Analysis of the Mechanism by Which Glucose Inhibits Maltose Induction of MAL Gene Expression in Saccharomyces

Corresponding author: Corinne A. Michels, Department of Biology, Queens College, Flushing, NY 11367., corinne_michels{at}qc.edu (E-mail)

Communicating editor: M. JOHNSTON

	ABSTRACT

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Expression of the MAL genes required for maltose fermentation in Saccharomyces cerevisiae is induced by maltose and repressed by glucose. Maltose-inducible regulation requires maltose permease and the MAL-activator protein, a DNA-binding transcription factor encoded by MAL63 and its homologues at the other MAL loci. Previously, we showed that the Mig1 repressor mediates glucose repression of MAL gene expression. Glucose also blocks MAL-activator-mediated maltose induction through a Mig1p-independent mechanism that we refer to as glucose inhibition. Here we report the characterization of this process. Our results indicate that glucose inhibition is also Mig2p independent. Moreover, we show that neither overexpression of the MAL-activator nor elimination of inducer exclusion is sufficient to relieve glucose inhibition, suggesting that glucose acts to inhibit induction by affecting maltose sensing and/or signaling. The glucose inhibition pathway requires HXK2, REG1, and GSF1 and appears to overlap upstream with the glucose repression pathway. The likely target of glucose inhibition is Snf1 protein kinase. Evidence is presented indicating that, in addition to its role in the inactivation of Mig1p, Snf1p is required post-transcriptionally for the synthesis of maltose permease whose function is essential for maltose induction.

IN the yeast Saccharomyces cerevisiae, glucose regulates the expression of a large number of genes (reviewed in JOHNSTON 1999 ). A major glucose repression pathway involves the Snf1 protein kinase that acts upon Mig1 protein, a DNA-binding transcriptional repressor of the SUC2, GAL, and MAL genes (NEHLIN and RONNE 1990 ; NEHLIN et al. 1991 ; HU et al. 1995 ). This repression requires glucose transport (OZCAN et al. 1994 ; VALLIER et al. 1994 ; OZCAN and JOHNSTON 1995 ) and several negative regulators, including Hxk2p (hexokinase PII) and Reg1p-Glc7p (protein phosphatase type-1).

Induction of GAL and MAL gene expression requires a transcriptional activator protein, Gal4p and the MAL-activator, respectively (for reviews, see NEEDLEMAN 1991 ; LOHR et al. 1995 ), but other aspects of the regulation of these sugar fermentation genes appear to be quite distinct. The mechanism of galactose sensing has been elucidated by recent studies. Intracellular galactose binds to Gal3p and induces a strong interaction between Gal3p and Gal80p that in turns relieves the inhibitory effect of Gal80p on Gal4p (SUZUKI-FUJIMOTO et al. 1996 ; ZENKE et al. 1996 ; BLANK et al. 1997 ; YANO and FUKASAWA 1997 ; PLATT and REECE 1998 ). Glucose inhibits the process by repressing GAL3 and GAL4 expression (NEHLIN et al. 1991 ; LAMPHIER and PTASHNE 1992 ; JOHNSTON et al. 1994 ). The primary mechanism of glucose repression of GAL gene expression is the reduction of GAL4 expression mediated by the Mig1p repressor (LAMPHIER and PTASHNE 1992 ; JOHNSTON et al. 1994 ). Another mechanism of glucose repression of GAL gene expression depends on GAL80 and reflects a glucose inhibition of the induction process, possibly due to glucose inhibition of galactose permease (encoded by GAL2) that causes inducer exclusion. It is believed that the level of intracellular galactose is reduced by glucose repression of GAL2 transcription (NEHLIN et al. 1991 ) and by glucose-induced inactivation of galactose permease (MATERN and HOLZER 1977 ; DEJUAN and LAGUNAS 1986 ; HORAK and WOLF 1997 ).

Previously, we showed that Mig1p represses transcription of MAL63, which encodes a transcriptional activator of the MAL genes, as well as the MAL genes themselves (HU et al. 1995 ). However, the Mig1p-binding site is missing from the promoter of the MAL63 homologue MAL23 due to a single base-pair deletion (GIBSON et al. 1997 ). Despite this, MAL23-mediated MAL gene induction remains sensitive to glucose regulation, suggesting that, unlike the GAL genes, Mig1p-dependent glucose repression of MAL-activator expression is not sufficient to explain glucose repression of MAL gene expression. Since constitutive MAL-activators are insensitive to glucose in mig1 strains, glucose must inhibit MAL-activator-mediated maltose induction by a mechanism that is independent of Mig1p repression (HU et al. 1995 ), which we refer to as glucose inhibition of maltose induction.

In addition to the MAL-activator, induction of the MAL genes by maltose requires maltose permease (CHARRON et al. 1986 ; DUBIN 1987 ). Glucose inhibits transcription of the maltose-permease-encoding gene and also dramatically decreases maltose permease transport activity and protein levels by a process called glucose-induced inactivation (MEDINTZ et al. 1996 ). Thus, like glucose regulation of GAL gene expression, it has been proposed that the combination of these glucose effects on maltose permease expression and activity block MAL gene induction by an inducer exclusion mechanism. Instead, we have found that glucose inhibition of MAL gene induction is not the result of inducer exclusion or reduced levels of the MAL transcription activator but appears to result from a novel effect that blocks maltose sensing/signaling. This requires the glucose repression regulatory pathway up to and including Snf1 protein kinase.

	MATERIALS AND METHODS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Strains and growth media:
The S. cerevisiae strains used throughout this study are listed in Table 1. Strain CMY1001 contains only MAL1 encoding maltose permease, maltase (MAL12), and the MAL-activator (MAL13) (MEDINTZ et al. 1996 ). The maltose permease gene at this MAL1 locus has been replaced with an HA-tagged maltose permease gene from MAL6, MAL61/HA. CMY1006u is the ura3 derivative of CMY1006 isolated on 5-fluoroorotic acid-containing medium (BOEKE et al. 1984 ). Yeast strains were grown at 30° in either rich media (1% yeast extract, 2% peptone) or minimal media (0.67% yeast nitrogen base with appropriate amino acids and nitrogen base supplements) plus various carbon sources as specified.

