- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Andolfatto, P.
- Articles by Kreitman, M.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Andolfatto, P.
- Articles by Kreitman, M.
Unusual Haplotype Structure at the Proximal Breakpoint of In(2L)t in a Natural Population of Drosophila melanogaster
Peter Andolfattoa, Jeffrey D. Wallb, and Martin Kreitmana,ba Committee on Genetics, University of Chicago, Chicago, Illinois 60637
b Department of Ecology and Evolution, University of Chicago, Chicago, Illinois 60637
Corresponding author: Peter Andolfatto, Department of Ecology and Evolution, 1101 E. 57th St., University of Chicago, Chicago, Illinois 60637., pandolfa{at}midway.uchicago.edu (E-mail)
Communicating editor: G. A. CHURCHILL
 | ABSTRACT |
|---|
 TOP ABSTRACT MATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
The existence of temporally stable frequency clines for In(2L)t in natural populations of Drosophila melanogaster suggests a role for selection in the maintenance of this polymorphism. We have collected nucleotide polymorphism data from the proximal breakpoint junction regions of In(2L)t to infer its evolutionary history. The finding of a novel LINE-like element near the In(2L)t breakpoint junction in sampled inverted chromosomes supports a transposable element-mediated origin for this inversion. An analysis of nucleotide variation in a Costa Rican population sample of standard and inverted chromosomes indicates a unique and relatively recent origin for In(2L)t. Additional In(2L)t alleles from three geographically diverse populations reveal no detectable geographic differentiation. Low levels of In(2L)t nucleotide polymorphism suggest a recent increase in the inversion's frequency in tropical populations. An unusual feature of our sample of standard alleles is a marked heterogeneity in levels of linkage disequilibrium among polymorphic sites across the breakpoint region. We introduce a test of neutral equilibrium haplotype structure that corrects both for multiple tests and for an arbitrarily chosen window size. It reveals that an ~1.4-kb region immediately spanning the breakpoint has fewer haplotypes than expected under the neutral model, given the expected level of recombination in this genomic region. Certain features of our data suggest that the unusual pattern in standard chromosomes is the product of selection rather than demography.
INVERSION polymorphisms in the genus Drosophila are widely believed to be among the best examples of balanced polymorphisms. They have been used extensively as model systems for the study of the adaptive processes involved in the maintenance of genetic variation (reviewed in 
Population genetic models suggest that a possible advantage of inversions lies in their ability to suppress recombination in karyotypic heterozygotes and thus maintain favorable epistatic interactions between alleles at linked loci (
In Drosophila, the linkage disequilibrium between selected sites and linked neutral variants predicted by epistatic or balancing selection models decays rapidly in the presence of gene conversion (
An alternative is to investigate the distribution of molecular variation within and between chromosomal arrangements at loci closely linked to the inversion breakpoints (
We have investigated nucleotide variation in a 5-kb region surrounding the proximal breakpoint of In(2L)t. Our a priori prediction is that the long-term maintenance of the inversion by selection will have led to the accumulation of a large number of fixed differences between karyotypic classes.
An unexpected feature of our sample of standard alleles is an unusually strong association among segregating sites close to the breakpoint. The presence of selection and recombination in a region can lead to considerable heterogeneity in levels of linkage disequilibrium (
| MATERIALS AND METHODS |
|---|
| TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
Localizing the 34A breakpoint:
The In(2L)t proximal breakpoint (34A8-9) was first localized by in situ hybridization on polytene chromosomes (modified from
|
Population samples:
Field collections were made from a single, large population of D. melanogaster in San Jose, Costa Rica. This tropical population was chosen because it was likely to have an appreciable frequency of In(2L)t. Wild-caught females were used to start isofemale lines. After several days of egg laying, genomic DNA was prepared from each original wild-caught female and PCR genotyped for In(2L)t. The use of specific primer pairs allowed the recovery of standard or In(2L)t alleles from inversion heterozygotes identified in the above screen. For the sampling of standard alleles, a 5-kb region spanning the proximal breakpoint (C/D in Figure 1) was PCR amplified from In(2L)t heterozygotes (primer C, GCCACGCCCCCATTCACTTAC; primer D, AATGCTTGGTGGCTTTGGAATGGT). These PCR-generated templates were sequenced directly with a set of forward and reverse primers. Similarly, for In(2L)t alleles, the two breakpoint junction regions (A/C and B/D in Figure 1) were amplified separately and sequenced from seven individuals (primer InA412, TTCGATCCACCGACAATCTGAAC; primer InB124, GTACTTTCACTGTTTGCTGACGACGC). Inversion frequencies were also determined by PCR for three other populations (Florida City, FL; Yeppoon, Australia; and Zimbabwe, Africa) for comparison to previously published estimates. Australian and African isofemale lines were kindly provided by C.-I Wu. Primers used for karyotyping individual flies for In(2L)t are as follows: StC545, GACTCATTCTGCTTCGATCACTAAG; StD18, CTGTTCCCACCGCACAGAGTTGCCTGTC; InA151, TATTTTGGTGGCCTGTTTCAG. Expected PCR products are ~500 bp for primer pair StC545/StD18 and ~250 bp for primer pair StC545/InA151.
