- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Loeb, J. D. J.
- Articles by Liu, H.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Loeb, J. D. J.
- Articles by Liu, H.
Saccharomyces cerevisiae G1 Cyclins Are Differentially Involved in Invasive and Pseudohyphal Growth Independent of the Filamentation Mitogen-Activated Protein Kinase Pathway
Jonathan D. J. Loeba, Tatiana A. Kerentsevaa, Ting Pana, Marisa Sepulveda-Becerraa, and Haoping Liuaa Department of Biological Chemistry, University of California, Irvine, California 92687
Corresponding author: Haoping Liu, Department of Biological Chemistry, University of California, 240D Med Sci I, Irvine, CA 92697.
Communicating editor: F. WINSTON
| ABSTRACT |
|---|
Several lines of evidence suggest that the morphogenetic transition from the yeast form to pseudohyphae in Saccharomyces cerevisiae may be regulated by the cyclin-dependent kinase (Cdk). To examine this hypothesis, we mutated all of the G1 cyclin genes in strains competent to form pseudohyphae. Interestingly, mutation of each G1 cyclin results in a different filamentation phenotype, varying from a significant defect in cln1/cln1 strains to enhancement of filament production in cln3/cln3 strains. cln1 cln2 double mutants are more defective in pseudohyphal development and haploid invasive growth than cln1 strains. FLO11 transcription, which correlates with the level of invasive growth, is low in cln1 cln2 mutants and high in grr1 cells (defective in proteolysis of Cln1,2), suggesting that Cln1,2/Cdks regulate the pseudohyphal transcriptional program. Epistasis analysis reveals that Cln1,2/Cdk and the filamentation MAP kinase pathway function in parallel in regulating filamentous and invasive growth. Cln1 and Cln2, but not Ste20 or Ste12, are responsible for most of the elevated FLO11 transcription in grr1 strains. Furthermore, phenotypic comparison of various filamentation mutants illustrates that cell elongation and invasion/cell-cell adhesion during filamentation are separable processes controlled by the pseudohyphal transcriptional program. Potential targets for G1 cyclin/Cdks during filamentous growth are discussed.
SACCHAROMYCES cerevisiae yeast form cells undergo a transition to pseudohyphal growth upon starvation for nitrogen (![]()
![]()
![]()
![]()
![]()
![]()
In S. cerevisiae, the MAP kinase pathway for filamentous growth shares elements with the mating signal transduction pathway, including Ste20 (PAK, P21-activated kinase), Ste11 (MEKK, MAP kinase kinase), Ste7 (MEK, MAP kinase), and the transcription factor Ste12 (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
A number of physiological changes, such as cell shape, budding pattern, and cell-cell attachment, are necessary for filament formation. Besides Flo11, other important targets necessary for filamentous growth are largely unknown. Two lines of evidence suggest that the alternation of cell shape may involve regulation by the cyclin-dependent kinase (CDK) system (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Another strand of suggestive evidence is from comparison of the cell cycle between the yeast form and pseudohyphal form (![]()
![]()
![]()
![]()
![]()
On the basis of these observations, our laboratory has begun to examine the role of G1 CDKs in filamentous growth. We have shown previously that a G1 cyclin is necessary for maintenance of hyphal growth in C. albicans (![]()
![]()
![]()
![]()
| MATERIALS AND METHODS |
|---|
Yeast strains and media:
All yeast strains used are congenic to the
1278b background and are listed in Table 1. The cln1::URA3 deletion mutation was introduced with a cln1::hisGURA3hisG construct (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
|
Plasmids:
pADH-CLN1 (pHL377) and pADH-CLN2 (pHL-379) plasmids were constructed by inserting the ADH promoter region, a BamHI-SalI fragment from the pAD4 plasmid (from Wigler lab), to the BamHI/SalI site of GAL-CLN1/pRS316 and GAL-CLN2/pRS316 plasmids, respectively. The GAL-CLN1 and GAL-CLN2 plasmids were isolated from a cDNA library (![]()
Microscopy:
Closeups of Saccharomyces microcolony morphology were made by growing cells on microscope slides on which a thin layer of solid growth medium had been poured. Cells were streaked onto the slides with toothpicks and then the cultures were allowed to grow for ~12 hr at 30°. Then coverslips were placed over the cells, and a Zeiss (Thornwood, NY) Axioplan 2 with a 100x objective and Nomarski imaging were used for photography. Pictures of Saccharomyces colony morphology were taken on a Zeiss Telaval 31 with 5x objective after 4 days of growth on SLAD medium.
Northern blotting:
Yeast cells were diluted from saturated cultures and grown to early log in YPD before harvesting. Total RNA was extracted from cell pellets by phenol extraction (![]()
![]()
-32P]dCTP (New England Nuclear, Boston, MA). A 1.5-kb BamHI-HindIII fragment of ACT1 was used for ACT1 probe. Oligos 5' GTAACTCCTGCCACTAATGCCGTA and 5' CCACATAAAGTTTCCAAGAACCTTG were used to amplify a 350-bp fragment from the Flo11 C-terminal region for the FLO11 probe.
