Genetics, Vol. 153, 1445-1453, November 1999, Copyright © 1999

DNA Variation in the Basic Chitinase Locus (ChiB) Region of the Wild Plant Arabidopsis thaliana

Akira Kawabea and Naohiko T. Miyashitaa
a Laboratory of Plant Genetics, Graduate School of Agriculture, Kyoto University, Sakyo-ku, Kyoto, 606-8502 Japan

Corresponding author: Naohiko T. Miyashita, Laboratory of Plant Genetics, Graduate School of Agriculture, Kyoto University, Sakyo-ku, Kyoto 606-8502, Japan., arabis{at}kais.kyoto-u.ac.jp (E-mail)

Communicating editor: M. K. UYENOYAMA


*  ABSTRACT
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Nucleotide variation in a 2.2-kbp region of basic chitinase (ChiB) locus in 17 ecotypes of Arabidopsis thaliana was compared with previously investigated regions to investigate genetic mechanisms acting on DNA polymorphism. In the ChiB region, dimorphic DNA variation was detected, as in the Adh and ChiA regions. Nucleotide diversity ({pi}) of the entire region was 0.0091, which was similar to those of the two other regions. About half of polymorphic sites (37/87) in the ChiB region were observed in only two ecotypes. Tajima's D was negative but not significantly, while Fu and Li's D* was positive. Neither McDonald-Kreitman nor Hudson, Kreitman, Aguadé tests showed a significant result, indicating that these loci were under similar evolutionary mechanisms before and after speciation. Linkage disequilibria were observed within the three regions because of dimorphic polymorphisms. Interlocus linkage disequilibrium was not detected between the Adh and the two chitinase regions, but was observed between the ChiA and ChiB regions. This could be due to epistatic interaction between the two chitinase loci, which are located on different chromosomes.


IN Arabidopsis thaliana, DNA polymorphism was first reported in the alcohol dehydrogenase (Adh) region (HANFSTINGL et al. 1994 Down; INNAN et al. 1996 Down; MIYASHITA et al. 1996 Down). In the Adh region, dimorphic DNA variation was observed and considered the result of balancing selection (HANFSTINGL et al. 1994 Down) and/or fusion of two diverged subpopulations (INNAN et al. 1996 Down). Similarly, dimorphism was observed in the acidic chitinase (ChiA) region (KAWABE et al. 1997 Down) and Cauliflower (Cal) region (PURUGGANAN and SUDDITH 1998 Down), suggesting that the presence of the dimorphic variations could be a characteristic of the nuclear genome of A. thaliana. However, patterns of polymorphism (i.e., the proportion of singleton and replacement polymorphisms) and results of neutrality tests varied among the regions.

To clarify the mechanisms responsible for the different patterns of polymorphism in the regions, one approach is to compare loci that have similar function. The chitinase system in plants provides a good opportunity, since the system consists of multiple genes of similar function but distinct nucleotide (or amino acid) sequences. Chitinases are enzymes that catalyze hydrolysis of chitin and play an important role in plant defense systems against fungal pathogens. Plant chitinases are classified into four classes with respect to their structures. Class I chitinase has four motifs: signal peptide, cysteine-rich (chitin binding) domain, hinge region, and catalytic domain (SHINSHI et al. 1990 Down; COLLINGE et al. 1993 Down; HAMEL et al. 1997 Down). Class II and IV chitinases are similar to class I chitinase. Class II chitinase lacks the N-terminal cysteine-rich domain, while class IV chitinase is distinguished from class I chitinase by four deletions (COLLINGE et al. 1993 Down; HAMEL et al. 1997 Down). Class III chitinase is similar to bacterial chitinases and has lysozyme activities (METRAUX et al. 1989 Down; HENRISSAT 1990 Down; JEKEL et al. 1991 Down; WATANABE et al. 1992 Down; BEINTEMA and TERWISSCHA VAN SCHELTINGA 1996 Down). Of the four classes of chitinases, only class III chitinase has no sequence similarities and may have an independent evolutionary origin (MEINS et al. 1992 Down; COLLINGE et al. 1993 Down; HAMEL et al. 1997 Down). As with other pathogenesis-related (PR) proteins, chitinases are classified as acidic or basic according to their protein constitutions and expression patterns. The acidic and basic chitinases are expressed in the central vacuole and intracellular space, respectively (MAUCH and STAEHELIN 1989 Down; METRAUX et al. 1989 Down). The induction mechanisms are also different between acidic and basic PR proteins. The acidic PR proteins are induced by salicylic acid, while basic PR proteins are induced by ethylene (OHASHI and OHSHIRO 1992 Down).