Plasmids:
A fragment containing the TRP1 gene was obtained from plasmid pRS304 by PCR using oligonucleotides L1 (GGAGATCTCATAAACGACATTACTAT) and L2 (GGGGTACCTGATGCGGTATTTTCTCC) that carry BglII and KpnI sites, respectively. This TRP1 fragment was inserted into pSH2-1/MAL63_(2-216) (HU et al. 1999 ) digested with BglII and KpnI, creating plasmid pLexA/MAL63_(2-216). An EcoRI-BamHI fragment containing codons 216–470 of MAL63 was inserted into pLexA/MAL63_(2-216), resulting in plasmid pLexA/MAL63 carrying the TRP1 gene for selection of yeast transformants. Plasmid pSH2-1/MAL63 is a HIS3 vector with MAL63_(2-470) fused to LexA (HU et al. 1999 ). Plasmids pUN30/MAL63 and pUN30/MAL63/43-c are described in GIBSON et al. 1997 and carry the inducible MAL63 or constitutive MAL63/43-c genes in the CEN vector pUN30 (ELLEDGE and DAVIS 1988 ). Construction of the reporter gene MAL61pro-LacZ, consisting of the MAL61 promoter region from the 5' AUG of the MAL61 open reading frame (ORF), is described in HU et al. 1995 . Plasmid pBM3270 (obtained from M. Johnston) is a CEN plasmid carrying URA3 and the dominant RGT2-1 allele.

Gene disruption and Southern analysis:
MIG1 was disrupted in strain YPH500 to create strain CMY2001 using plasmid pJN22 as described (NEHLIN and RONNE 1990 ). HXK2 was disrupted in strain YPH500 (creating strain CMY2002) and isogenic CMY2001 (creating strain CMY2003) using plasmid pRB528 (obtained from David Botstein), which was digested with EcoRI prior to transformation. Plasmid pRB528 carries a hxk2::URA3 deletion disruption. Strain CMY4001 was constructed from strain PS5959-6B by replacing MIG1 with LEU2 using the disruption fragment from plasmid pJN22 (NEHLIN and RONNE 1990 ). All disruptions were confirmed by Southern analysis. GSF2 was disrupted in strain CMY1001 using plasmid p2-RM1 as described in SHERWOOD and CARLSON 1997 to create strain CMY3001. This construction replaces the entire GSF2 coding region with TRP1.

Northern blot analysis:
Total RNA was prepared using the RNeasy Midi kit (QIAGEN, Chatsworth, CA) according to the manufacturer's instructions for yeast cells. The RNA was size separated in a 1.2% formaldehyde-agarose gel as described in the RNeasy kit (QIAGEN), transferred to nitrocellulose, washed, and probed according to AUSUBEL et al. 1999 . Approximately 50–70 µg of total RNA was loaded per lane. PCR-amplified MAL61 ORF and plasmid pYactI (NG and ABELSON 1980 ) were used as probes to the same gel. The Storm 860 PhosphorImager (Molecular Dynamics, Sunnyvale, CA) was used to visualize and quantify the hybridization signals.

Western blot analysis:
Cells were harvested in mid-log phase. Whole-cell protein extracts were prepared as described (AUSUBEL et al. 1999 ). Equal amounts of protein samples were separated in SDS-polyacrylamide gel and transferred to Hybond-ECL nitrocellulose membrane (Amersham, Piscataway, NJ) as described (AUSUBEL et al. 1999 ). Membranes were probed with either anti-LexA antibody (obtained from Roger Brent) followed by horseradish-peroxidase-linked donkey anti-rabbit antibodies (Amersham) or anti-HA antibody (Boehringer Mannheim, Indianapolis) followed by horseradish-peroxidase-linked sheep anti-mouse antibody (Amersham). Protein bands were visualized using the enhanced chemiluminescence (ECL) Western blotting detection kit (Amersham) on ECL-Hyperfilm. The protein blots were quantified by scanning with a DU640 spectrophotometer (Beckman, Fullerton, CA).

Enzyme assays:
Yeast cells were grown in rich media or minimal media with 3% glycerol and 2% lactate (v/v) plus 2% of the specified sugar(s) (w/v) and harvested in mid-log phase. Maltase activities were determined as described (DUBIN et al. 1988 ). Maltase activity is expressed as nanomoles of p-nitrophenol--glucopyranoside (PNPG) hydrolyzed per minute per milligram of protein. The assays of ß-galactosidase activity were carried out in total cell extracts, and the activity was normalized to protein concentration for calculating specific activity (ROSE et al. 1990 ). Maltose transport activities were measured by the uptake of [¹⁴C]maltose as described (CHENG and MICHELS 1991 ). Inactivation protocol for assays of glucose sensitivity of maltose permease has been described in detail in MEDINTZ et al. 1996 .

	RESULTS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Loss of Mig2p does not relieve glucose inhibition:
MIG2 encodes a protein with a Cys₂His₂ zinc finger similar to that of Mig1p (LUTFIYYA et al. 1998 ) that represses SUC expression in the presence of glucose. We tested the possibility that Mig2p is responsible for the Mig1p-independent glucose effect on MAL gene induction. As the results in Table 2 demonstrate, glucose significantly inhibits maltase induction in the mig1 mig2 double mutant. Therefore, glucose inhibition of maltose induction is not due to residual effects of Mig2p.

Overexpression of the MAL-activator does not relieve glucose inhibition:
Glucose could inhibit maltose induction by affecting the synthesis and/or stability of the Mal63 protein. Thus, we tested whether overexpression of MAL63 abolishes glucose inhibition. A multicopy plasmid carrying a LexA-MAL63 fusion gene abundantly expressed from the constitutive ADH1 promoter was introduced into a mig1 strain carrying a lexO-LacZ reporter gene. The LexA-Mal63 fusion protein is expressed at comparable levels in both maltose-grown and glucose-grown cells, which is about twice the level seen in the glycerol/lactate-grown cells (data not shown). LexA-Mal63 protein activates transcription of both the MAL genes and the lexO-LacZ reporter gene in a maltose-dependent manner (HU et al. 1999 ; Table 3 and Table 4). As shown in Table 3, the LexA-Mal63 fusion protein fails to activate either the LacZ reporter gene or the maltase gene in cells grown in maltose/glucose media. Thus, unlike GAL, the effect of glucose on maltose induction of the MAL-activator is not the result of reduced levels of the activator protein.

Inducer exclusion is not necessary for glucose inhibition:
Maltose induction of MAL gene expression requires a functional maltose permease gene (CHARRON et al. 1986 ; DUBIN 1987 ; X. WANG and C. A. MICHELS, unpublished results). Since glucose causes a rapid reduction of maltose transport activity (MEDINTZ et al. 1996 ), glucose could block the induction signal simply by decreasing the transport of maltose (that is, by inducer exclusion). Two experiments were carried out to explore this hypothesis.