| RESULTS |
|---|
Saccharomyces G1 cyclin mutations have differing effects on filamentous growth:
To investigate whether the G1 cyclins Cln1 and Cln2 are required for pseudohyphal growth, we deleted them in diploid strains (
1278b, a wild-type pseudohyphal growth competent strain) and examined their ability to form filaments on nitrogen starvation medium. Diploid cln1/cln1 strains produced chains of round cells upon nitrogen starvation and gave rise to colonies with rare stubby filaments (Figure 1A). cln2/cln2 mutant stains, on the other hand, generated cells slightly longer than those of the wild type and were able to produce long chains of filaments. Strikingly, cln1/cln1 cln2/cln2 strains completely lost the ability to form pseudohyphal colonies (Figure 1A). The double mutants made enlarged round cells, which became misshapen with a wrinkled cell wall after longer incubation on nitrogen starvation medium. The phenotypes of cln1/cln1 and cln2/cln2 single mutant strains suggest that Cln1 is the major cyclin involved in filamentous growth. The more severe phenotype observed in cln1/cln1 cln2/cln2 double mutants indicates that Cln1 and Cln2 have overlapping roles in this phenomenon. This notion of semiredundant function between these homologues is further supported by the observation that overexpression of either CLN1 or CLN2 gene slightly stimulated cell elongation in wild-type cells (Figure 1C).
|
Diploid cln3/cln3 strains in the
1278b background consistently generated longer cells and better filaments than wild-type strains (Figure 1B). The enhanced pseudohyphal growth caused by deletion of CLN3 was more evident in a cln3/cln3 cln1/cln1 double mutant because the double mutant behaved like cln3/cln3 and had much more florid filaments than cln1/cln1 strains (Figure 1B). Thus, Cln3 has an antagonistic effect on pseudohyphal growth. The inhibitory activity of the Cln3 protein is further supported by the phenotype of a dominant CLN3 mutation. CLN3-1 (DAF1-1) was isolated as a mutant that fails to arrest its cell cycle in the presence of mating pheromone (![]()
cells as determined by Southern hybridization (data not shown), and the haploid cells were mated to generate diploid CLN3-1 strains. CLN3-1 diploid cells exhibit a small round cell morphology on SLAD medium (Figure 1C), confirming the inhibitory effect of Cln3 on cell elongation.
However, the nitrogen starvation signal is not mediated through Cln3 because diploid cln3 cells are not elongated on media with ample nitrogen, such as the yeast synthetic complete medium (![]()
Relationship between G1 cyclins and the Kss1 MAP kinase pathway in filamentous growth:
Cln1,2/Cdk have been proposed to activate Cdc42 in promoting polarization of the actin cytoskeleton (![]()
![]()
![]()
![]()
![]()
![]()
|
Reciprocal experiments to determine the effect of MAP kinase stimulation in G1 cyclin mutants were also performed. Activation of the MAP kinase pathway by either overexpression of STE20 or introduction of a gain-of-function mutation STE11-4 can enhance filamentous growth in wild-type cells. In cln1/cln1 cln2/cln2 mutants, overexpression of STE20 or STE11-4 can partially suppress the cell elongation defect (Figure 2B). Similarly, they partially alleviate the defect in pseudohyphal colony formation of cln1/cln1 cln2/cln2 diploids (not shown). While the effect of stimulation of the STE pathway on cln1/cln1 cln2/cln2 is more pronounced than the effect of CLN1 overexpression on ste mutants, it is important to note that stimulation of pseudohyphal growth by overexpression of CLN1 or CLN2 is much weaker than that observed for enhancers of the MAP kinase pathway. Nevertheless, the bidirectional nature of these epistasis studies indicates that the MAP kinase pathway and Cln1,2 may function in parallel in regulating pseudohyphal growth.
As shown above, cln3/cln3 mutant strains are more filamentous than wild type. This enhanced filamentation may function through the Kss1/MAP kinase pathway. To test this possibility, diploid strains mutated in both STE12 and CLN3 genes were constructed. The ste12/ste12 cln3/cln3 homozygous diploids were found as defective in pseudohyphal development as the ste12/ste12 single mutants (Figure 2C), indicating that most of the Cln3 inhibitory activity on pseudohyphal growth may act through Ste12.
Cln1 and Cln2 are involved in haploid invasive growth:
Many mutants defective in pseudohyphal growth are also impaired in haploid invasive growth into rich solid medium (![]()
![]()
|
Consistent with the result that diminished activity of G1 cyclins leads to reduced invasiveness, grr1 mutants, which stabilize Cln1 and Cln2 and thus lead to very high concentrations of these normally labile proteins, had a greatly enhanced level of invasive growth into the agar surface as monitored by a washing assay (Figure 3B). First, a haploid grr1 mutant shows elevated invasive growth compared to wild-type strains. Hyperinvasiveness is even more pronounced in grr1/grr1 diploids. While wild-type diploid strains do not invade solid medium, a diploid grr1 strain invades as well as a wild-type haploid strain (Figure 3B). Invasiveness is much reduced in both cln1 cln2 grr1 haploid and diploid strains, suggesting that the accumulation of stable Cln1 and Cln2 contributed to most of the elevated invasiveness observed in the grr1 mutant.