In A. thaliana, two chitinases, acidic (ChiA) and basic (ChiB) chitinases, were cloned and their DNA sequences were reported (SAMAC et al. 1990 Down). The ChiA locus has three exons, coding a protein 302 amino acids (aa) long, while the ChiB has two exons, whose product is 336 aa long. It is not possible to align nucleotide or amino acid sequences of the two chitinases. ChiA and ChiB are located on chromosomes 5 and 3, respectively (BELL and ECKER 1994 Down; SATO et al. 1998 Down). ChiA encodes a class III chitinase and ChiB a class I chitinase. These two chitinases were classified as acidic and basic chitinases, although both chitinases are basic proteins (BEINTEMA and TERWISSCHA VAN SCHELTINGA 1996 Down). This classification is based on their different expression patterns (SAMAC et al. 1990 Down; SAMAC and SHAH 1991 Down, SAMAC and SHAH 1994 Down). ChiB is expressed in the root tissue constitutively and induced by ethylene (SAMAC et al. 1990 Down; SAMAC and SHAH 1994 Down), as are other basic PR proteins (OHASHI and OHSHIRO 1992 Down). ChiA is expressed in root, leaf vascular, hydathode, guard cell, and anther tissues (SAMAC and SHAH 1991 Down) and is induced by salicylic acid (SAMAC and SHAH 1991 Down), typical for acidic PR proteins (OHASHI and OHSHIRO 1992 Down).

In this study, we report intraspecific nucleotide variation in a 2.2-kbp fragment of the ChiB region in A. thaliana using the same ecotypes (ecological races) analyzed for the ChiA region. The main purpose of this study is to investigate whether or not polymorphic patterns in the ChiA region are related to protein function. If the pattern of polymorphism in a locus is related to its function, similar patterns should be found in loci of similar function.


*  MATERIALS AND METHODS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Plant materials:
Seeds of 16 ecotypes of A. thaliana were obtained from Professor Nobuharu Goto, Sendai Arabidopsis Seed Stock Center, Miyagi University of Education, Sendai, Japan and were grown in soil pots in an incubator under 16-hr light and 8-hr dark conditions. These ecotypes were sampled worldwide. Sixteen of the 17 ecotypes were analyzed for Adh variation (INNAN et al. 1996 Down), and the same 17 ecotypes were analyzed for the ChiA region (KAWABE et al. 1997 Down). To estimate divergence, a related species, Arabis gemmifera (sampled at Ashibi, Kyoto prefecture, Japan), was used.

Sequencing:
Total DNA was extracted from mature plants by a CTAB method of WEISING et al. 1991 Down and used as template for PCR amplification. Primers for PCR amplification are 5' CGT CTA TTT TTA TTT TCT CCA 3' (BCH-1) and 5' TTG GTT TGA TGT TGG TTT TGT 3' (BCH-102), which amplifies a fragment about 2.5 kbp long encompassing the entire coding region of the ChiB locus. Two primers, BCH-1 and 5' AAG TTT AGG CTC TGA TTT ATG 3' (BCH-101), were used for A. gemmifera to amplify a fragment about 2.5 kbp long containing the entire coding region of the ChiB locus. The PCR products were cloned into plasmid pUC 18 as described in TERAUCHI et al. 1997 Down. Sequencing reactions (ALFexpress Auto Read sequence kit, Pharmacia, Piscataway, NJ) followed the dideoxy chain termination method (SANGER et al. 1977 Down) using cloned plasmid as the template. Sequencing primers were designed at ~350- to 400-bp intervals. Sequence for each ecotype was determined in both strands by a Pharmacia ALFred sequencer. Singleton variants were confirmed by sequencing more than two clones to eliminate PCR artifacts. Newly obtained nucleotide sequences were deposited in the DDBJ database under nos. AB023448–AB023464.

Sequence analyses:
Seventeen sequences including a published sequence of the ecotype Columbia (Col-0: SAMAC et al. 1990 Down) were studied. The analyzed region is located between nucleotide positions 394 and 2640 of the Columbia ecotype (SAMAC et al. 1990 Down). Nucleotide diversity ({pi}, NEI and LI 1979 Down; TAJIMA and NEI 1984 Down), 4Nµ ({theta}, WATTERSON 1975 Down), the number of recombination events (Rm, HUDSON and KAPLAN 1985 Down), and 4Nc (C, HUDSON 1987 Down) were estimated by using DnaSP program version 2.5 (ROZAS and ROZAS 1997 Down). The phylogenetic tree was constructed by the neighbor-joining (NJ) method (SAITOU and NEI 1987 Down) based on the genetic distances for the entire region calculated by the JUKES and CANTOR 1969 Down method (PHYLIP v. 3.572; FELSENSTEIN 1996 Down). Nucleotide sequences of the Adh and ChiA regions were obtained from MIYASHITA et al. 1996 Down, MIYASHITA et al. 1998 Down, INNAN et al. 1996 Down, and KAWABE et al. 1997 Down. Between all non-singleton variants in the three regions, linkage disequilibrium was analyzed by the DnaSP program (ROZAS and ROZAS 1997 Down) and tested by Fisher's exact test.


*  RESULTS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

DNA polymorphism in the ChiB region of A. thaliana:
There were 109 variants (83 nucleotide substitutions and 26 length variants) in the entire ChiB region (Figure 1). Of these, 22 nucleotide substitutions and 5 length variants were singletons. Length variation was observed only in noncoding regions. Five repeat number variants [poly(A) at site 500–506, poly(T) at 1335–1338, poly(A) at 1391–1396, poly(T) at 2598–2603, and poly(AT) at 1306–1333] were excluded from the following analyses.