First, to test the minimal level of maltose permease activity required for induction, a LexA-MAL63_(41-66) fusion gene was transformed into a mig1 strain lacking other MAL-activator genes. Because it is missing its DNA-binding domain, the LexA-MAL63_(41-66) fusion protein is unable to activate expression of the MAL genes (HU et al. 1999 ; Table 3 and Table 4), causing maltose permease activity to remain at the low, uninduced basal level. Despite this, LexA-Mal63_(41-66) protein is able to activate transcription of the lexO-LacZ reporter gene in response to maltose (Table 3), indicating that this low basal level expression of maltose permease is adequate for maximal maltose induction of reporter expression.

Second, a plasmid carrying a constitutive glucose-repression-insensitive MAL-activator gene, MAL64-R10, was introduced into a mig1 strain along with the LexA-MAL63 fusion (DUBIN et al. 1988 ; HU et al. 1995 ). MAL64-R10 causes constitutive expression of the MAL genes, including maltose permease, even in the presence of glucose (Table 3 and Table 4). This significantly increases maltose transport activity in these maltose/glucose-grown cells (fourfold above the basal level). Despite the elevated levels of maltose transport activity, the overexpressed inducible LexA-Mal63 activator remains sensitive to glucose inhibition of maltose induction (Table 3). Thus, neither the elimination of inducer exclusion nor the abundant expression of Mal63 protein is sufficient to relieve glucose inhibition.

HXK2 is involved in glucose inhibition of Mal63p:
Hxk2 hexokinase reportedly generates the high glucose signal to which the glucose repression pathway responds (reviewed in RONNE 1995 ; CARLSON 1999 ; JOHNSTON 1999 ). To test if Hxk2p is involved in glucose inhibition, a plasmid carrying MAL63 was introduced into wild-type and isogenic mig1, hxk2, and mig1 hxk2 strains, and maltase activities were determined. As was found previously (HU et al. 1995 ), mig1 partially relieves glucose repression of maltase, but maltose induction remains mostly blocked by glucose inhibition (Table 5). In contrast, hxk2 fully relieves glucose repression of maltase expression and, more notably, maltase activity is partially induced in the maltose/glucose-grown hxk2 cells (to about threefold higher than in glucose-grown cells). Thus, the hxk2 mutation appears to allow some maltose induction in the presence of glucose, suggesting that Hxk2p is a component of the signaling pathway regulating both glucose inhibition and glucose repression.

Maltase expression in maltose/glucose-grown hxk2 cells is about sixfold lower than in maltose-grown cells, and we wished to explore the basis of this residual effect. Disruption of MIG1 in the hxk2 strain allows significantly increased levels of maltase expression in the presence of glucose plus maltose, almost to the levels seen in maltose-grown cells (Table 5). Thus, it appears that the residual regulation of MAL gene induction seen in hxk2 mutant strains is the result of Mig1p. We believe this is due to effects on MAL63 expression because of the results of the following experiments.

The abundantly expressed LexA-MAL63 activator gene was introduced into isogenic mig1, hxk2, and mig1 hxk2 YPH500-derived strains (Table 3). First, glucose does not inhibit maltose induction of maltase expression mediated by the abundantly expressed LexA-Mal63 activator in both the hxk2 and mig1 hxk2 strains. Significantly, no enhancement of maltase expression results from the loss of Mig1 repressor. Second, we find that disruption of HXK2 in a strain carrying the MAL23 MAL-activator gene causes a complete loss of glucose sensitivity in maltose/glucose-grown cells (data not shown). MAL23 lacks a Mig1p-binding site in its promoter (GIBSON et al. 1997 ).

Taken together, these results support the view that Hxk2p is an important component of both the glucose repression and glucose inhibition signaling pathways. In the hxk2 strain, Mig1p can still confer some glucose sensitivity on MAL63 by repressing its transcription. We suggest that in the hxk2 background another sugar kinase may at least partially substitute for the role of hexokinase PII encoded by HXK2 in mediating glucose repression. This issue is addressed in the following section.

HXK1 may partially mediate glucose repression in a hxk2 strain:
S. cerevisiae contains two hexokinases, PI (Hxk1p) and PII (Hxk2p) (LOBO and MAITRA 1977 ). HXK2 appears to be expressed in cells grown on high levels of glucose; expression of HXK1 is glucose repressed (HERRERO et al. 1995 ; DE WINDE et al. 1996 ). The functional distinction between HXK1 and HXK2 appears to result from their different expression patterns since multiple copies of HXK1 in an hxk2 mutant partially restore glucose repression (ENTIAN et al. 1984 ; MA and BOTSTEIN 1986 ; ROSE et al. 1991 ). Because HXK1 is derepressed in hxk2 cells on glucose, we reasoned that Hxk1p could play some of the roles of Hxk2p in generating/transmitting the glucose repression signal. Maltase expression on various carbon sources was not affected by disruption of HXK1 alone (data not shown), but disruption of HXK1 in an hxk2 mutant further relieved glucose repression of maltase in glucose-grown cells (Table 6). These results suggest that Hxk1p can at least partially substitute for Hxk2p in mediating glucose repression.

Glucose-induced inactivation of maltose permease is intact in the hxk2 strain:
Maltose transport activity and the amount of maltose permease protein can be followed in a strain expressing an HA-tagged maltose permease gene, allowing us to assay the sensitivity of the permease to glucose-induced inactivation. The protocol for the inactivation assay has been described in detail in MEDINTZ et al. 1996 . Briefly, cells are grown to early log phase in rich medium containing 2% maltose (to induce maltose permease expression), harvested, and transferred to nitrogen-starvation medium (to stop protein synthesis) with 2% glucose. Maltose transport activity and maltose permease protein levels are measured at selected time intervals within 3 hr following the transfer to glucose.

Glucose causes a decrease in both maltose transport activities and protein levels of maltose permease (Fig 1A). Disruption of HXK2 has only a modest twofold effect on the glucose inactivation of maltose permease (Fig 1B). Moreover, the hxk2 strain pregrown in maltose/glucose medium, which partially induces expression of maltose permease, exhibits a very rapid and complete inactivation of this permease after being transferred into glucose medium (Fig 1C). Thus, loss of Hxk2p relieves glucose inhibition of the MAL-activator (Table 5) but has no apparent impact on the rate of glucose-induced loss of maltose permease protein and maltose transport activity, suggesting that glucose-induced inactivation of maltose permease alone does not account for glucose inhibition.