FLO11 transcription correlates with invasive growth in cln1cln2 and grr1 strains:
FLO11 was employed as a molecular marker for activity of the filamentation/invasive transcriptional program. FLO11 expression is higher in haploids than in diploids (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
|
|
|
Ste12 and Ste20 are required for FLO11 transcription but grr1 can bypass these requirements:
The FLO11 promoter has been shown to contain potential Ste12/Tec1 binding sites and overexpression of FLO11 suppresses the defect of invasive growth in haploid ste12 strains (![]()
![]()
![]()
We further investigated whether the Cln1- and Cln2-mediated activation of FLO11 transcription in grr1 mutants requires Ste12. FLO11 transcript levels in ste12 grr1 strains were analyzed by Northern hybridization. While Ste12 is required for FLO11 transcription in wild-type haploid cells, grr1 mutant haploid and diploid cells both express FLO11 in the absence of STE12 (Figure 4B). Thus, mutations in grr1 enhance FLO11 transcription and can bypass the requirement for Ste12. Similarly, Ste20 is necessary for FLO11 expression in wild-type cells while mutations in grr1 can bypass the requirement for Ste20 (Figure 4C). In agreement with their levels of FLO11 expression, both ste12 grr1 and ste20 grr1 strains have similar amounts of invasive growth as the grr1 mutant (Figure 4D). ste12 grr1 or ste20 grr1 cells are also as elongated as grr1 cells (data not shown). Because Cln1 and Cln2 are required for the elevated FLO11 transcription in grr1 strains and Ste20 and Ste12 are not, Cln1,2 and the STE pathway must act on independent pathways to regulate FLO11 transcription.
Cell elongation and invasive growth/cell-cell adhesion are separable:
Although grr1 mutants show both an elevated level of invasive growth and cell elongation, cell elongation does not always correlate with invasion. For example, diploid clb2/clb2 cells of
1278b background are highly elongated even on rich medium (![]()
![]()
![]()
clb2 mutations can bypass the requirement of Cln1,2/CDK activity for polarized growth, but not the requirement for invasive growth:
![]()
1278 strain background generates extremely long cells on both rich media and under nitrogen starvation conditions (![]()
We also examined whether the clb2 mutation can suppress the defect of the cln1 cln2 mutant in haploid invasive growth. As shown in Figure 3C, haploid and diploid clb2 mutants have normal invasive behavior as compared to the wild type. While the clb2 mutant can completely suppress the defect in cell elongation of cln1cln2 mutants, it did not suppress the defect in haploid invasion. cln1 cln2 clb2 haploid strains had the same level of reduced invasive growth as cln1 cln2 strains (Figure 6B). Similarly, the clb2 mutation can suppress the defect of filamentous growth in a diploid ste12 mutant completely, but it did not suppress the invasive growth defect in haploid ste12 clb2 strains (Figure 6A and Figure B).
| DISCUSSION |
|---|
Our results demonstrate that the S. cerevisiae G1 cyclins Cln1 and Cln2 are necessary for pseudohyphal whereas the third G1 cyclin Cln3 is inhibitory to filamentous growth. Furthermore, we found that a mechanism of Cln1 and Cln2 activation of filamentous growth is independent of the well-understood STE MAP kinase pathway. A schematic depiction of a model concerning cyclin function in filamentous growth based on our results is shown in Figure 7.
|
G1 cyclin mutants define a STE-independent pathway necessary for filamentous development:
No epistasis is observed between CLN1,2 and elements of the Kss1 MAP kinase pathway when assayed for pseudohyphal growth. Overexpression of CLN1 can partially suppress the defect in either ste7/ste7 or ste12/ste12 cells while activation of the filamentation MAP kinase pathway can also partially bypass the defect in cln1/cln1 cln2/cln2 mutants. The bidirectional nature of these epistasis studies indicates that Cln1,2 and the MAP kinase pathway function in parallel. By comparison, overexpression of the Ste12 transcription factor can bypass a ste11/stell mutant whereas an activated STE11-4 mutant cannot bypass a ste12/ste12 mutant, thereby indicating that Ste11 and Ste12 function in series (![]()
The relationship between Cln1,2/Cdk and Ste20 is more complex. Ste20 is upstream of the MAP kinase pathway and is thought to have additional targets involved in cell morphogenesis. Cln1,2/Cdks are responsible for the cyclic phosphorylation of Ste20 (![]()
![]()
![]()
![]()
However, the role for the Ste20 phosphorylation activity of Cln1,2/Cdk may be limited to the morphogenesis function of Ste20. There is no evidence that phosphorylation of Ste20 by Cln1,2/Cdk is necessary for transcriptional activation of invasive/pseudohyphal genes. On the other hand, while Cln1,2 are responsible for much of the elevated FLO11 transcription in grr1 mutants, deletion of neither STE20 nor STE12 in grr1 mutants blocks FLO11 transcription (Figure 4). This strongly suggests that the Cln1,2/Cdk-mediated transcriptional activation of FLO11, and probably other invasion/pseudohyphal genes, is through a STE-independent pathway. Therefore, there must be other important targets in addition to Ste20 for Cln1,2/Cdk during invasive and pseudohyphal growth.