View larger version (45K):
In this window
In a new window
Download PPT slide
 
Figure 1. Summary of DNA variations detected in the ChiB region of A. thaliana. Vertical bars indicate nucleotide variations, of which replacement changes are shown with solid circles. Open triangles mean indels. Non-singleton changes are summarized at the bottom, where dot indicates nucleotide identical to consensus, + indicates presence of indel, and minus indicates absence. Sequences of indels, indicated by lowercase letters, are a, TTA; b, AA; c, ACTGT; d, CTGGATACTAC; e, TCTTGATTAATCTAAACGCAAAT; f, TTAA; g, AATATAATAC; h, AT; i, ATATT; and j, GATTC.

In the coding region, 21 nucleotide polymorphisms were observed, including four replacement substitutions. The proportion of replacement nucleotide sites (19.1%) was lower than those in the ChiA (43.2%) and Adh (31.6%) regions. The high proportion of replacement sites in ChiA could be specific to the locus. Only one replacement site variant, a non-singleton, was observed in ChiB; it caused a nonconservative amino acid change, between negatively charged Asp and positively charged Lys (MIYATA et al. 1979 Down). However, the site was located at amino acid position 17, which is included in the N-terminal region of 30 amino acids that is cut off from mature protein (SAMAC et al. 1990 Down). Therefore, this nonconservative polymorphic site is not related to chitinase function. The other three amino acid changes, all singletons, were conservative.

Nucleotide diversity ({pi}) of the ChiB region was estimated (Table 1). Nucleotide diversity of the entire region was 0.0091. This value was almost the same as those of the ChiA (0.0104), Adh (0.0080), and Cal (0.0070) regions. Table 1 also summarizes the results of TAJIMA's (1989) and FU and LI's (1993) tests. The D test statistics were negative in most regions, while D* was positive in some regions. None of the tests gave a significant result, except for Fu and Li's test on the 3' flanking region. The ChiB region had an excess of doublet sites (Figure 2), which contrasted with the other three loci. This excess of doublet polymorphisms caused contrary results for Tajima's and Fu and Li's tests. The significantly positive D* value under Fu and Li's test for the 3' flanking region reflected that only 1 of 21 polymorphic sites in the region was a singleton polymorphism. In the ChiA region, the two test statistics were significantly negative, because of excess singletons (KAWABE et al. 1997 Down). These chitinase loci also differed in the proportion of singleton nucleotide sites.



View larger version (36K):
In this window
In a new window
Download PPT slide
 
Figure 2. Frequency spectrum of polymorphic nucleotide sites in the ChiB region. The expected value was obtained according to TAJIMA 1989 Down.


 
View this table:
In this window
In a new window

 
Table 1. Summary of polymorphism in the ChiB region of A. thaliana

Intragenic recombination in the ChiB region of A. thaliana:
As in the Adh, ChiA, and Cal regions, non-singleton polymorphisms found throughout the ChiB region were dimorphic (Figure 1), confirming previous results that dimorphism was a characteristic of DNA variation in the A. thaliana nuclear genome. It was certain that intragenic recombination had occurred in the ChiB region, especially in exon 2. Two ecotypes, Ci-0 and Pog-0, which have 39 distinct variants, were diverged from other ecotypes. But these two ecotypes are not obvious parental types of any evidently recombinant ecotypes. Complicated partitioning in the ChiB region and the absence of an informative outgroup sequence made it impossible to use the methods previously used for detecting the number and times of recombination events (INNAN et al. 1996 Down; KAWABE et al. 1997 Down). Instead, we estimated the minimum number of recombination events (Rm, HUDSON and KAPLAN 1985 Down) and 4Nc (C, HUDSON 1987 Down) to describe intragenic recombination in the ChiB region, together with the Adh and ChiA regions (Table 2). The values per site for ChiB were intermediate between those of the two regions. These two chitinase loci again differed in the rate of recombination. The estimated C values for each of the three regions were always smaller than estimates of {theta}, indicating that recombination has occurred less frequently than nucleotide mutation. Although estimates of 4Nµ ({theta}) were relatively constant over the three regions, those of C varied widely. This result meant that recombination rate in A. thaliana was not constant, but strongly depended on region.


 
View this table:
In this window
In a new window

 
Table 2. Summary of estimated recombination at the three regions

Genealogical relationship of ecotypes based on nucleotide variations in the ChiB region:
An estimate of genealogical relationships among ecotypes was obtained by the NJ method, based on nucleotide variation in the entire ChiB region (Figure 3). Because there have been some recombination events, this NJ tree may not be greatly informative. However, there were clearly three distinct clusters. The first cluster included 13 ecotypes, the second cluster included Mt-0 and Kn-0, and the third cluster consisted of Ci-0 and Pog-0. Nucleotide diversities within clusters II and III were low (0.0005 and 0.0009, respectively), while that of cluster I was 0.0075, which was similar to the overall estimate. This result suggested that sequences in cluster I were relatively older than those in clusters II and III. Average nucleotide distances between clusters were 0.0147, 0.0221, and 0.0223 for I and II, I and III, and II and III, respectively. For the Adh and ChiA regions, average nucleotide distances between the two most divergent sequence types were 0.0127 and 0.0148, respectively. Thus, the ChiB region contained more divergent sequences than the other two regions.



View larger version (20K):
In this window
In a new window
Download PPT slide
 
Figure 3. Neighbor-joining tree of ecotypes based on the nucleotide variation in the ChiB region. Bootstrap probabilities >50% are shown above branches.