View larger version (20K): [in this window] [in a new window] [Download PPT slide]   Figure 1. Glucose-induced inactivation of maltose permease in hxk2 mutant strains. Glucose-induced inactivation of maltose permease was followed in isogenic CMY1001 (HXK2) and CMY1006 (hxk2) as described in MATERIALS AND METHODS. At the indicated times, maltose transport activity (open circles), relative maltose permease protein levels (solid circles), and growth dilution (dashed line, squares) were determined. A and B show strains CMY1001 and CMY1006 grown in maltose medium, respectively. C shows strain CMY1006 grown in maltose plus glucose medium.

Effects of reg1 and gsf1 on glucose inhibition of Mal63p:
REG1 encodes a regulatory subunit of the protein phosphatase type-1 (PP1) catalytic subunit encoded by GLC7 (TU and CARLSON 1995 ). PP1 and Reg1p are required for glucose repression (TU and CARLSON 1994 ). Deletion of REG1 fully relieves repression of maltase expression in glucose-grown cells (Table 7). More significantly, maltose induction is not glucose inhibited in the absence of Glc7p-Reg1p phosphatase activity. Thus, disruption of REG1 appears to relieve both glucose repression of MAL gene expression as well as glucose inhibition of Mal63p function.

GSF1 is proposed to encode an inhibitor of Snf1 protein kinase that responds to glucose availability and acts in the same or a parallel pathway as Reg1p (SHERWOOD and CARLSON 1997 ). Loss of Gsf1p dramatically relieves glucose repression of SUC2 and GAL10 expression, and glucose induction of HXT1 expression is downregulated in gsf1 mutants. It also results in partial maltose inducibility of maltase expression in maltose/glucose medium (Table 8).

GRR1-dependent pathway mediates inhibition of the MAL-activator function in response to glucose:
Since grr1 strains are defective in glucose-induced inactivation of maltose permease (JIANG et al. 1997 ) as well as glucose repression, we examined whether grr1 also relieves glucose inhibition of MAL-activator induction. As shown in Table 9, disruption of GRR1 relieves glucose repression and glucose inhibition of maltase expression. Disruption of RGT1 in the grr1 strain dramatically restores glucose repression in cells grown in glucose-containing medium (Table 9), which correlates well with the full restoration of high-affinity glucose transport in the same grr1 rgt1 strain (JIANG et al. 1997 ). However, glucose sensitivity of MAL13 is only partially restored, and maltose-induced expression of the maltase gene is still observed in maltose/glucose-grown cells (~30-fold induction remains). Maltase expression in a grr1 rgt1 strain carrying an overexpressed LexA-MAL63 fusion gene also is clearly induced in maltose/glucose-grown cells as compared to glucose-repressed level (Table 9). These results suggest a Grr1p-dependent glucose effect on MAL-activator induction that does not involve Rgt1p.

Rgt2p and Snf3p are sensors of high and low extracellular glucose, respectively (OZCAN and JOHNSTON 1995 ; OZCAN et al. 1996A ). If the GRR1-dependent glucose inhibition of Mal13p function requires the high-glucose sensor Rgt2p, maltase expression in a strain carrying the dominant, constitutive RGT2-1 allele should be affected even under maltose-induced conditions. Maltose-induced expression of maltase is only slightly decreased (less than twofold) by RGT2-1 (Table 10). Furthermore, disruption of RGT2 only modestly relieves glucose repression of maltase expression (Table 9). Thus, it would appear that RGT2 does not play a major role in triggering the Grr1p-dependent glucose inhibition of the MAL-activator.

Snf1 protein kinase is required for maltose permease synthesis:
The results reported above indicate that the glucose sensing/signaling pathway for glucose inhibition shares several components with the glucose repression pathway that negatively regulates Snf1 protein kinase activity in response to glucose availability (reviewed in JOHNSTON 1999 ). For this reason, we decided to test the possibility that the glucose inhibition signaling pathway also involves Snf1 protein kinase, suggesting that Snf1 protein kinase is required for maltose induction in addition to its role in inhibiting Mig1 repressor. MAL gene expression was determined in mig1 strains with or without functional SNF1. Loss of Snf1 kinase severely impairs MAL gene expression in the strain carrying the inducible MAL63 activator gene (Table 11). The constitutive MAL-activator allele MAL63/43-c was introduced into the same SNF1 mig1 and snf1 mig1 strains, and expression of maltase, maltose transport activity, and the MAL61pro-LacZ reporter was compared (Table 11). Surprisingly, while maltase and the MAL61pro-LacZ reporter are both constitutively expressed, no maltose transport activity above background levels is detected. There is no significant difference between the level of maltose permease mRNA in the SNF1 mig1 [pMAL63/43-c] and snf1 mig1 [pMAL63/43-c] strains (Fig 2). These results suggest that the lack of maltose transport activity in the snf1 mig1 [pMAL63/43-c] strain is the result of a post-transcriptional block in maltose permease synthesis. Consistent with this, the introduction of additional plasmid-borne copies of MAL61 slightly increases the level of maltose transport activity expressed in this strain. Thus, these results suggest that the inability of maltose to induce MAL gene expression in snf1 mig1 strains is due to the block in synthesis of maltose permease. In uninduced cells, the low basal level of maltose permease must play an essential role in induction.

View larger version (48K): [in this window] [in a new window] [Download PPT slide]   Figure 2. Maltose permease mRNA expression in snf1 mig1 mutant strains. Northern blot analysis was carried out on strains PS5959-6B (SNF1 mig1) and CMY4001 (snf1 mig1) transformed with plasmid pUN30-MAL63/43-c carrying the constitutive MAL-activator gene MAL63/43-c according to the procedures in MATERIALS AND METHODS. Cells were grown as described in Table 11. PCR-amplified MAL61 ORF was used as the probe for maltose permease mRNA and normalized to the level of ACT1 mRNA using plasmid pYact1 as probe (NG and ABELSON 1980 ).

	DISCUSSION

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Although MAL63 transcription is repressed by Mig1p, maltose induction of MAL gene expression is still inhibited by glucose in mig1 strains (HU et al. 1995 ). We refer to this Mig1p-independent regulatory mechanism as glucose inhibition of maltose induction. It does not result from residual effects of Mig2p (Table 2).

Overexpression of LexA-MAL63 fails to overcome glucose inhibition. It is unlikely that the ability of the overexpressed LexA-Mal63 fusion protein to bind to DNA is affected directly by glucose, because LexA-MAL63 fusion protein binds to the LexA operators regardless of carbon sources (Z. HU, unpublished data). Also, abundant Mal63p is able to compete with Mig1p for binding to their adjacent binding sites in the MAL61-MAL62 promoter, suggesting that overexpressed Mal63p is able to bind to UAS_MAL in the presence of glucose (WANG et al. 1997 ). Thus, we favor the view that glucose inhibition does not affect nuclear entry or DNA-binding of the MAL-activator, but instead acts on some other function required for induction such as maltose sensing/signaling.