Polymorphism analyses:
Tests of the neutral equilibrium model that compare polymorphism and divergence (e.g., 
= 4Nu, where N is the effective population size of the species and u is the neutral mutation rate, was estimated from both 
, the average pairwise difference per base pair (
Tree construction, In(2L)t historical frequency, and age:
Bootstrapped parsimony phylograms were constructed using PAUP3.1.1 (
If we assume the former model and that the inversion is at equilibrium, then and f can be estimated from the sample sizes of inverted and standard chromosomes (ni and ns, respectively) and the observed number of segregating sites within the inverted and standard chromosomes (Si and Ss, respectively; 
k-1j=1 j-1. Then, E[Si] = fani and E[Ss] = (1 - f)ans. To estimate and f, the expectations are replaced by their observed values. This yields
 |
(1) |
and
 |
(2) |
It is then straightforward to estimate the time to the most recent common ancestor of the inverted chromosomes by substituting (1) into
 |
(3) |
This yields an estimate of the minimum age of the inversion. An expected age of the inversion is also calculated based on the average net number of differences between arrangements scaled to the expected divergence time between D. melanogaster and D. simulans. It should be noted that these estimates have very large variances.
We investigate by simulation whether levels of In(2L)t variation are compatible with assumed historical inversion frequencies under a neutral equilibrium model. We run 100,000 coalescent simulations with sample size ni and population mutation parameter 
f. Here is estimated from (2), and we determine for which values of f the observation of Si segregating sites is within the middle 95% of the simulated distribution of Si.
Test of neutral equilibrium haplotype structure:
We constructed a test to determine whether any subsets of consecutive segregating sites in our data contain fewer distinct haplotypes than would be expected under a neutral equilibrium model. Suppose we have a data set with n chromosomes and S segregating sites. Define Sk to be the largest number of consecutive segregating sites that contain only k different haplotypes (1 < k < n). An empirical distribution of Sk is determined from 100,000 simulations using an infinite-sites, panmictic coalescent model conditional on n and S (
A concern is the violation of the "infinitely many sites" assumption of our null model. In particular, mutations can sometimes overlap in actual data, especially in the presence of deletions. It is not clear whether "infinite-sites" simulations are conservative when the actual data has overlapping mutations. On one hand, more windows are considered in the simulations than in the actual data, which is conservative. On the other, missing information for those chromosomes with deletions might lead to fewer haplotypes than expected under the infinite-sites assumption. We believe that both effects are rather minor, but a higher degree of caution should be exercised when interpreting the relevant significance levels.
Two different versions of the In(2L)t data are considered. In-dels are likely to be governed by a different mutational process than single nucleotide polymorphisms (hereafter SNPs); however, they are included in simulations that condition on S since nothing is assumed about the underlying mutation rate, (
|
All parameters used in simulations, including n, S, and C are listed in Table 1. In reality, the effective rate of recombination depends on the arrangement class. Our assumptions of panmixia and the same recombination rate for all individuals are unrealistic in this regard. Nevertheless, we consider it to be a reasonable simplifying assumption. In fact, an explicit demographic model of equilibrium-balancing selection based on estimates of the inversion's age and historic frequency yielded more significant P values (results not shown). Since individuals were not sampled randomly, both versions used a random sample based on the observed frequency (20.8%) of In(2L)t chromosomes in the San Jose population. This sample included all 11 standard chromosomes as well as cr40i, cr44i, and cr46i (see Figure 2). Since In(2L)t varies in frequency among geographic locations, and the inferred historical frequency was estimated to be between 4 and 23% (see RESULTS), we also considered representative samples with zero to four inverted alleles.
