLG was deleted in the S24 haplotype of B. oleracea in spite of its normal expression of SI. Furthermore, some different S haplotypes have very similar SLGs while their SRKs show much lower similarity (KUSABA et al. 1997 Down; KUSABA and NISHIO 1999 Down). For example, SLG23 and SLG29 of B. oleracea show 99.5% identity and have identical hypervariable regions, but the S domains of SRK23 and SRK29 exhibit only 87.9% identity in amino acid sequence. In this article, we demonstrated that SLG varies much more than SRK between different lines that share the same self-recognition specificity. While the amino acid sequences responsible for self-recognition specificity are expected to be conserved among such lines, the SLGs of S2/S2-b and S13/S13-b have accumulated a number of amino acid substitutions in the hypervariable regions. In particular, SLG2-b showed only 88.5% amino acid identity to SLG2, which is comparable to that between SLGs of different S haplotypes. These results suggest that SLG is not important for recognition of SI specificity.

On the other hand, NASRALLAH et al. 1992 Down demonstrated that the trans-acting scf mutation, which causes self-compatibility, reduces the expression of SLG, but not SRK. However, expression of SLR1 and SLR2 was also reduced in the scf mutant. This suggests that the self-compatible phenotype could have been caused by the reduced expression of other genes regulated by SCF. Other evidence for the function of SLG in SI is given by transgenic experiments. A sense cosuppression experiment (CONNER et al. 1997 Down) and an anti-sense transgenic experiment (SHIBA et al. 1995 Down) using SLG seemed to indicate that reduced expression of SLG causes the self-compatible phenotype. However, the expression of SRK might also have been reduced in the transgenic plants because of the high homology between SLG and SRK. Thus, while these transgenic experiments do not unequivocally demonstrate that SLG is essential for SI, they do demonstrate that one or more genes highly similar to SLG are involved in SI. Involvement of SRK in SI is consistent with other observations as well: a self-compatible mutant was shown to have a nonfunctional SRK (NASRALLAH et al. 1994A Down), and introduction of a nonfunctional SRK transgene caused partial self-compatibility without reducing SLG or SRK expression (STAHL et al. 1998 Down). Our observations that the amino acid sequence of the S domain of SRK is highly conserved between S haplotypes with the same recognition specificity suggest that the S domain is important for recognition. Consistent with this view, we have not found within the same species any distinct SRK alleles that show high similarity in the S domain (24 S haplotypes in B. oleracea; T. NISHIO, T. SUZUKI and M. KUSABA, unpublished results), unlike the case for SLG alleles or the kinase domains of SRK alleles (KUSABA and NISHIO 1999 Down).

In the present investigation, it was suggested that the S domain of SRK, but not SLG, is important for recognition in SI. From the observation that the S15 haplotype has two distinct SLG genes, CABRILLAC et al. 1999 Down suggested that the two SLG genes are redundant or that they are not required for recognition in SI. Our observation favors the latter interpretation. LUU et al. 1999 Down recently suggested that SLG and SLR1 are involved in pollen adhesion to the surface of the stigma. This means that SLG might have a function more general than determination of self-recognition specificity. In any case, further evidence is required to demonstrate that SLG is not essential to SI.


*  FOOTNOTES

1 Present address: Takii Plant Breeding & Experiment Station, Kohsei, Kohka-gun, Shiga 520-3231, Japan. Back
2 Present address: Faculty of Agriculture, Niigata University, Niigata, 950-2181, Japan. Back


*  ACKNOWLEDGMENTS

We thank D. Ockendon and D. Astley for providing plant materials, M. E. Nasrallah and J. B. Nasrallah for providing anti-SLG antiserum, and M. Uyenoyama for her suggestions for improvement of our manuscript. This work was supported by a grant from the Science and Technology Agency of Japan and in part by a Grant-in-Aid (Bio Design Program) from the Ministry of Agriculture, Forestry and Fisheries.

Manuscript received May 24, 1999; Accepted for publication September 10, 1999.