The relationship between maltose permease and glucose inhibition of maltose induction:
MAL-activator-mediated maltose induction requires the presence of a functional maltose permease gene (CHARRON et al. 1986 ; DUBIN 1987 ; X. WANG and C. A. MICHELS, unpublished results). It has been suggested that this role is to transport the inducer, maltose, into the cell, thereby making it available for MAL-activator stimulation. It is equally possible that maltose permease plays the role of a "maltose sensor" and signals the presence of extracellular maltose via an intracellular signaling pathway, as Snf3p and Rgt2p do for glucose (OZCAN et al. 1996A ). If this were the case, changes in maltose transport activity would not necessarily correlate with changes in glucose inhibition sensitivity. This is what we see.

The expression level of maltose permease required for induction is remarkably low. Several LexA-MAL63 mutant fusions activate the transcription of the lexO-LacZ reporter even in strains capable of expressing only the extremely low basal level of maltose transport activity. Moreover, raising maltose transport activity significantly above this basal level does not relieve glucose inhibition of the LexA-Mal63_(41-66) activator. This is evident from our finding that overexpression of maltose permease does not relieve glucose inhibition (Table 3 and Table 4). Additionally, glucose-induced inactivation of maltose permease, which inhibits maltose transport activity and increases the degradation rate of maltose permease protein, does not contribute significantly to the glucose inhibition of maltose induction. Strains carrying a disruption of HXK2 are significantly relieved of glucose inhibition of maltose induction, yet these strains maintain almost normal rates of glucose-induced inactivation of maltose permease (Fig 1).

Thus, even without inducer exclusion and downregulation of MAL-activator protein levels, glucose inhibits maltose induction. Moreover, the results reported here support the possibility that maltose permease has a signaling function in MAL gene induction. However, we cannot exclude the possibility that the combination of both glucose repression of maltose permease transcription and glucose-induced inactivation of maltose permease protein can act synergistically to functionally eliminate maltose permease completely in cells grown on glucose plus maltose.

Our findings indicate that it is unlikely that the N-terminal half of the MAL-activator containing the DNA-binding and transcription activation domains is a direct target of glucose inhibition. Two constitutive activators lacking the C-terminal maltose-regulatory domain but possessing the DNA-binding and transcriptional activation domains are insensitive to glucose inhibition (HU et al. 1995 ; Z. HU, unpublished results). Furthermore, the full-length constitutive mutations of MAL23 and MAL43, as well as those of MAL63 (when their expression is not repressed by Mig1p), all become resistant to glucose inhibition (CHARRON and MICHELS 1987 ; WANG and NEEDLEMAN 1996; GIBSON et al. 1997 ). Taken together, these findings suggest a correlation between maltose inducibility and glucose inhibition sensitivity.

The glucose inhibition pathway shares components with the glucose repression pathway and is distinct from the Rgt2p-dependent glucose induction pathway:
The results reported here demonstrate that several upstream negative regulators in the glucose repression pathway are also components of the glucose inhibition signaling pathway, including Hxk2p, Reg1p, and Gsf1p (reviewed in JOHNSTON 1999 ). HXK2 is proposed to act at an early, possibly signal-generating step in the glucose repression pathway. The nature of the glucose signal controlling glucose repression is unknown, but, based on the homology between components of the Snf1 kinase complex and the mammalian AMP-activated protein kinase, the AMP/ATP ratio is a possible candidate (WOODS et al. 1994 ; WILSON et al. 1996 ). HXK2 is the predominant hexokinase in glucose-grown Saccharomyces cells and acts as a gatekeeper regulating the rate of glucose fermentation and thus, indirectly, the AMP/ATP ratio. Our results indicate that the signal generated by hexokinase regulates glucose inhibition of maltose induction as well as glucose repression. Deletion of HXK2 allows for some, but not full, maltose induction of maltase expression in the presence of glucose (Table 5). This residual glucose inhibition is relieved by deletion of HXK1 (Table 6), deletion of MIG1 (Table 5), or overexpression of the MAL-activator (Table 3). Thus, a glucose signal is still generated in the absence of Hxk2p by Hxk1 hexokinase, and this reduced signal is able to repress expression of certain MAL-activator genes via Mig1p. In summary, hexokinase, particularly Hxk2p, is an important early negative regulator of glucose inhibition.

REG1 encodes a glucose-repression-responsive regulatory subunit of protein phosphatase type-1 (TU and CARLSON 1995 ; reviewed in JOHNSTON 1999 ). Interaction between Reg1p and the catalytic subunit of protein phosphatase type-1, Glc7p, is stimulated in high glucose conditions (TU and CARLSON 1995 ). Reg1p is believed to target Glc7p phosphatase activity to Snf1p, altering Snf1p- and Snf4p-binding and thereby blocking Snf1 kinase activation (LUDIN et al. 1998 ). We show that loss of Reg1p fully relieves both glucose repression of MAL gene expression and glucose inhibition of maltose induction. Thus, Reg1p is a component of both signaling pathways.

SHERWOOD and CARLSON 1997 suggest that Gsf1p may act in conjunction with Reg1p to stimulate or target Glc7 phosphatase activity toward the Snf1 kinase. Indeed, physical interaction of Snf1p and Reg1p has been reported (LUDIN et al. 1998 ). Alternately, Gsf1p could be a substrate of a Reg1-Glc7 phosphatase. Our results are consistent with these reports. We find that gsf1-1 mutant strains exhibit a relief of glucose inhibition similar to that of reg1 strains (compare Table 7 and Table 8) but the extent is more modest, which could reflect the possibility that gsf1-1 is a partial loss-of-function allele. Nevertheless, deregulation of Snf1 kinase activity appears to correlate with the release of glucose inhibition of maltose induction in the gsf1-1 strain.