|
Recombination:
The implications of recombination on the predictions of population genetic models are poorly understood. Perhaps as a result, investigators often conduct statistical tests with the assumption of no recombination. However, since there is evidence for recombination in our (and other) data, it is more realistic to assume C > 0 in simulations. In addition, ignoring the effect of recombination does not always lead to a conservative test (
The use of estimators of the population recombination rate, C = 4Nr, on the basis of nucleotide polymorphism data (e.g., 
, where is the per base pair, per generation rate of recombination obtained from laboratory measurements of the exchange of flanking markers (cf. /4µ, where is estimated from the average nucleotide diversity at silent sites and noncoding DNA of loci in regions of intermediate recombination (
The presence of an inversion in our sample makes the parameter C difficult to interpret. We expect that reduced exchange in inversion heterozygotes (i.e., genetic isolation) will affect the overall levels of exchange. When calculating Clab for use in simulations, we account for lack of recombination in D. melanogaster males and assume an absence of recombination in inversion heterozygotes. Thus, Clab = (1 - 2q(1 - q)) 2N, where q is the assumed inversion frequency. Note that the maximum effect of an inversion on the recombination rate among standard chromosomes is a factor of two (assuming an inversion at 50% frequency and no recombination in inversion heterozygotes).
Analysis of other data sets:
To demonstrate the effect that an arbitrarily chosen window size can have on the likelihood of a data set, we assess the significance of nonneutral haplotype structure reported in additional studies of D. melanogaster populations: the white locus data of for each locus (
| RESULTS |
|---|
| TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
Polymorphism summary:
Figure 2 summarizes 176 polymorphic sites found in the sampled 5-kb of region C/D (see Figure 1). The data set contains 131 biallelic single nucleotide polymorphisms (SNPs). In addition, there are 27 biallelic insertion-deletion polymorphisms, denoted by i, d, or M. Complex polymorphisms are denoted by M; they are either multiple insertions (or deletions) that are very close to each other, or one or more nucleotide mutations associated with an insertion or deletion. The spatial distribution of insertion-deletion variation does not appear to be different from that for SNPs and does not significantly affect Tajima's D statistic (results not shown). The In(2L)t breakpoint occurs between positions 2826 and 2919, where all sampled inverted chromosomes (n = 18) contain a 94-bp deletion.
Inversion frequencies and uniqueness of origin:
Estimates of In(2L)t frequencies assessed by PCR assay in Yeppoon and Florida City samples were 22.9% (n = 43) nd 25.0% (n = 100), respectively. These estimates are similar to those based on the cytology of geographically proximate populations (
Recombination within and between chromosomal arrangements:
For the chromosomal band 34A8-9, the laboratory estimate of the crossover rate is 2.9 x 10-8 per site per generation in females (
Despite the large number of informative polymorphisms, there is almost no evidence for genetic exchange between arrangements in our data. A possible exception is site 174 (Figure 2), which may be a multiple hit. This observation is consistent with the finding of suppressed exchange between standard and inverted classes at the breakpoint of the inversion (
|
History of In(2L)t:
A bootstrapped parsimony phylogram for 2.3 kb of sequence (positions 1491 to 3822) immediately spanning the inversion breakpoint is shown in Figure 3. All mutations in this segment are consistent with a single genealogical tree (i.e., there are no inferred recombination events in the segment). From the tree, we can infer that the inversion is relatively recently derived from one of two distinct haplotype classes of standard chromosomes. Trees based on three other recombination-free segments (positions 189–492, 639–1020, and 3946–4354) all produce similar topologies: In(2L)t alleles form a distinct cluster that is closely related to one or more standard haplotypes.
|
In total, 12 biallelic segregating polymorphisms were found in the 7 sampled In(2L)t alleles. Of these, 9 are SNPs (see Figure 2). Estimates of and for the In(2L)t alleles are 11 and 7%, respectively, of those for standard alleles (Table 1). Assuming the population is at equilibrium, this level of diversity is consistent with a low (i.e., ~10%) average historical frequency.