*  LITERATURE CITED
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

BOYES, D. C., C.-H. CHEN, T. TANTIKANJANA, J. J. ESCH, and J. B. NASRALLAH, 1991  Isolation of a second S locus related cDNA from B. oleracea: genetic relationship between the S locus and two related loci. Genetics 127:221-228[Abstract].

BOYES, D. C. and J. B. NASRALLAH, 1995  An anther-specific gene encoded by an S locus haplotype of Brassica produces complementary and differentially regulated transcripts. Plant Cell 7:1283-1294[Abstract].

BRACE, J., G. J. KING, and D. J. OCKENDON, 1994  A molecular approach to the identification of S-alleles in Brassica oleracea.. Sex. Plant Reprod. 7:201-208.

CABRILLAC, D., V. DELORME, J. GARIN, V. RUFFIO-CHABLE, and J.-L. GIRANTON et al., 1999  The S15 self-incompatibility haplotype in Brassica oleracea includes three S gene family members expressed in stigmas. Plant Cell 11:971-986[Abstract/Free Full Text].

CONNER, J. A., T. TANTIKANJANA, J. C. STEIN, M. K. KANDASAMY, and J. B. NASRALLAH et al., 1997  Transgene-induced silencing of S-locus genes and related genes in Brassica. Plant J. 11:809-823.

DWYER, K. G., M. A. BALENT, J. B. NASRALLAH, and M. E. NASRALLAH, 1991  DNA sequences of self-incompatiblility genes from Brassica campestris and B. oleracea: polymorphism predating speciation. Plant Mol. Biol. 16:481-486[Medline].

GAUDE, T., M. ROUGIER, P. HEIZMANN, D. J. OCKENDON, and C. DUMAS, 1995  Expression level of the SLG gene is not correlated with the self-incompatibility phenotype in the class II S haplotypes of Brassica oleracea.. Plant Mol. Biol. 27:1003-1014[Medline].

GORING, D. R., T. L. GLAVIN, U. SCHAFER, and S. J. ROTHSTEIN, 1993  An S receptor kinase gene in self-compatible Brassica napus has a 1-bp deletion. Plant Cell 5:531-539[Abstract].

HATAKEYAMA, K., T. TAKASAKI, M. WATANABE, and K. HINATA, 1998  Molecular characterization of S locus genes, SLG and SRK, in a pollen-recessive self-incompatibility haplotype of Brassica rapa L. Genetics 149:1587-1597[Abstract/Free Full Text].

KUSABA, M. and T. NISHIO, 1999  Comparative analysis of S haplotypes with very similar SLG alleles in Brassica rapa and B. oleracea.. Plant J. 17:83-92[Medline].

KUSABA, M., T. NISHIO, Y. SATTA, K. HINATA, and D. OCKENDON, 1997  Striking sequence similarity in inter- and intra-specific comparisons of class I SLG alleles from Brassica oleracea and Brassica campestris: implications for the evolution and recognition mechanism. Proc. Natl. Acad. Sci. USA 94:7673-7678[Abstract/Free Full Text].

LALONDE, B. A., M. E. NASRALLAH, K. G. DWYER, C.-H. CHEN, and B. BARLOW et al., 1989  A highly conserved Brassica gene with homology to the S-locus-specific glycoprotein structural gene. Plant Cell 1:249-258[Abstract/Free Full Text].

LEE, H.-S., S. HUANG, and T.-H. KAO, 1994  S proteins control rejection of incompatible pollen in Petunia inflata.. Nature 367:560-563[Medline].

LUU, D.-T., D. MARTY-MAZARS, M. TRICK, C. DUMAS, and P. HEIZMANN, 1999  Pollen-stigma adhesion in Brassica spp involves SLG and SLR1 glycoproteins. Plant Cell 11:251-262[Abstract/Free Full Text].

MATTON, D. P., O. MAES, G. LAUBLIN, Q. XIKE, and C. BERTRAND et al., 1997  Hypervariable domains of self-incompatibility RNases mediate allele-specific pollen recognition. Plant Cell 9:1757-1766[Abstract].