Differential requirement for G1 cyclins in pseudohyphal growth:
Mutations in each of the three G1 cyclins have a different filamentous growth phenotype. Deletion of CLN1 in diploids confers a moderate defect in pseudohyphal development and cln2/cln2 mutants are apparently normal for pseudohyphal development, whereas cln3/cln3 strains generate better filaments. The functions of Cln1 and Cln2 are apparently overlapping, because a cln1/cln1 cln2/cln2 strain is completely defective in pseudohyphal development (Figure 1). Consistent with their null phenotypes, overexpression of CLN1 or CLN2 promotes cell elongation while the CLN3-1 dominant active mutation gave rise to small round cells under pseudohyphal growth-stimulating conditions. The inhibitory activity of Cln3 is most evident in cln3/cln3 cln1/cln1 diploid cells because they generate florid filaments whereas cln1/cln1 cells are defective in pseudohyphal growth. Epistasis analysis between the CLN1,2 pair and CLN3 is limited by the requirement for at least one of these G1 cyclins for viability. On the other hand, the phenotype of a cln3/cln3 ste12/ste12 double mutant indicates that Ste12 activity is required for pseudohyphal development in cln3/cln3 mutants (Figure 2). Interestingly, in a recent comprehensive study of cell-cycle-regulated genes, overexpression of CLN3 in cln1cln2 background was unexpectedly found to inhibit basal expression of many pheromone-responsive genes (![]()
![]()
![]()
![]()
![]()
Our observations also stress the differences between Cln1 and Cln2. We found that cln1 mutant strains are impaired in haploid invasive growth and filamentous growth while cln2 strains have no detectable phenotypes. It is possible that Cln1 and Cln2 have different targets while sharing some overlapping functions, considering that overexpression of CLN1 or CLN2 both promoted pseudohyphal growth (Figure 1). Unfortunately, CLN1 and CLN2 transcripts in nitrogen-starved diploid cells are not sufficiently abundant for an accurate detection by Northern blotting. Therefore, we are unable to determine whether this difference is due to variance in environment-specific expression between these two genes. Our findings are consistent with a number of other previous reports that distinguish between CLN1 and CLN2, such as the transcriptional repression of CLN1 by glucose and the inhibition of FUS1 expression by CLN2 overproduction in the presence of Far1 (![]()
![]()
![]()
Potential targets for Cln1,2 cyclins during filamentous development:
Invasion and cell elongation are distinct processes. Some mutants are defective in one or the other function, where other mutants are defective in both. For example, consider the phenotypes of flo11 mutants. Haploid flo11 cells are not invasive (thought to be a measure of cell-cell adhesion) at all (![]()
Cell-cell adhesion and invasive growth correlates with transcription of FLO11. Cln1 and Cln2 are required for normal expression of FLO11. FLO11 transcription level is low in cln1 cln2 mutants and high in grr1 mutants (Figure 3C). As discussed above, the elevated FLO11 transcription in grr1 strains requires Cln1 and Cln2, but not Ste20 or Ste12. Therefore, Cln1- and Cln2-mediated activation of pseudohyphal growth or FLO11 expression is independent of Ste12 and the Kss1 MAP kinase pathway. Other than Ste12, several transcriptional regulators, such as Tec1, Flo8, Msn1, and Mss11, have been shown to be required for FLO11 expression and filamentous growth (![]()
![]()
![]()
cln/cln1 cln2/cln2 cells do not elongate under pseudohyphae inducing conditions. Therefore, Cln1,2/Cdk is necessary for both cell elongation during filamentous growth and cell adhesion/invasion. Given the complex nature by which cell elongation is regulated, Cln1,2/Cdk likely has multiple targets in promoting the cell elongation process during filamentous growth (Figure 7). One potential target could be a transcriptional regulator (or regulators) responsible for expression of proteins involved in cell elongation. This regulation may overlap with the transcriptional control of adhesion/invasion (pathways regulating FLO11) because many of the transcriptional factors required for FLO11 transcription also affect cell elongation (![]()
![]()
![]()
![]()
As discussed above, one of the other targets for Cln1,2/Cdk could be Ste20, a PAK kinase that functions upstream of the STE MAP kinase pathway. Other potential targets of Cln1,2/Cdk in promoting polarized growth include Cdc42 (![]()
![]()
![]()
![]()
![]()
![]()
G1 cyclins Cln1,2 may transmit nutrient availability information via Grr1:
Cln1 and Cln2 are regulated at the level of protein stability by CSFGrr1 (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
In summary, we found that different G1 cyclins have various effects on pseudohyphal growth. Cln1and Cln2 are involved in normal invasive/pseudohyphal growth and the transcription of a pseudohyphal-specific gene in S. cerevisiae. These findings for S. cerevisiae are consistent with our studies in C. albicans. A Cln1,2-like G1 cyclin of C. albicans is involved in maintenance of hyphal development under certain hyphal inducing conditions and is required for transcription of hyphal-specific genes (![]()
| ACKNOWLEDGMENTS |
|---|
We are grateful to Steve Kron for helpful discussions and for generously sharing unpublished data and reagents. We also thank Drs. A. Amon, B. F. Cross, S. Reed, B. Futcher, M. Tyers, A. M. Dranginis, and H. U. Moesch for plasmids and yeast strains. This work was supported by National Institutes of Health grant GM-55155. H. Liu is a new investigator of Burroughs Wellcome Fund.
Manuscript received April 12, 1999; Accepted for publication July 16, 1999.
| LITERATURE CITED |
|---|
AHN, S. H., A. ACURIO, and S. KRON, 1999 Regulation of G2/M progression by the STE MAP kinase pathway in budding yeast filamentous growth. Mol. Biol. Cell 10:3301-3316
ANDREWS, B. and V. MEASDAY, 1998 The cyclin family of budding yeast: abundant use of a good idea. Trends Genet. 14:66-72[Medline].
BANUETT, F., 1992 Ustilago maydis, the delightful blight. Trends Genet. 8:174-180[Medline].
BARONI, M. D., P. MONTI, and L. ALBERGHINA, 1994 Repression of growth-regulated G1 cyclin expression by cyclic AMP in budding yeast. Nature 371:339-342. (see comments).[Medline].