In(2L)t appears to be recently derived relative to standard lineages and the D. melanogaster-D. simulans divergence time. We estimate the E[TMRCA] of our sample of In(2L)t alleles to be ~0.3 Ne generations. This roughly corresponds to ~100,000 years, assuming an Ne ~3 x 106 (
A second estimate of the age can be obtained from the number of fixed differences between In(2L)t and standard lineages: the number (9) is small compared to the average pairwise divergence between standard chromosomes (48.5). This again suggests that In(2L)t is recently derived relative to standard lineages. We estimate the expected age of the inversion (~160,000 years) to be ~4% of the net divergence time for D. melanogaster and D. simulans.
In(2L)t nucleotide diversity and frequencies in natural populations:
Several features of the data suggest that In(2L)t is not at equilibrium. First, Tajima's D for the inverted class is negative (though the frequency spectrum is not significantly skewed). This finding is interesting given that Tajima's D is significantly positive for the random sample. Second, In(2L)t chromosomes show no segregating variation in a region of elevated (positions 2637 to 3020, Figure 2). These observations suggest a recent origin and rapid increase in the inversion's frequency.
Evidence that In(2L)t has recently increased in frequency can be inferred from the geographic distribution of In(2L)t variation and the relative levels of diversity for standard and inverted chromosomes. We sequenced an ~0.8-kb region spanning the C/A breakpoint junction of 11 additional In(2L)t chromosomes (positions 2001 to 2819, Figure 2). Table 3 summarizes polymorphic variation found in this subregion for 18 In(2L)t alleles from four geographically diverse populations. Permutation tests (
|
Heterogeneity in nucleotide polymorphism:
Sliding-window profiles of nucleotide diversity (Figure 4) reveal considerable heterogeneity in levels of polymorphism across region C/D. For example, the large mutation-free stretch centered at ~1600 in Figure 4B (found between positions 1491 and 2019 in Figure 2) is highly unusual (P < 0.004 for all C) assuming a uniform mutation rate. Nonuniformity of mutations could arise from heterogeneity in selective constraint across the region. A comparatively large peak of intraspecific polymorphism is observed at the inversion breakpoint (approximately position 2600 in Figure 4A). Interestingly, most of this variation is distributed between two major haplotypic classes and not within them (Figure 4B), reflecting the strong linkage disequilibrium observed between sites close to the breakpoint (see Figure 2). The average pairwise divergence between haplotypic classes is ~10% at its highest point. This pattern is reminiscent of that observed between Fast and Slow allozyme classes at the Adh locus (
|
There seem to be fewer haplotypes at the breakpoint than expected under a neutral equilibrium model (given the sample size, the number of mutations, and the expected recombination rate). Unfortunately, Figure 4A and Figure 4B are tricky to interpret: for one, the division of standard chromosomes into two "haplotypic classes," as done in Figure 4B, is post hoc. In addition, the chosen window size is arbitrary. Given evidence for heterogeneity in constraint in the region, Figure 4 could be misleading since each window may not contain an equivalent number of "neutral" polymorphisms. In general, it is unclear how to test whether an arbitrarily defined window is unusual after having examined the data. To address this difficulty, the test described below corrects for a post hoc choice of window size.
Test of neutral equilibrium haplotype structure:
While there is evidence for recombination in our data (i.e., 10 minimum inferred recombination events), there are also strong associations among sites over a considerable distance spanning the In(2L)t breakpoint (see positions 1491–4109 in Figure 2). Although this observation seems unlikely under the null model, closely linked sites do have correlated histories in neutral genealogies with intermediate recombination (
|
Final P values that correct for a post hoc choice of window size are shown in Table 4. Each of these values reflect median P values for all possible random samples with three In(2L)t alleles (reflecting the sampled In(2L)t frequency of 20.8%). Since In(2L)t nucleotide diversity levels are consistent with frequencies of between ~4 and 23%, we conducted additional tests on random samples corresponding to In(2L)t frequencies of between 0 and 27%. Most of the tests on Version I of the data were not significant when C = Ccon. Version II of the data, which includes polymorphisms that overlap with the 94-bp deletion of In(2L)t alleles, is significant when C = Ccon for samples that included between zero and three In(2L)t alleles.