Glucose-induced expression of HXT1 is mediated by the high-glucose sensor Rgt2p and is dependent upon Grr1p (OZCAN et al. 1996A , OZCAN et al. 1996B ). Our data indicate that Grr1p is involved in the glucose inhibition of maltose induction, but not Rgt2p or the glucose induction pathway. Disruption of RGT1 in grr1 strain fully restores glucose transport rate and glucose repression of maltase expression, but only partially restores glucose inhibition, as evidenced by the partial induction of maltase expression in maltose/glucose medium (Table 9). Additionally, loss of Rgt2p has no significant effect on glucose inhibition sensitivity (Table 9), nor does introduction of the dominant constitutive signaling allele RGT2-1 cause glucose inhibition (Table 10). We conclude from these results that the role of Grr1p in mediating glucose inhibition of MAL-activator induction is probably indirect, and is in addition to and distinct from its role in the inactivation of the Rgt1 repressor. Results reported elsewhere indicate that loss of Grr1p leads to reduced levels of Reg1 protein (JIANG et al. 2000B ; F. LI and M. JOHNSTON, unpublished results). This decreased Reg1p is likely to be the basis of the GRR1-mediated effect on glucose inhibition of maltose induction. Thus, we do not suggest that Grr1p is directly involved in glucose inhibition.

Snf1 protein kinase is required post-transcriptionally for the synthesis of maltose permease:
Snf1p is known to directly regulate transcription factors such as Mig1p and Sip4p (CELENZA and CARLSON 1986 ; VALLIER and CARLSON 1994 ; DEVIT et al. 1997 ; VINCENT and CARLSON 1998 ). Two targets of AMP-activated protein kinase, the mammalian homologue of Snf1 protein kinase, are HMG-CoA reductase and acetyl-CoA carboxylase, key enzymes in sterol biosynthesis (reviewed in HARDIE and CARLING 1997 ). Similarly in Saccharomyces, Snf1 kinase may activate acetyl-CoA carboxylase in glucose-derepressed conditions (WOODS et al. 1994 ). Our results suggest the possibility that Snf1p might have broader function in yeast.

SNF1 is required for maltose fermentation. If the only role of Snf1 kinase in MAL gene expression were to inhibit Mig1 repressor in low-glucose growth conditions, snf1 mig1 double-mutant strains should be able to induce MAL structural gene expression and ferment maltose. They cannot. Expression of the maltose fermentation enzymes is still blocked in the snf1 mig1 strain carrying the inducible MAL63 MAL-activator (Table 11 and Fig 2). In contrast, the snf1 mig1 MAL-activator constitutive and SNF1 mig1 MAL-activator constitutive strains transcribe the MAL structural genes at comparable rates. Taken together, these results indicate that Snf1p is required for maltose sensing/signaling. We found that despite the constitutive expression of the maltose permease gene, maltose transport activity is not expressed. This clearly suggests that Snf1 kinase plays a post-transcriptional role in maltose permease synthesis, and, since maltose permease is essential for maltose sensing/signaling, snf1 mutant strains are not maltose inducible. One can conceive of several points in the maltose permease synthesis where Snf1p might act, including translation of maltose permease mRNA, transit of nascent maltose permease through the secretory pathway, stability of the nascent protein during this process, or its maturation to an active integral membrane protein. Moreover, Snf1p need not act directly on maltose permease synthesis but could regulate the expression or activity of other functions required for this process. The nature of this role of Snf1 kinase is currently under investigation.

Mechanism of glucose inhibition of maltose induction:
We have uncovered a novel mechanism by which glucose inhibits maltose induction of the MAL-activator. Snf1 kinase is a key factor in glucose inhibition, as it is in glucose repression, but in this case Snf1p is necessary for the synthesis of maltose permease as opposed to the inactivation of Mig1 repressor. Thus, Snf1 kinase is the branchpoint of the glucose repression and glucose inhibition pathways. Upstream of Snf1 kinase the glucose sensing/signaling pathways controlling glucose repression and glucose inhibition appear to be the same since both utilize HXK2, REG1, and GSF1 as negative regulators. One of the major unresolved questions in Saccharomyces glucose repression is whether Snf1p, Reg1p, or both respond directly to the glucose signal. Our results suggest that Reg1p or factors controlling the Reg1p-Glc7p interaction respond directly to high-glucose growth conditions which, in turn, regulates Snf1 kinase activity. If instead, or in addition, the Snf1 kinase complex were the direct target of the glucose signal, loss of Reg1p would not be so effective in eliminating glucose inhibition and glucose repression of MAL gene induction.

	ACKNOWLEDGMENTS

This work was supported by grants from the National Institute of General Medical Sciences (GM28216 and GM49280) to C.A.M. P.S. was supported by a Damon Runyon–Walter Winchell Cancer Research Fund Postdoctoral Fellowship and a National Institutes of Health/National Institutes of Allergy and Infectious Diseases training grant (2T32A1071161). The results were submitted in partial fulfillment of the requirements for the Ph.D. program from the Graduate School of the City University of New York (H.J., Z.H., and Y.Y.).

Manuscript received March 15, 1999; Accepted for publication September 17, 1999.

	LITERATURE CITED

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

AUSUBEL, F. M., R. BRENT, R. E. KINGSTON, D. D. MOORE, J. G. SEIDMAN et al., 1999 Current Protocols in Molecular Biology. Green Publishing Associates/John Wiley & Sons, New York.

BLANK, T. E., M. P. WOODS, C. M. LEBO, P. XIN, and J. E. HOPPER, 1997  Novel Gal3 proteins showing altered Gal80p binding cause constitutive transcription of Gal4-activated genes in Saccharomyces cerevisiae.. Mol. Cell. Biol. 17:2566-2575[Abstract].

BOEKE, J. D., F. LACROUTE, and G. R. FINK, 1984  A positive selection for mutants lacking orotidine-5'-phosphate decarboxylase activity in yeast: 5-fluoro-orotic acid resistance. Mol. Gen. Genet. 197:345-346[Medline].

CARLSON, M., 1999  Glucose repression in yeast. Curr. Opin. Microbiol. 2:202-207[Medline].

CELENZA, J. L. and M. CARLSON, 1986  A yeast gene that is essential for release from glucose repression encodes a protein kinase. Science 233:1175-1180[Abstract/Free Full Text].

CHARRON, M. J. and C. A. MICHELS, 1987  The constitutive, glucose repression-insensitive mutation of the yeast MAL4 locus is an alteration of the MAL43 gene. Genetics 116:23-31[Abstract/Free Full Text].

CHARRON, M. J., R. A. DUBIN, and C. A. MICHELS, 1986  Structural and functional analysis of the MAL1 locus of Saccharomyces cerevisiae.. Mol. Cell. Biol. 6:3891-3899[Abstract/Free Full Text].

CHENG, Q. and C. A. MICHELS, 1991  MAL11 and MAL61 encode the inducible high-affinity maltose transporter of Saccharomyces cerevisiae.. J. Bacteriol. 173:1817-1820[Abstract/Free Full Text].