As in the Adh and ChiA regions, no association between phylogenetic clustering and sample locations was observed (Figure 3). In particular, the two ecotypes in each of clusters II and III, which had low nucleotide diversity, came from different continents. These results support the hypothesis that the A. thaliana population has spread over the world recently (KING et al. 1993 Down; PRICE et al. 1994 Down; INNAN et al. 1996 Down, INNAN et al. 1997 Down).

Interspecific variation between A. thaliana and A. gemmifera in the ChiB coding region:
A McDonald-Kreitman test (MCDONALD and KREITMAN 1991 Down) was conducted to examine the ratio of polymorphic replacement and silent sites in A. thaliana relative to divergence between A. thaliana and A. gemmifera (Table 3). Because only one sequence was determined in A. gemmifera, the divergence could include both fixed sites between A. thaliana and A. gemmifera and some polymorphic sites within A. gemmifera. None of the comparisons gave significant results, although the ratio of replacement to silent changes for the interspecific comparison was higher than that for the intraspecific comparison. This result indicated that ratio of replacement to synonymous substitutions was constant in intra- and interspecific variations.


 
View this table:
In this window
In a new window

 
Table 3. Result of McDonald-Kreitman test for the ChiB locus

To examine the difference in levels of nucleotide variation between polymorphism and divergence among the Adh, ChiA, and ChiB regions, a Hudson, Kreitman, Aguadé test (HUDSON et al. 1987 Down) was conducted, comparing the number of polymorphic sites in coding regions and using A. gemmifera as a reference species (Table 4). None of the comparisons were significant, indicating that the level of polymorphism was consistent with divergence among the three regions.


 
View this table:
In this window
In a new window

 
Table 4. Summary of the results of Hudson, Kreitman, Aguadé test for the ChiB region

Linkage disequilibrium within and between loci:
Because most of the ecotypes studied for the ChiB region were also used for analyses of the Adh and ChiA regions (INNAN et al. 1996 Down; KAWABE et al. 1997 Down), it was possible to analyze intra- and interlocus linkage disequilibrium between polymorphic DNA variants in the three regions (Figure 4). Since all three regions showed dimorphism, significant linkage disequilibria were observed within each region. The proportions of linkage disequilibria that were significant at least at the 5% level were 368 of 1035 tests (36%), 173 of 351 (49%), and 1651 of 3403 (49%) for Adh, ChiA, and ChiB, respectively. Sign tests (LEWONTIN 1995 Down) were applied to test the overall degree of linkage disequilibrium (Table 5). In each region, an excess of coupling (positive) linkage disequilibrium was detected. Between the Adh and either of the two chitinase regions, almost no pairs of sites showed linkage disequilibrium significant at the 5% level [12 of 5060 tests (0.2%)]. On the other hand, between the two chitinase regions, 428 of 2241 tests (19%) were significant at the 5% level. The significant interlocus linkage disequilibria were caused by two divergent ecotypes Ci-0 and Pog-0, which had unique polymorphisms in the two regions. In the ChiB region, 27 nucleotide substitutions and 12 indels were uniquely found in Ci-0 and Pog-0. Almost all of these variants were located in noncoding regions, with the exception of two synonymous substitutions in exon 1. It should be mentioned that because of the enormous number of comparisons, none of the tests were significant when the Bonferroni correction was applied.




View larger version (81K):
In this window
In a new window
Download PPT slide
 
Figure 4. Intra- and interlocus linkage disequilibrium between polymorphic DNA variations in the Adh, ChiA, and ChiB regions. Polymorphic variations in each region are arranged from 5' to 3'. Statistical significance based on Fisher's exact test is shown.


 
View this table:
In this window
In a new window

 
Table 5. The sign test applied to Adh, ChiA, and ChiB regions of A. thaliana


*  DISCUSSION
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Patterns of DNA variation among the Adh, ChiA, and ChiB regions:
One of the main purposes of this study was to distinguish whether or not the polymorphic patterns in the ChiA region, i.e., excess of rare alleles and higher replacement polymorphism, were related to the function of chitinase protein. None of the ChiA-specific polymorphic patterns were observed in the ChiB region, except for asymmetric partitioning of dimorphism. In both regions, dimorphism was maintained at low frequencies. These results suggested that the patterns of polymorphism in the ChiA region were not related to chitinase function, but might be specific to the locus. Therefore, another approach is necessary to determine the causes of higher replacement polymorphism or high proportion of rarer alleles in the ChiA region.

In Drosophila melanogaster, recombination rate is related to level of intraspecific DNA variations (AGUADE et al. 1991 Down; BEGUN and AQUADRO 1992 Down) as a result of hitchhiking and/or background selection (MAYNARD SMITH and HAIGH 1974 Down; CHARLESWORTH et al. 1993 Down). A. thaliana is a self-pollinated plant and its outcrossing rate was estimated to be only ~0.3% (ABBOTT and GOMES 1989 Down). In such highly selfing species, the whole genome may act as a linked locus and the effects of hitchhiking or background selection may be similar for all loci (CHARLESWORTH et al. 1993 Down). Estimated recombination rates were higher in the Adh and ChiB regions than in the ChiA region (Table 2). The reason why the recombination rate in the ChiA region was reduced could not be clarified in this study. However, the rates of synonymous substitution were also related to estimated recombination rates (C) of the three regions in A. thaliana (d.f. = 1, r = 0.99996, P < 0.01), as shown in D. melanogaster (MORIYAMA and POWELL 1996 Down). This relationship indicates that recombination may play an important role in determining levels of intraspecific variation in A. thaliana.