BARRAL, Y., S. JENTSCH, and C. MANN, 1995 G1 cyclin turnover and nutrient uptake are controlled by a common pathway in yeast. Genes Dev. 9:399-409
BLACKETER, M. J., P. MADAULE, and A. M. MYERS, 1995 Mutational analysis of morphologic differentiation in Saccharomyces cerevisiae.. Genetics 140:1259-1275[Abstract].
BROWN, J. L., M. JAQUENOUD, M. P. GULLI, J. CHANT, and M. PETER, 1997 Novel Cdc42-binding proteins Gic1 and Gic2 control cell polarity in yeast. Genes Dev. 11:2972-2982
CHEN, G. C., Y. J. KIM, and C. S. CHAN, 1997 The Cdc42 GTPase-associated proteins Gic1 and Gic2 are required for polarized cell growth in Saccharomyces cerevisiae. Genes Dev. 11:2958-2971
COOK, J. G., L. BARDWELL, and J. THORNER, 1997 Inhibitory and activating functions for MAPK Kss1 in the S. cerevisiae filamentous-growth signalling pathway. Nature 390:85-88[Medline].
CROSS, F. R., 1988 DAF1, a mutant gene affecting size control, pheromone arrest, and cell cycle kinetics of Saccharomyces cerevisiae. Mol. Cell. Biol. 8:4675-4684
DIRICK, L., T. BOHM, and K. NASMYTH, 1995 Roles and regulation of Cln-Cdc28 kinases at the start of the cell cycle of Saccharomyces cerevisiae. EMBO J. 14:4803-4813[Medline].
EDGINGTON, N. P., M. J. BLACKETER, T. A. BIERWAGEN, and A. M. MYERS, 1999 Control of Saccharomyces cerevisiae filamentous growth by cyclin-dependent kinase Cdc28. Mol. Cell. Biol. 19:1369-1380
FLICK, J. S. and M. JOHNSTON, 1991 GRR1 of Saccharomyces cerevisiae is required for glucose repression and encodes a protein with leucine-rich repeats. Mol. Cell. Biol. 11:5101-5112
GAGIANO, M., D. VAN DYK, F. F. BAUER, M. G. LAMBRECHTS, and I. S. PRETORIUS, 1999 Msn1p/Mss10p, Mss11p and Muc1p/Flo11p are part of a signal transduction pathway downstream of Mep2p regulating invasive growth and pseudohyphal differentiation in Saccharomyces cerevisiae. Mol. Microbiol. 31:103-116[Medline].
GALLEGO, C., E. GARI, N. COLOMINA, E. HERRERO, and M. ALDEA, 1997 The Cln3 cyclin is down-regulated by translational repression and degradation during the G1 arrest caused by nitrogen deprivation in budding yeast. EMBO J. 16:7196-7206[Medline].
GIMENO, C. J., P. O. LJUNGDAHL, C. A. STYLES, and G. R. FINK, 1992 Unipolar cell divisions in the yeast S. cerevisiae lead to filamentous growth: regulation by starvation and RAS. Cell 68:1077-1090[Medline].
GRAY, J. V., J. P. OGAS, Y. KAMADA, M. STONE, and D. E. LEVIN et al., 1997 A role for the Pkc1 MAP kinase pathway of Saccharomyces cerevisiae in bud emergence and identification of a putative upstream regulator. EMBO J. 16:4924-4937[Medline].
GREENBERG, M. E., 1987 Preparation and analysis of RNA, p. 13.12.1 in Current Protocols in Molecular Biology, edited by F. M. AUSUBEL, R. BRENT, R. E. KINSTON, D. D. MOORE, J. G. SEIDMAN, J. H. SMITH and K. STRUHL. John Wiley & Sons, New York.
HADWIGER, J. A., C. WITTENBERG, H. E. RICHARDSON, M. DE BARROS LOPES, and S. I. REED, 1989 A family of cyclin homologs that control the G1 phase in yeast. Proc. Natl. Acad. Sci. USA 86:6255-6259
IRAQUI, I., S. VISSERS, F. BERNARD, J. O. DE CRAENE, and E. BOLES et al., 1999 Amino acid signaling in Saccharomyces cerevisiae: a permease-like sensor of external amino acids and F-Box protein Grr1p are required for transcriptional induction of the AGP1 gene, which encodes a broad-specificity amino acid permease. Mol. Cell. Biol. 19:989-1001
JAQUENOUD, M., M. P. GULLI, K. PETER, and M. PETER, 1998 The Cdc42p effector Gic2p is targeted for ubiquitin-dependent degradation by the SCFGrr1 complex. EMBO J. 17:5360-5373[Medline].
KISHI, T. and F. YAMAO, 1998 An essential function of Grr1 for the degradation of Cln2 is to act as a binding core that links Cln2 to Skp1. J. Cell Sci. 111:3655-3661[Abstract].
KRON, S. J. and N. A. GOW, 1995 Budding yeast morphogenesis: signalling, cytoskeleton and cell cycle. Curr. Opin. Cell Biol. 7:845-855[Medline].
KRON, S. J., C. A. STYLES, and G. R. FINK, 1994 Symmetric cell division in pseudohyphae of the yeast Saccharomyces cerevisiae. Mol. Biol. Cell 5:1003-1022[Abstract].