DE WINDE, J. H., M. CRAUWELS, S. HOHMANN, J. M. THEVELEIN, and J. WINDERICKX, 1996  Differential requirement of the yeast sugar kinases for sugar sensing in the establishment of the catabolite-repressed state. Eur. J. Biochem. 241:633-643[Medline].

DEJUAN, C. and R. LAGUNAS, 1986  Inactivation of the galactose transport system in Saccharomyces cerevisiae.. FEBS Lett. 207:258-261[Medline].

DEVIT, M. J., J. A. WADDLE, and M. JOHNSTON, 1997  Regulated nuclear translocation of the Mig1 glucose repressor. Mol. Biol. Cell 8:1603-1618[Abstract].

DUBIN, R. A., 1987 Molecular organization of the MAL6 locus of Saccharomyces carlsbergensis. Ph.D. Thesis, The City University of New York.

DUBIN, R. A., M. J. CHARRON, S. R. HAUT, R. B. NEEDLEMAN, and C. A. MICHELS, 1988  Constitutive expression of the maltose fermentative enzymes in Saccharomyces cerevisiae is dependent upon the mutational activation of a nonessential homolog of MAL63.. Mol. Cell. Biol. 8:1027-1035[Abstract/Free Full Text].

ELLEDGE, S. J. and R. DAVIS, 1988  A family of versatile centromeric vectors designed for use in the sectoring-shuffle mutagenesis assay in Saccharomyces cerevisiae.. Gene 70:303-312[Medline].

ENTIAN, K.-D., E. KOPETZKI, K. U. FROHLICH, and D. MECKE, 1984  Cloning of hexokinase isoenzyme PI from Saccharomyces cerevisiae: PI transformants confirm the unique role of hexokinase isoenzyme PII for glucose repression in yeasts. Mol. Gen. Genet. 198:50-54[Medline].

FREDERICK, D. L. and K. TATCHELL, 1996  The REG2 gene of Saccharomyces cerevisiae encodes a type-1 protein phosphatase-binding protein that functions with Reg1p and the Snf1 protein kinase to regulate growth. Mol. Cell. Biol. 16:2922-2931[Abstract].

GIBSON, W. A., L. A. WOJCIECHOWICZ, S. DANZI, B. ZHANG, and J. H. KIM et al., 1997  Constitutive mutations of the Saccharomyces cerevisiae MAL-activator genes MAL23, MAL43, MAL63, and mal64.. Genetics 146:1287-1298[Abstract].

HARDIE, D. G. and D. CARLING, 1997  The AMP-activated protein kinase: fuel gauge of the mammalian cell? Eur. J. Biochem. 246:259-273[Medline].

HERRERO, P., J. GALINDEZ, N. RUIZ, C. MARTINEZ-CAMPA, and F. MORENO, 1995  Transcriptional regulation of the Saccharomyces cerevisiae HXK1, HXK2 and GLK1 genes. Yeast 11:137-144[Medline].

HORAK, J. and D. H. WOLF, 1997  Catabolite inactivation of the galactose transporter in the yeast Saccharomyces cerevisiae: ubiquitination, endocytosis, and degradation in the vacuole. J. Bacteriol. 179:1541-1549[Abstract/Free Full Text].

HU, Z., J. O. NEHLIN, H. RONNE, and C. A. MICHELS, 1995  MIG1-dependent and MIG1-independent glucose regulation of MAL gene expression in Saccharomyces cerevisiae.. Curr. Genet. 28:258-266[Medline].

HU, Z., A. W. GIBSON, J. H. KIM, B. ZHANG, and L. A. WOJCIECHOWICZ et al., 1999  Functional domain analysis of the Saccharomyces MAL-activator. Curr. Genet. 36:1-12[Medline].

JIANG, H., I. MEDINTZ, and C. A. MICHELS, 1997  Two glucose sensing/signaling pathways stimulate glucose-induced inactivation of maltose permease in Saccharomyces.. Mol. Biol. Cell 8:1293-1304[Abstract].

JIANG, H., I. MEDINTZ, B. ZHANG and C. A. MICHELS, 2000a Metabolic signals trigger glucose-induced inactivation of maltose permease in Saccharomyces. J. Bacteriol. (in press).

JIANG, H., K. TATCHELL and C. A. MICHELS, 2000b Protein phosphatase type-1 regulatory subunits Reg1p and Reg2p are signal transducers in the glucose-induced proteolysis of maltose permease in Saccharomyces. Mol. Gen. Genet. (in press).

JOHNSTON, M., 1999  Feasting, fasting and fermenting: glucose sensing in yeast and other cells. Trends Genet. 15:29-33[Medline].

JOHNSTON, M., J. S. FLICK, and T. PEXTON, 1994  Multiple mechanisms provide rapid and stringent glucose repression of GAL gene expression in Saccharomyces cerevisiae.. Mol. Cell. Biol. 14:3834-3841[Abstract/Free Full Text].

LAMPHIER, M. S. and M. PTASHNE, 1992  Multiple mechanisms mediate glucose repression of the yeast GAL1 gene. Proc. Natl. Acad. Sci. USA 89:5922-5926[Abstract/Free Full Text].

LOBO, Z. and P. K. MAITRA, 1977  Genetics of yeast hexokinase. Genetics 86:727-744[Abstract/Free Full Text].

LOHR, D., P. VENKOV, and J. ZLATANOVA, 1995  Transcriptional regulation in the yeast GAL gene family: a complex genetic network. FASEB J. 9:777-787[Abstract].

LUDIN, K., R. JIANG, and M. CARLSON, 1998  Glucose-regulated interaction of a regulatory subunit of protein phosphatase 1 with the Snf1 protein kinase in Saccharomyces cerevisiae.. Proc. Natl. Acad. Sci. USA 95:6245-6250[Abstract/Free Full Text].

LUTFIYYA, L. L. and M. JOHNSTON, 1996  Two zinc-finger-containing repressors are responsible for glucose repression of SUC2 expression. Mol. Cell. Biol. 16:4790-4797[Abstract].

LUTFIYYA, L. L., V. R. IVER, J. DERISI, M. J. DEVIT, and P. O. BROWN et al., 1998  Characterization of three related glucose repressors and genes they regulate in Saccharomyces cerevisiae.. Genetics 150:1377-1391[Abstract/Free Full Text].

MA, H. and D. BOTSTEIN, 1986  Effects of null mutations in the hexokinase genes of Saccharomyces cerevisiae on catabolite repression. Mol. Cell. Biol. 6:4046-4052[Abstract/Free Full Text].