In the three regions, C/{theta}, which reduced to c/µ, ranged from 0.0001 to 0.2197 and the average was 0.0823. In D. melanogaster, this ratio was estimated as 1.6 in the Adh region (HUDSON 1987 Down). If the mutation rate has been similar between D. melanogaster and A. thaliana, the lower value of C/{theta} in A. thaliana suggests less recombination in this plant species and is consistent with the difference in breeding system of these organisms.

Interchromosomal linkage disequilibrium between the two chitinase regions:
Although statistical significance was not confirmed for linkage disequilibrium, it is clear that the two ecotypes have a divergent sequence type in the two chitinase loci. To explain this pattern in the chitinase loci, which lie on different chromosomes, two hypotheses could be considered. First, the pattern may represent a consequence of random assortment of the chromosomes, where the two loci are located, after formation of a heterozygote between two divergent sequence types. Although this plant species is highly selfing, previous studies of nucleotide variation in the Adh and ChiA loci (INNAN et al. 1996 Down; KAWABE et al. 1997 Down) showed that recombination events had occurred. Because recombination events can be detected only in the presence of heterozygous individuals, some outcrossing must have occurred in the evolutionary history of A. thaliana. Once this combination is formed in the two chitinase loci, it will be maintained by selfing at the species level. The second explanation for the pattern in the chitinase loci could be epistatic interaction between the genes. Since ChiA and ChiB are functionally related, this hypothesis is attractive. At this moment, we do not have any supporting evidence. To distinguish the possibilities, it may be necessary to study DNA variation in surrounding regions of the chitinase loci and compare chitinase activity between ecotypes.


*  ACKNOWLEDGMENTS

We are grateful to N. Goto, Sendai Arabidopsis Stock Center, Miyagi University of Education, for A. thaliana seeds and to F. Tajima, M. Uyenoyama, and E. Stahl for comments and improving the manuscript. This article is contribution number 556 from the Laboratory of Plant Genetics, Graduate School of Agriculture, Kyoto University.

Manuscript received November 3, 1998; Accepted for publication July 27, 1999.


*  LITERATURE CITED
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

ABBOTT, R. J. and M. F. GOMES, 1989  Population genetic structure and outcrossing rate of Arabidopsis thaliana (L.) Heynh. Heredity 62:411-418.

AGUADÉ, M., N. T. MIYASHITA, and C. H. LANGLEY, 1991  Reduced variation in the yellow-achaete-acute region in natural populations of Drosophila melanogaster.. Genetics 122:607-616[Abstract/Free Full Text].

BEGUN, D. J. and C. E. AQUADRO, 1992  Levels of naturally occurring DNA polymorphism correlate with recombination rates in D. melanogaster.. Nature 356:519-520[Medline].

BEINTEMA, J. J., and A. C. TERWISSCHA VAN SCHELTINGA, 1996 Plant lysozyme, pp. 75–86 in Lysozyme: Model Enzymes in Biochemistry and Biology, edited by P. JOLLES. Birkhauser Verlag, Basel.

BELL, C. J. and J. R. ECKER, 1994  Assignment of 30 microsatellite loci to the linkage map of Arabidopsis.. Genomics 19:137-144[Medline].

CHARLESWORTH, B., M. T. MORGAN, and D. CHARLESWORTH, 1993  The effect of deleterious mutations on neutral molecular variation. Genetics 134:1289-1303[Abstract].

COLLINGE, D. B., K. M. KRAGH, J. D. MIKKELSEN, K. K. NIELSEN, and U. RASMUSSEN et al., 1993  Plant chitinases. Plant J. 3:31-40[Medline].

FELSENSTEIN, J., 1996 PHYLIP (Phylogeny inference package), ver. 3.572. University of Washington Press, Seattle.

FU, Y. X. and W. H. LI, 1993  Statistical tests of neutrality of mutation. Genetics 133:693-709[Abstract].

HAMEL, F., R. BOLVIN, C. TREMBLAY, and G. BELLEMERE, 1997  Structural and evolutionary relationships among chitinases of flowering plants. J. Mol. Evol. 44:614-624[Medline].

HANFSTINGL, U., A. BERRY, E. A. KELLOG, J. T. COSTA, III, and W. RUDIGER et al., 1994  Haplotype divergence coupled with lack of diversity at the Arabidopsis thaliana alcohol dehydrogenase locus: role for both balancing and directional selection? Genetics 138:811-828[Abstract].

HENRISSAT, B., 1990  Weak sequence homologies among chitinases detected by clustering analysis. Protein Sequences Data Anal. 3:523-526[Medline].

HUDSON, R. R., 1987  Estimating the recombination parameter of finite population model without selection. Genet. Res. 50:245-250[Medline].

HUDSON, R. R. and N. L. KAPLAN, 1985  Statistical properties of the number of recombination events in the history of a sample of DNA sequence. Genetics 111:147-164[Abstract/Free Full Text].

HUDSON, R. R., M. KREITMAN, and M. AGUADÉ, 1987  A test of neutral molecular evolution based on nucleotide data. Genetics 116:153-159[Abstract/Free Full Text].