MURFETT, J., T. L. ATHERTON, B. MOU, C. S. GRASSER, and B. A. MCCLURE, 1994  S-RNase expressed in transgenic Nicotiana causes S-allele-specific pollen rejection. Nature 367:563-566[Medline].

NAKANISHI, T. and K. HINATA, 1973  An efficient time for CO2 gas treatment for overcoming self-incompatibility in Brassica. Plant Cell Physiol. 14:873-879[Abstract/Free Full Text].

NASRALLAH, J. B. and M. E. NASRALLAH, 1993  Pollen-stigma signaling in the sporophytic self-incompatibility response. Plant Cell 10:1325-1335.

NASRALLAH, J. B., T. NISHIO, and M. E. NASRALLAH, 1991  The self-incompatibility genes of Brassica: expression and use in genetic ablation of floral tissues. Annu. Rev. Plant Physiol. Plant Mol. Biol. 42:393-422.

NASRALLAH, J. B., S. J. RUNDLE, and M. E. NASRALLAH, 1994a  Genetic evidence for the requirement of the Brassica S-locus receptor kinase gene in the self-incompatibility response. Plant J. 5:373-384.

NASRALLAH, J. B., J. C. STEIN, M. K. KANDASAMY, and M. E. NASRALLAH, 1994b  Signaling the arrest of pollen tube development in self-incompatible plants. Science 266:1505-1508[Abstract/Free Full Text].

NASRALLAH, M. E., M. K. KANDASAMY, and J. B. NASRALLAH, 1992  A genetically defined trans-acting locus regulates S-locus function in Brassica. Plant J. 2:497-506.

NISHIO, T., M. KUSABA, M. WATANABE, and K. HINATA, 1996  Registration of S-alleles in Brassica campestris L by the restriction fragment sizes of SLGs.. Theor. Appl. Genet. 92:388-394.

NISHIO, T., M. KUSABA, K. SAKAMOTO, and D. J. OCKENDON, 1997  Polymorphism of the kinase domain of the S-locus receptor kinase gene (SRK) in Brassica oleracea L. Theor. Appl. Genet. 95:335-342.

OKAZAKI, K., M. KUSABA, D. J. OCKENDON, and T. NISHIO, 1999  Characterization of S tester lines in Brassica oleracea: polymorphism of restriction fragment length of SLG homologues and isoelectric points of S-locus glycoproteins. Theor. Appl. Genet. 98:1329-1334.

PASTUGLIA, M., V. RUFFIO-CHABLE, V. DELORME, T. GAUDE, and C. DUMAS et al., 1997  A functional S locus anther gene is not required for the self-incompatibility response in Brassica oleracea.. Plant Cell 9:2065-2076[Abstract].

ROGERS, S. O. and A. J. BENDICH, 1985  Extraction of DNA from milligram amounts of fresh, herbarium and mummified plant tissues. Plant Mol. Biol. 5:69-76.

SAKAMOTO, K., M. KUSABA, and T. NISHIO, 1998  Polymorphism of the S-locus glycoprotein gene (SLG) and the S-locus related gene (SLR1) in Raphanus sativus L. and self-incompatible ornamental plants in the Brassicaceae. Mol. Gen. Genet. 258:397-403[Medline].

SAKAMOTO, K., M. KUSABA, and T. NISHIO, 1999  Single seed PCR-RFLP analysis for identification of S haplotypes in commercial F1 hybrid cultivars of broccoli and cabbage. Plant Cell Rep. in press.

SCUTT, C. P. and R. R. D. CROY, 1992  An S5 self-incompatibility allele-specific cDNA sequence from Brassica oleracea shows high homology to the SLR2 gene. Mol. Gen. Genet. 232:240-246[Medline].

SHIBA, H., K. HINATA, A. SUZUKI, and A. ISOGAI, 1995  Breakdown of self-incompatibility in Brassica by the antisense RNA of the SLG gene. Proc. Jpn. Acad. Ser. B 71:81-83.