KUBLER, E., H. U. MOSCH, S. RUPP, and M. P. LISANTI, 1997 Gpa2p, a G-protein alpha-subunit, regulates growth and pseudohyphal development in Saccharomyces cerevisiae via a cAMP-dependent mechanism. J. Biol. Chem. 272:20321-20323
LAMBRECHTS, M. G., F. F. BAUER, J. MARMUR, and I. S. PRETORIUS, 1996 Muc1, a mucin-like protein that is regulated by Mss10, is critical for pseudohyphal differentiation in yeast. Proc. Natl. Acad. Sci. USA 93:8419-8424
LEBERER, E., K. ZIEGELBAUER, A. SCHMIDT, D. HARCUS, and D. DIGNARD et al., 1997 Virulence and hyphal formation of Candida albicans require the Ste20p-like protein kinase CaCla4p. Curr. Biol. 7:539-546[Medline].
LEVINE, K., K. HUANG, and F. R. CROSS, 1996 Saccharomyces cerevisiae G1 cyclins differ in their intrinsic functional specificities. Mol. Cell. Biol. 16:6794-6803[Abstract].
LEW, D. J. and S. I. REED, 1993 Morphogenesis in the yeast cell cycle: regulation by Cdc28 and cyclins. J. Cell Biol. 120:1305-1320
LEW, D. J. and S. I. REED, 1995 Cell cycle control of morphogenesis in budding yeast. Curr. Opin. Genet. Dev. 5:17-23[Medline].
LI, F. N. and M. JOHNSTON, 1997 Grr1 of Saccharomyces cerevisiae is connected to the ubiquitin proteolysis machinery through Skp1: coupling glucose sensing to gene expression and the cell cycle. EMBO J. 16:5629-5638[Medline].
LIU, H., J. KRIZEK, and A. BRETSCHER, 1992 Construction of a GAL1-regulated yeast cDNA expression library and its application to the identification of genes whose overexpression causes lethality in yeast. Genetics 132:665-673[Abstract].
LIU, H., C. A. STYLES, and G. R. FINK, 1993 Elements of the yeast pheromone response pathway required for filamentous growth of diploids. Science 262:1741-1744
LIU, H., C. A. STYLES, and G. R. FINK, 1996 Saccharomyces cerevisiae S288C has a mutation in FLO8, a gene required for filamentous growth. Genetics 144:967-978[Abstract].
LO, H. J., J. R. KOHLER, B. DIDOMENICO, D. LOEBENBERG, and A. CACCIAPUOTI et al., 1997 Nonfilamentous C. albicans mutants are avirulent. Cell 90:939-949[Medline].
LO, W. S. and A. M. DRANGINIS, 1996 FLO11, a yeast gene related to the STA genes, encodes a novel cell surface flocculin. J. Bacteriol. 178:7144-7151
LO, W. S. and A. M. DRANGINIS, 1998 The cell surface flocculin Flo11 is required for pseudohyphae formation and invasion by Saccharomyces cerevisiae. Mol. Biol. Cell 9:161-171
LOEB, J. D., M. SEPULVEDA-BECERRA, I. HAZAN, and H. LIU, 1999 A G1 cyclin is necessary for maintenance of filamentous growth in Candida albicans. Mol. Cell. Biol. 19:4019-4027
LORENZ, M. C. and J. HEITMAN, 1997 Yeast pseudohyphal growth is regulated by GPA2, a G protein alpha homolog. EMBO J. 16:7008-7018[Medline].
MADHANI, H. D. and G. R. FINK, 1997 Combinatorial control required for the specificity of yeast MAPK signaling. Science 275:1314-1317
MADHANI, H. D. and G. R. FINK, 1998 The control of filamentous differentiation and virulence in fungi. Trends Cell Biol 8:348-353[Medline].
MADHANI, H. D., C. A. STYLES, and G. R. FINK, 1997 MAP kinases with distinct inhibitory functions impart signaling specificity during yeast differentiation. Cell 91:673-684[Medline].
MENDENHALL, M. D. and A. E. HODGE, 1998 Regulation of Cdc28 cyclin-dependent protein kinase activity during the cell cycle of the yeast Saccharomyces cerevisiae. Microbiol. Mol. Biol. Rev. 62:1191-1243
MOSCH, H. U. and G. R. FINK, 1997 Dissection of filamentous growth by transposon mutagenesis in Saccharomyces cerevisiae. Genetics 145:671-684[Abstract].
MOSCH, H. U., R. L. ROBERTS, and G. R. FINK, 1996 Ras2 signals via the Cdc42/Ste20/mitogen-activated protein kinase module to induce filamentous growth in Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 93:5352-5356
NASMYTH, K. and L. DIRICK, 1991 The role of SW14 and SW16 in the activity of G1 cyclins in yeast. Cell 66:995-1013[Medline].
OEHLEN, L. J. and F. R. CROSS, 1994 G1 cyclins CLN1 and CLN2 repress the mating factor response pathway at Start in the yeast cell cycle. Genes Dev. 8:1058-1070
OEHLEN, L. J. and F. R. CROSS, 1998 Potential regulation of Ste20 function by the Cln1-Cdc28 and Cln2-Cdc28 cyclin-dependent protein kinases. J. Biol. Chem. 273:25089-25097
OZCAN, S., F. SCHULTE, K. FREIDEL, A. WEBER, and M. CIRIACY, 1994 Glucose uptake and metabolism in grr1/cat80 mutants of Saccharomyces cerevisiae. Eur. J. Biochem. 224:605-611[Medline].