INNAN, H., F. TAJIMA, R. TERAUCHI, and N. T. MIYASHITA, 1996  Intragenic recombination in the Adh locus of the wild plant Arabidopsis thaliana.. Genetics 143:1761-1770[Abstract].

INNAN, H., R. TERAUCHI, and N. T. MIYASHITA, 1997  Microsatellite polymorphism in natural population of the wild plant Arabidopsis thaliana.. Genetics 146:1441-1452[Abstract].

JEKEL, P. A., J. B. H. HARTMANN, and J. J. BEINTEMA, 1991  The primary structure of hevamine, an enzyme with lysozyme/chitinase activity from Heves brasiliensis latex. Eur. J. Biochem. 200:123-138[Medline].

JUKES, T. H., and C. R. CANTOR, 1969 Evolution of protein molecules, pp. 21–132 in Mammalian Protein Metabolism, edited by H. MUNRO. Academic Press, New York.

KAWABE, A., H. INNAN, R. TERAUCHI, and N. T. MIYASHITA, 1997  Nucleotide polymorphism in the acidic chitinase locus (ChiA) region of the wild plant Arabidopsis thaliana.. Mol. Biol. Evol. 14:1303-1315[Abstract].

KING, G., J. NIENHUIS, and C. HUSSEY, 1993  Genetic similarity among ecotypes of Arabidopsis thaliana estimated by analysis of restriction fragment length polymorphisms. Theor. Appl. Genet. 86:1028-1032.

LEWONTIN, R. C., 1995  The detection of linkage disequilibrium in molecular sequence data. Genetics 140:377-388[Abstract].

MAUCH, F. and L. A. STAEHELIN, 1989  Functional implications of the subcellular localization of ethylene-induced chitinase and ß-1,3-glucanase in bean leaves. Plant Cell 1:447-457[Abstract/Free Full Text].

MAYNARD SMITH, J. and J. HAIGH, 1974  The hitchhiking effect of a favorable gene. Genet. Res. 23:23-55[Medline].

MCDONALD, J. H. and M. KREITMAN, 1991  Adaptive protein evolution at the Adh locus in Drosophila.. Nature 351:652-654[Medline].

MEINS, F., JR., J. M. NEUHAUS, C. SPERISEN and J. RYALS, 1992 The primary structure of plant pathogenesis-related glucanohydrolases and their genes, pp. 245–282 in Genes Involved in Plant Defense, edited by T. BOLLER and F. MEINS, JR. Springer Verlag, New York.

METRAUX, J. P., W. BURKHART, M. MOYER, S. DINCHER, and W. MIDDLESTEADT et al., 1989  Isolation of a complementary DNA encoding a chitinase with structural homology to a bifunctional lysozyme/chitinase. Proc. Natl. Acad. Sci. USA 86:896-900[Abstract/Free Full Text].

MIYASHITA, N. T., H. INNAN, and R. TERAUCHI, 1996  Intra- and interspecific variation in the alcohol dehydrogenase locus region of wild plants Arabis gemmifera and Arabidopsis thaliana.. Mol. Biol. Evol. 13:433-436[Medline].

MIYASHITA, N. T., A. KAWABE, H. INNAN, and R. TERAUCHI, 1998  Intra- and interspecific DNA variation and codon bias of alcohol dehydrogenase (Adh) locus in Arabis and Arabidopsis species. Mol. Biol. Evol. 15:1420-1429[Free Full Text].

MIYATA, T., S. MIYAZAWA, and T. YASUNAGA, 1979  Two types of amino acid substitutions in protein evolution. J. Mol. Evol. 12:219-236[Medline].

MORIYAMA, E. N. and J. R. POWELL, 1996  Intraspecific nuclear DNA variation in Drosophila.. Mol. Biol. Evol. 13:261-277[Abstract].

NEI, M. and W.-S. LI, 1979  Mathematical model for studying genetic variation in terms of restriction endonuclease. Proc. Natl. Acad. Sci. USA 76:5269-5273[Abstract/Free Full Text].

OHASHI, Y. and M. OHSHIRO, 1992  Stress-induced expression of genes for pathogenesis-related protein in plants. Plant Cell Physiol. 33:819-826[Abstract/Free Full Text].

PRICE, R. A., J. D. PALMER and I. A. AL-SHEHBAZ, 1994 Systematic relationships of Arabidopsis: a molecular and morphological perspective, pp. 7–20 in Arabidopsis, edited by E. M. MEYEROWITZ and C. R. SOMERVILLE. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

PURUGGANAN, M. D. and J. I. SUDDITH, 1998  Molecular population genetics of the Arabidopsis CAULIFLOWER regulatory gene: nonneutral evolution and naturally occurring variation in floral homeotic function. Proc. Natl. Acad. Sci. USA 95:8130-8134[Abstract/Free Full Text].

ROZAS, J. and R. ROZAS, 1997  DnaSP version 2.0: a novel software package for extensive molecular population genetics analysis. Comp. Appl. Biosci. 13:307-311.

SAMAC, D. A. and D. M. SHAH, 1991  Developmental and pathogen induced activation of the Arabidopsis acidic chitinase protein. Plant Cell 3:1063-1072[Abstract/Free Full Text].