STEPHENSON, A. G., J. DOUGHTY, S. DIXON, C. ELLEMAN, and S. HISCOCK et al., 1997  The male determinant of self-incompatibility in Brassica oleracea is located in the pollen coating. Plant J. 12:1351-1359.

STAHL, R. J., M. ARNOLDO, T. L. GLAVIN, D. R. GORING, and S. J. ROTHSTEIN, 1998  The self-incompatibility phenotype in Brassica is altered by the transformation of a mutant S locus receptor kinase. Plant Cell 10:209-218[Abstract/Free Full Text].

SUZUKI, G., M. WATANABE, A. ISOGAI, and K. HINATA, 1997  Highly conserved 5'-flanking regions of two self-incompatibility genes, SLG9 and SRK9. Gene 191:123-126[Medline].

TANTIKANJANA, T., M. E. NASRALLAH, J. C. STEIN, C.-H. CHEN, and J. B. NASRALLAH, 1993  An alternative transcript of the S locus glycoprotein gene in a class II pollen-recessive self-incompatibility haplotype of Brassica oleracea encodes a membrane-anchored protein. Plant Cell 5:657-666[Abstract/Free Full Text].

THOMPSON, K. F. and J. P. TAYLOR, 1966  Non-linear dominance relationships between S alleles. Heredity 21:345-362.




This article has been cited by other articles:


Home page
GeneticsHome page
K. Edh, B. Widen, and A. Ceplitis
Molecular Population Genetics of the SRK and SCR Self-Incompatibility Genes in the Wild Plant Species Brassica cretica (Brassicaceae)
Genetics, March 1, 2009; 181(3): 985 - 995.
[Abstract] [Full Text] [PDF]


Home page
Plant Cell PhysiolHome page
Y. Sato, K. Sato, and T. Nishio
Interspecific Pairs of Class II S Haplotypes Having Different Recognition Specificities between Brassica oleracea and Brassica rapa
Plant Cell Physiol., March 1, 2006; 47(3): 340 - 345.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
N. L. Prigoda, A. Nassuth, and B. K. Mable
Phenotypic and Genotypic Expression of Self-incompatibility Haplotypes in Arabidopsis lyrata Suggests Unique Origin of Alleles in Different Dominance Classes
Mol. Biol. Evol., July 1, 2005; 22(7): 1609 - 1620.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
T. Chookajorn, A. Kachroo, D. R. Ripoll, A. G. Clark, and J. B. Nasrallah
Inaugural Article: Specificity determinants and diversification of the Brassica self-incompatibility pollen ligand
PNAS, January 27, 2004; 101(4): 911 - 917.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
D. Charlesworth, C. Bartolome, M. H. Schierup, and B. K. Mable
Haplotype Structure of the Stigmatic Self-Incompatibility Gene in Natural Populations of Arabidopsis lyrata
Mol. Biol. Evol., November 1, 2003; 20(11): 1741 - 1753.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
D. Charlesworth, B. K. Mable, M. H. Schierup, C. Bartolome, and P. Awadalla
Diversity and Linkage of Genes in the Self-Incompatibility Gene Family in Arabidopsis lyrata
Genetics, August 1, 2003; 164(4): 1519 - 1535.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
C. Miege, V. Ruffio-Chable, M. H. Schierup, D. Cabrillac, C. Dumas, T. Gaude, and J. M. Cock
Intrahaplotype Polymorphism at the Brassica S Locus
Genetics, October 1, 2001; 159(2): 811 - 822.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
M. K. Uyenoyama
Evolutionary Dynamics of Self-Incompatibility Alleles in Brassica
Genetics, September 1, 2000; 156(1): 351 - 359.
[Abstract] [Full Text]


Home page
Plant Physiol.Home page
R. Dixit, M. E. Nasrallah, and J. B. Nasrallah
Post-Transcriptional Maturation of the S Receptor Kinase of Brassica Correlates with Co-Expression of the S-Locus Glycoprotein in the Stigmas of Two Brassica Strains and in Transgenic Tobacco Plants
Plant Physiology, September 1, 2000; 124(1): 297 - 312.
[Abstract] [Full Text]