MATERN, H. and H. HOLZER, 1977  Catabolite inactivation of the galactose uptake system in yeast. J. Biol. Chem. 252:6399-6402[Free Full Text].

MEDINTZ, I., H. JIANG, E.-K. HAN, W. CUI, and C. A. MICHELS, 1996  Characterization of the glucose-induced inactivation of maltose permease in Saccharomyces cerevisiae.. J. Bacteriol. 178:2245-2254[Abstract/Free Full Text].

NEEDLEMAN, R. B., 1991  Control of maltase synthesis in yeast. Mol. Microbiol. 5:2079-2084[Medline].

NEHLIN, J. O. and H. RONNE, 1990  Yeast MIG1 repressor is related to the mammalian early growth response and Wilms' tumor finger proteins. EMBO J. 9:2891-2898[Medline].

NEHLIN, J. O., M. CARLBERG, and H. RONNE, 1991  Control of yeast GAL genes by MIG1 repressor: a transcriptional cascade in the glucose response. EMBO J. 10:3373-3377[Medline].

NG, R. and J. ABELSON, 1980  Isolation and sequence of the gene for actin in Saccharomyces cerevisiae.. Proc. Natl. Acad. Sci. USA 77:3912-3916[Abstract/Free Full Text].

OZCAN, S. and M. JOHNSTON, 1995  Three different regulatory mechanisms enable yeast hexose transporter (HXT) genes to be induced by different levels of glucose. Mol. Cell. Biol. 15:1564-1572[Abstract].

OZCAN, S., F. SCHULTE, K. FREIDEL, A. WEBER, and M. CIRIACY, 1994  Glucose uptake and metabolism in grr1/cat80 mutants of Saccharomyces cerevisiae.. Eur. J. Biochem. 224:605-611[Medline].

OZCAN, S., J. DOVER, A. G. ROSENWALD, D. WOLFL, and M. JOHNSTON, 1996a  Two glucose transporters in Saccharomyces cerevisiae are glucose sensors that generate a signal for induction of gene expression. Proc. Natl. Acad. Sci. USA 93:12428-12432[Abstract/Free Full Text].

OZCAN, S., T. LEONG, and M. JOHNSTON, 1996b  Rgt1p of Saccharomyces cerevisiae, a key regulator of glucose-induced genes, is both an activator and a repressor of transcription. Mol. Cell. Biol. 16:6419-6426[Abstract].

PLATT, A. and R. J. REECE, 1998  The yeast galactose genetic switch is mediated by the formation of a Gal4p-Gal80p-Gal3p complex. EMBO J. 17:4086-4091[Medline].

RONNE, H., 1995  Glucose repression in fungi. Trends Genet. 11:12-17[Medline].

ROSE, M., W. ALBIG, and K. D. ENTIAN, 1991  Glucose repression in Saccharomyces cerevisiae is directly associated with hexose phosphorylation by hexokinase-PI and hexokinase-PII. Eur. J. Biochem. 199:511-518[Medline].

ROSE, M. D., F. WINSTON and P. HIETER, 1990 Methods in Yeast Genetics: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

SHERWOOD, P. W. and M. CARLSON, 1997  Mutations in GSF1 and GSF2 alter glucose signaling in Saccharomyces cerevisiae.. Genetics 147:557-566[Abstract].

SUZUKI-FUJIMOTO, T., M. FUKUMA, K.-I. YANO, H. SAKURAI, and A. VONIKA et al., 1996  Analysis of the galactose signal transduction pathway in Saccharomyces cerevisiae: interaction between Gal3p and Gal80p. Mol. Cell. Biol. 16:2504-2508[Abstract].

TU, J. and M. CARLSON, 1994  The GLC7 type 1 protein phosphatase is required for glucose repression in Saccharomyces cerevisiae.. Mol. Cell. Biol. 14:6789-6796[Abstract/Free Full Text].

TU, J. and M. CARLSON, 1995  REG1 binds to protein phosphatase type 1 and regulates glucose repression in Saccharomyces cerevisiae.. EMBO J. 14:5939-5946[Medline].

VALLIER, L. G. and M. CARLSON, 1994  Synergistic release from glucose repression by mig1 and ssn mutations in Saccharomyces cerevisiae.. Genetics 137:49-54[Abstract].

VALLIER, L. G., D. COONS, L. F. BISSON, and M. CARLSON, 1994  Altered regulatory responses to glucose are associated with a glucose transport defect in grr1 mutants of Saccharomyces cerevisiae.. Genetics 136:1279-1285[Abstract].

VINCENT, O. and M. CARLSON, 1998  Sip4, a Snf1 kinase-dependent transcriptional activator, binds to the carbon source-responsive element of gluconeogenic genes. EMBO J. 17:7002-7008[Medline].

WANG, J., O. SIRENKO, and R. NEEDLEMAN, 1997  Genomic footprinting of Mig1p in the MAL62 promoter: binding is dependent upon carbon source and competitive with Mal63p activator. J. Biol. Chem. 272:4613-4622[Abstract/Free Full Text].

WILSON, W. A., S. A. HAWLEY, and D. G. HARDIE, 1996  Glucose repression/derepression in budding yeast: Snf1 protein kinase is activated by phosphorylation under derepressing conditions, and this correlates with a high AMP:ATP ratio. Curr. Biol. 6:1426-1434[Medline].

WOODS, A., M. R. MUNDAY, J. SCOTT, X. YANG, and M. CARLSON et al., 1994  Yeast Snf1 is functionally related to mammalian AMP-activated protein kinase and regulates acetyl-CoA carboxylase in vivo.. J. Biol. Chem. 269:19509-19515[Abstract/Free Full Text].

YANO, K.-I. and T. FUKASAWA, 1997  Galactose-dependent reversible interaction of Gal3p with Gal80p in the induction pathway of Gal4p-activated genes of Saccharomyces cerevisiae.. Proc. Natl. Acad. Sci. USA 94:1721-1726[Abstract/Free Full Text].

ZENKE, F. T., R. ENGELS, V. VOLLENBROICH, J. MEYER, and C. P. HOLLENBERG et al., 1996  Activation of Gal4p by galactose-dependent interaction of galactokinase and Gal80p. Science 272:1662-1665[Abstract].

This article has been cited by other articles:

				J. Houghton-Larsen and A. Brandt Fermentation of High Concentrations of Maltose by Saccharomyces cerevisiae Is Limited by the COMPASS Methylation Complex Appl. Envir. Microbiol., November 1, 2006; 72(11): 7176 - 7182. [Abstract] [Full Text] [PDF]

G. M. Santangelo