ROBERTS, R. L. and G. R. FINK, 1994 Elements of a single MAP kinase cascade in Saccharomyces cerevisiae mediate two developmental programs in the same cell type: mating and invasive growth. Genes Dev. 8:2974-2985
RUPP, S., E. SUMMERS, H. J. LO, H. MADHANI, and G. FINK, 1999 MAP kinase and cAMP filamentation signaling pathways converge on the unusually large promoter of the yeast FLO11 gene. EMBO J. 18:1257-1269[Medline].
SHERMAN, F., G. R. FINK and J. B. HICKS, 1986 Methods in Yeast Genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
SIKORSKI, R. S. and P. HIETER, 1989 A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122:19-27
SKOWYRA, D., K. L. CRAIG, M. TYERS, S. J. ELLEDGE, and J. W. HARPER, 1997 F-box proteins are receptors that recruit phosphorylated substrates to the SCF ubiquitin-ligase complex. Cell 91:209-219. (see comments).[Medline].
SPELLMAN, P. T., G. SHERLOCK, M. Q. ZHANG, V. R. IYER, and K. ANDERS et al., 1998 Comprehensive identification of cell cycle-regulated genes of the yeast Saccharomyces cerevisiae by microarray hybridization. Mol. Biol. Cell 9:3273-3297
STEVENSON, B. J., N. RHODES, B. ERREDE, and G. SPRAGUE, JR., 1992 Constitutive mutants of the protein kinase STE11 activate the yeast pheromone response pathway in the absence of the G protein. Genes Dev. 6:1293-1304
STUART, D. and C. WITTENBERG, 1995 CLN3, not positive feedback, determines the timing of CLN2 transcription in cycling cells. Genes Dev. 9:2780-2794
TOKIWA, G., M. TYERS, T. VOLPE, and B. FUTCHER, 1994 Inhibition of G1 cyclin activity by the Ras/cAMP pathway in yeast. Nature 371:342-345. (see comments).[Medline].
TYERS, M., G. TOKIWA, and B. FUTCHER, 1993 Comparison of the Saccharomyces cerevisiae G1 cyclins: Cln3 may be an upstream activator of Cln1, Cln2 and other cyclins. EMBO J. 12:1955-1968[Medline].
WU, C., T. LEEUW, E. LEBERER, D. Y. THOMAS, and M. WHITEWAY, 1998 Cell cycle- and Cln2p-Cdc28p-dependent phosphorylation of the yeast Ste20p protein kinase. J. Biol. Chem. 273:28107-28115
This article has been cited by other articles:
![]() |
A. M. Dranginis, J. M. Rauceo, J. E. Coronado, and P. N. Lipke A Biochemical Guide to Yeast Adhesins: Glycoproteins for Social and Antisocial Occasions Microbiol. Mol. Biol. Rev., June 1, 2007; 71(2): 282 - 294. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-U. Park, H. Hur, M. Ka, and J. Kim Identification of Translational Regulation Target Genes during Filamentous Growth in Saccharomyces cerevisiae: Regulatory Role of Caf20 and Dhh1 Eukaryot. Cell, December 1, 2006; 5(12): 2120 - 2127. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. M. Santangelo Glucose Signaling in Saccharomyces cerevisiae Microbiol. Mol. Biol. Rev., March 1, 2006; 70(1): 253 - 282. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Castillo-Lluva and J. Perez-Martin The Induction of the Mating Program in the Phytopathogen Ustilago maydis Is Controlled by a G1 Cyclin PLANT CELL, December 1, 2005; 17(12): 3544 - 3560. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. S. Bensen, A. Clemente-Blanco, K. R. Finley, J. Correa-Bordes, and J. Berman The Mitotic Cyclins Clb2p and Clb4p Affect Morphogenesis in Candida albicans Mol. Biol. Cell, July 1, 2005; 16(7): 3387 - 3400. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Chapa y Lazo, S. Bates, and P. Sudbery The G1 Cyclin Cln3 Regulates Morphogenesis in Candida albicans Eukaryot. Cell, January 1, 2005; 4(1): 90 - 94. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Bachewich and M. Whiteway Cyclin Cln3p Links G1 Progression to Hyphal and Pseudohyphal Development in Candida albicans Eukaryot. Cell, January 1, 2005; 4(1): 95 - 102. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. van Dyk, I. S. Pretorius, and F. F. Bauer Mss11p Is a Central Element of the Regulatory Network That Controls FLO11 Expression and Invasive Growth in Saccharomyces cerevisiae Genetics, January 1, 2005; 169(1): 91 - 106. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Spielewoy, K. Flick, T. I. Kalashnikova, J. R. Walker, and C. Wittenberg Regulation and Recognition of SCFGrr1 Targets in the Glucose and Amino Acid Signaling Pathways Mol. Cell. Biol., October 15, 2004; 24(20): 8994 - 9005. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Queralt and J. C. Igual Functional Distinction Between Cln1p and Cln2p Cyclins in the Control of the Saccharomyces cerevisiae Mitotic Cycle Genetics, September 1, 2004; 168(1): 129 - 140. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Prinz, I. Avila-Campillo, C. Aldridge, A. Srinivasan, K. Dimitrov, A. F. Siegel, and T. Galitski Control of Yeast Filamentous-Form Growth by Modules in an Integrated Molecular Network Genome Res., March 1, 2004; 14(3): 380 - 390. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. van Dyk, G. Hansson, I. S. Pretorius, and F. F. Bauer Cellular Differentiation in Response to Nutrient Availability: The Repressor of Meiosis, Rme1p, Positively Regulates Invasive Growth in Saccharomyces cerevisiae Genetics, November 1, 2003; 165(3): 1045 - 1058. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. Cullen and G. F. Sprague Jr. The Glc7p-Interacting Protein Bud14p Attenuates Polarized Growth, Pheromone Response, and Filamentous Growth in Saccharomyces cerevisiae Eukaryot. Cell, December 1, 2002; 1(6): 884 - 894. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kohler, S. Wesche, N. Taheri, G. H. Braus, and H.-U. Mosch Dual Role of the Saccharomyces cerevisiae TEA/ATTS Family Transcription Factor Tec1p in Regulation of Gene Expression and Cellular Development Eukaryot. Cell, October 1, 2002; 1(5): 673 - 686. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. P. Palecek, A. S. Parikh, and S. J. Kron Sensing, signalling and integrating physical processes during Saccharomyces cerevisiae invasive and filamentous growth Microbiology, April 1, 2002; 148(4): 893 - 907. [Full Text] [PDF] |
||||
![]() |
E. Gari, T. Volpe, H. Wang, C. Gallego, B. Futcher, and M. Aldea Whi3 binds the mRNA of the G1 cyclin CLN3 to modulate cell fate in budding yeast Genes & Dev., November 1, 2001; 15(21): 2803 - 2808. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-H. Ahn, B. T. Tobe, J. N. F. Gerald, S. L. Anderson, A. Acurio, and S. J. Kron Enhanced Cell Polarity in Mutants of the Budding Yeast Cyclin-dependent Kinase Cdc28p Mol. Biol. Cell, November 1, 2001; 12(11): 3589 - 3600. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Miled, C. Mann, and G. Faye Xbp1-Mediated Repression of CLB Gene Expression Contributes to the Modifications of Yeast Cell Morphology and Cell Cycle Seen during Nitrogen-Limited Growth Mol. Cell. Biol., June 1, 2001; 21(11): 3714 - 3724. [Abstract] [Full Text] |
||||
![]() |
R. La Valle and C. Wittenberg A Role for the Swe1 Checkpoint Kinase During Filamentous Growth of Saccharomyces cerevisiae Genetics, June 1, 2001; 158(2): 549 - 562. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. G. Hsiung, H.-C. Chang, J.-L. Pellequer, R. La Valle, S. Lanker, and C. Wittenberg F-Box Protein Grr1 Interacts with Phosphorylated Targets via the Cationic Surface of Its Leucine-Rich Repeat Mol. Cell. Biol., April 1, 2001; 21(7): 2506 - 2520. [Abstract] [Full Text] |
||||
![]() |
R. S. Nash, T. Volpe, and B. Futcher Isolation and Characterization of WHI3, a Size-Control Gene of Saccharomyces cerevisiae Genetics, April 1, 2001; 157(4): 1469 - 1480. [Abstract] [Full Text] |
||||
![]() |
Z. Zhang, M. M. Smith, and J. S. Mymryk Interaction of the E1A Oncoprotein with Yak1p, a Novel Regulator of Yeast Pseudohyphal Differentiation, and Related Mammalian Kinases Mol. Biol. Cell, March 1, 2001; 12(3): 699 - 710. [Abstract] [Full Text] |
||||
![]() |
K. B. Lengeler, R. C. Davidson, C. D'souza, T. Harashima, W.-C. Shen, P. Wang, X. Pan, M. Waugh, and J. Heitman Signal Transduction Cascades Regulating Fungal Development and Virulence Microbiol. Mol. Biol. Rev., December 1, 2000; 64(4): 746 - 785. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Chen, S. Zhou, Q. Wang, X. Chen, T. Pan, and H. Liu Crk1, a Novel Cdc2-Related Protein Kinase, Is Required for Hyphal Development and Virulence in Candida albicans Mol. Cell. Biol., December 1, 2000; 20(23): 8696 - 8708. [Abstract] [Full Text] |
||||
![]() |
M. Schröder, J. S. Chang, and R. J. Kaufman The unfolded protein response represses nitrogen-starvation induced developmental differentiation in yeast Genes & Dev., December 1, 2000; 14(23): 2962 - 2975. [Abstract] [Full Text] |
||||
![]() |
P. J. Cullen and G. F. Sprague Jr. Glucose depletion causes haploid invasive growth in yeast PNAS, November 22, 2000; (2000) 240345197. [Abstract] [Full Text] |
||||
![]() |
S. P. Palecek, A. S. Parikh, and S. J. Kron Genetic Analysis Reveals That FLO11 Upregulation and Cell Polarization Independently Regulate Invasive Growth in Saccharomyces cerevisiae Genetics, November 1, 2000; 156(3): 1005 - 1023. [Abstract] [Full Text] |
||||
![]() |
P. J. Cullen and G. F. Sprague Jr. Glucose depletion causes haploid invasive growth in yeast PNAS, December 5, 2000; 97(25): 13619 - 13624. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Hazan, M. Sepulveda-Becerra, and H. Liu Hyphal Elongation Is Regulated Independently of Cell Cycle in Candida albicans Mol. Biol. Cell, January 1, 2002; 13(1): 134 - 145. [Abstract] [Full Text] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Loeb, J. D. J.
- Articles by Liu, H.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Loeb, J. D. J.
- Articles by Liu, H.
