SAMAC, D. A. and D. M. SHAH, 1994  Effect of chitinase antisense RNA expression on disease susceptibility of Arabidopsis plants. Plant Mol. Biol. 25:587-596[Medline].

SAMAC, D. A., C. M. HIROCHIKA, P. E. YALLALY, and D. M. SHAH, 1990  Isolation and characterization of the genes encoding basic and acidic chitinase in Arabidopsis thaliana.. Plant Physiol. 93:907-914[Abstract/Free Full Text].

SAITOU, N. and M. NEI, 1987  The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4:406-425[Abstract].

SANGER, F., S. NICKLEN, and A. R. COULSON, 1977  DNA sequencing with chain terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463-5467[Abstract/Free Full Text].

SATO, S., T. KANEKO, H. KOTANI, Y. NAKAMURA, and E. ASAMIZU et al., 1998  Structural analysis of Arabidopsis thaliana chromosome 5. IV. Sequence features of the regions of 1,456,315 bp covered by nineteen physically assigned P1 and TAC clones. DNA Res. 5:41-54[Abstract].

SHINSHI, H., J. M. NEUHAUS, J. RYALS, and F. MEINS, JR., 1990  Structure of tobacco endochitinase gene: evidence that different chitinase genes can arise by transposition of sequence encoding cysteine-rich domain. Plant Mol. Biol. 14:357-368[Medline].

TAJIMA, F., 1989  Statistical test for testing the neutral mutation hypothesis by DNA polymorphism. Genetics 123:585-595[Abstract/Free Full Text].

TAJIMA, F. and M. NEI, 1984  Estimation of evolutionary distance between nucleotide sequences. Mol. Biol. Evol. 1:269-285[Abstract].

TERAUCHI, R., T. TERACHI, and N. T. MIYASHITA, 1997  DNA polymorphism at the Pgi locus of a wild yam, Dioscorea tokoro.. Genetics 147:1899-1914[Abstract].

WATANABE, T., W. OYANAGI, K. SUZUKI, K. OHNISHI, and H. TANAKA, 1992  Structure of the gene encoding chitinase D of Bacillus circulans WL-12 and possible homology of the enzyme to other prokaryotic chitinases and class III plant chitinases. J. Bacteriol. 174:408-414[Abstract/Free Full Text].

WATTERSON, G. A., 1975  On the number of segregating sites in genetical models without recombination. Theor. Popul. Biol. 7:256-276[Medline].

WEISING, K., D. KAEMMER, F. WEIGAND, J. T. EPPLEN, and G. KAHL, 1991  Oligonucleotide fingerprinting reveals various probe-dependent levels of informativeness in chickpea (Cicer arietinum). Genome 35:436-442.




This article has been cited by other articles:


Home page
Mol Biol EvolHome page
D. A. Moeller and P. Tiffin
Genetic Diversity and the Evolutionary History of Plant Immunity Genes in Two Species of Zea
Mol. Biol. Evol., December 1, 2005; 22(12): 2480 - 2490.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
P. K. Ingvarsson
Molecular Population Genetics of Herbivore-induced Protease Inhibitor Genes in European Aspen (Populus tremula L., Salicaceae)
Mol. Biol. Evol., September 1, 2005; 22(9): 1802 - 1812.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
J. M. Cork and M. D. Purugganan
High-Diversity Genes in the Arabidopsis Genome
Genetics, August 1, 2005; 170(4): 1897 - 1911.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
K. J. Schmid, S. Ramos-Onsins, H. Ringys-Beckstein, B. Weisshaar, and T. Mitchell-Olds
A Multilocus Sequence Survey in Arabidopsis thaliana Reveals a Genome-Wide Departure From a Neutral Model of DNA Sequence Polymorphism
Genetics, March 1, 2005; 169(3): 1601 - 1615.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
P. Tiffin, R. Hacker, and B. S. Gaut
Population Genetic Evidence for Rapid Changes in Intraspecific Diversity and Allelic Cycling of a Specialist Defense Gene in Zea
Genetics, September 1, 2004; 168(1): 425 - 434.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
P. Tiffin
Comparative Evolutionary Histories of Chitinase Genes in the Genus Zea and Family Poaceae
Genetics, July 1, 2004; 167(3): 1331 - 1340.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
G. Stacey, L. Vodkin, W. A. Parrott, and R. C. Shoemaker
National Science Foundation-Sponsored Workshop Report. Draft Plan for Soybean Genomics
Plant Physiology, May 1, 2004; 135(1): 59 - 70.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
M. J. Clauss and T. Mitchell-Olds
Functional Divergence in Tandemly Duplicated Arabidopsis thaliana Trypsin Inhibitor Genes
Genetics, March 1, 2004; 166(3): 1419 - 1436.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
L. E. Rose, P. D. Bittner-Eddy, C. H. Langley, E. B. Holub, R. W. Michelmore, and J. L. Beynon
The Maintenance of Extreme Amino Acid Diversity at the Disease Resistance Gene, RPP13, in Arabidopsis thaliana
Genetics, March 1, 2004; 166(3): 1517 - 1527.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. Kroymann, S. Donnerhacke, D. Schnabelrauch, and T. Mitchell-Olds
Evolutionary dynamics of an Arabidopsis insect resistance quantitative trait locus
PNAS, November 25, 2003; 100(suppl_2): 14587 - 14592.
[Abstract] [Full Text]


Home page
GeneticsHome page
E. Baudry and F. Depaulis
Effect of Misoriented Sites on Neutrality Tests With Outgroup
Genetics, November 1, 2003; 165(3): 1619 - 1622.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
T. Kado, H. Yoshimaru, Y. Tsumura, and H. Tachida
DNA Variation in a Conifer, Cryptomeria japonica (Cupressaceae sensu lato)
Genetics, August 1, 2003; 164(4): 1547 - 1559.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
A. Kawabe and N. T. Miyashita
DNA Polymorphism in Active Gene and Pseudogene of the Cytosolic Phosphoglucose Isomerase (PgiC) Loci in Arabidopsis halleri ssp. gemmifera
Mol. Biol. Evol., July 1, 2003; 20(7): 1043 - 1050.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
K. A. Shepard and M. D. Purugganan
Molecular Population Genetics of the Arabidopsis CLAVATA2 Region: The Genomic Scale of Variation and Selection in a Selfing Species
Genetics, March 1, 2003; 163(3): 1083 - 1095.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
Y. L. Zhu, Q. J. Song, D. L. Hyten, C. P. Van Tassell, L. K. Matukumalli, D. R. Grimm, S. M. Hyatt, E. W. Fickus, N. D. Young, and P. B. Cregan
Single-Nucleotide Polymorphisms in Soybean
Genetics, March 1, 2003; 163(3): 1123 - 1134.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
R. Mauricio, E. A. Stahl, T. Korves, D. Tian, M. Kreitman, and J. Bergelson
Natural Selection for Polymorphism in the Disease Resistance Gene Rps2 of Arabidopsis thaliana
Genetics, February 1, 2003; 163(2): 735 - 746.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
J.-Z. Lin, P. L. Morrell, and M. T. Clegg
The Influence of Linkage and Inbreeding on Patterns of Nucleotide Sequence Diversity at Duplicate Alcohol Dehydrogenase Loci in Wild Barley (Hordeum vulgare ssp. spontaneum)
Genetics, December 1, 2002; 162(4): 2007 - 2015.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Bot.Home page
H. K. Stenoien, C. B. Fenster, H. Kuittinen, and O. Savolainen
Quantifying latitudinal clines to light responses in natural populations of Arabidopsis thaliana (Brassicaceae)
Am. J. Botany, October 1, 2002; 89(10): 1604 - 1608.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
D. Tian, H. Araki, E. Stahl, J. Bergelson, and M. Kreitman
Signature of balancing selection in Arabidopsis
PNAS, August 20, 2002; 99(17): 11525 - 11530.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
V. Le Corre, F. Roux, and X. Reboud
DNA Polymorphism at the FRIGIDA Gene in Arabidopsis thaliana: Extensive Nonsynonymous Variation Is Consistent with Local Selection for Flowering Time
Mol. Biol. Evol., August 1, 2002; 19(8): 1261 - 1271.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
J. Hagenblad and M. Nordborg
Sequence Variation and Haplotype Structure Surrounding the Flowering Time Locus FRI in Arabidopsis thaliana
Genetics, May 1, 2002; 161(1): 289 - 298.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
R. L. Small and J. F. Wendel
Differential Evolutionary Dynamics of Duplicated Paralogous Adh Loci in Allotetraploid Cotton (Gossypium)
Mol. Biol. Evol., May 1, 2002; 19(5): 597 - 607.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
K. M. Olsen, A. Womack, A. R. Garrett, J. I. Suddith, and M. D. Purugganan
Contrasting Evolutionary Forces in the Arabidopsis thaliana Floral Developmental Pathway
Genetics, April 1, 2002; 160(4): 1641 - 1650.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
V. Dvornyk, A. Sirvio, M. Mikkonen, and O. Savolainen
Low Nucleotide Diversity at the pal1 Locus in the Widely Distributed Pinus sylvestris
Mol. Biol. Evol., February 1, 2002; 19(2): 179 - 188.
[Abstract] [Full Text] [PDF]


Home page
Mol Biol EvolHome page
M.-T. Hauser, B. Harr, and C. Schlotterer
Trichome Distribution in Arabidopsis thaliana and its Close Relative Arabidopsis lyrata: Molecular Analysis of the Candidate Gene GLABROUS1
Mol. Biol. Evol., September 1, 2001; 18(9): 1754 - 1763.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
A. Kawabe, K. Yamane, and N. T. Miyashita
DNA Polymorphism at the Cytosolic Phosphoglucose Isomerase (PgiC) Locus of the Wild Plant Arabidopsis thaliana
Genetics, November 1, 2000; 156(3): 1339 - 1347.
[Abstract] [Full Text]


Home page
GeneticsHome page
D. M. Weinreich and D. M. Rand
Contrasting Patterns of Nonneutral Evolution in Proteins Encoded in Nuclear and Mitochondrial Genomes
Genetics, September 1, 2000; 156(1): 385 - 399.
[Abstract] [Full Text]


Home page
GeneticsHome page
H. Kuittinen and M. Aguadé
Nucleotide Variation at the CHALCONE ISOMERASE Locus in Arabidopsis thaliana
Genetics, June 1, 2000; 155(2): 863 - 872.
[Abstract] [Full Text]