Figure 5 shows P vs. C for Version I of the data. Note that C = 0 is not conservative and that P decreases (almost) monotonically for C > Ccon. The pattern in Figure 5 (an initial increase in P for low values of C followed by a steady decrease as C increases) is a general feature of our test (results not shown). When running simulations with our a priori estimate of the recombination rate (Clab, corrected for the inversion's effect), all tests were highly significant (P < 0.001) for both versions of the data, including samples with zero to four In(2L)t alleles.
|
Multiple tests, recombination, and haplotype structure at other loci:
Correcting for multiple tests and an arbitrary window size can have an impact on the significance of the data. For example, the most unusual subset of the Acp70A data (
|
The assumed rate of recombination also has a large effect on our interpretation of the data (Table 5). For example, under conservative recombination the white locus (
0.004). Interestingly, significant haplotype structure is not detected in the two African samples of vermilion, even when C = Clab (P = 0.817 and 0.270 for Kenya and Zimbabwe, respectively). Thus, these two samples are in accordance with the predictions of a neutral equilibrium model under expected levels of recombination (i.e., C = Clab).
Open reading frames:
A scan of 8.4 kb of the proximal breakpoint sequence (see Figure 1) with open reading frame (ORF) Finder (http://www.ncbi.nlm.nih.gov) revealed an ~200-amino-acid open reading frame between positions 7701 and 8343. A search of the protein databases revealed that this putative exon encodes a shaggy-like protein kinase. The position and direction of this exon is indicated in Figure 1. This putative exon was not included in our polymorphism study. GRAIL v. 1.3 software (http://compbio.ornl.gov) identified a second putative ORF (Figure 1) between positions 3078 and ~3227. This putative ORF is oriented in the same direction as the shaggy-like ORF and contains a helix-loop-helix dimerization motif. It is unknown whether or not these ORFs are contained in a single gene. The proximity of this putative coding region to the In(2L)t breakpoint raises the possibility that the inversion may affect patterns of gene expression. This finding would not be unprecedented in the literature (cf.
A scan for ORFs in the In(2L)t B/D junction region revealed a 93-amino-acid open reading frame oriented toward the breakpoint that encodes the 3'-end of a novel putative reverse transcriptase of the LINE family of retro-elements (
| DISCUSSION |
|---|
| TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
Origin and age of In(2L)t:
A LINE-like retrotransposon is found immediately at one of the breakpoint junctions. This element is absent in standard chromosomes but fixed in In(2L)t chromosomes, suggesting a transposable element-mediated origin for the inversion. This finding supports other recent work indicating a role for transposable elements in the formation of naturally occurring chromosomal rearrangements (
Patterns of polymorphism and divergence between chromosomal arrangements in the San Jose population sample suggest that In(2L)t has a unique and relatively recent origin. Our estimate of In(2L)t's age, ~160,000 years old (or ~1.6 million generations), is similar to the age reported for In(3L)P (
An alternative to the "long-lived balanced polymorphism" scenario is that In(2L)t has very recently increased in frequency in some populations due to selection. If so, the inverted class should have either reduced levels of variation, as observed in one allelic class at the Sod locus of D. melanogaster (
In(2L)t is not at equilibrium in natural populations:
A recent increase in the frequency of In(2L)t can be inferred by considering relative levels of nucleotide diversity in standard and inverted arrangement classes (Table 1 and Table 2) as well as world-wide inversion frequency estimates (
Genetic exchange between arrangements is suppressed at inversion breakpoints:
Our data suggest that exchange between arrangements, including gene conversion, is significantly suppressed at breakpoint regions relative to other regions. This is manifested by the lack of shared polymorphism between arrangements (Table 2) and the low diversity of In(2L)t and In(3L)P alleles (relative to standard alleles) at the junction region. We find no evidence for genetic exchange between karyotypic classes despite the large number of informative sites in the region sequenced (with the possible exception of site 174, Figure 2). In contrast, patterns of variation at Adh and Fabp2 are consistent with considerable levels of between-karyotype exchange at these loci. Patterns of nucleotide polymorphism at multiple loci linked to In(3L)P lead to a similar conclusion (Table 3).
The distribution of polymorphism within and between arrangements at rp49 is significantly different from that observed at both In(2L)t and In(3L)P breakpoints (Table 2, two-tailed P < 0.01 and P < 0.04, respectively, by a Fisher's exact test). Est-5 of D. pseudoobscura (Table 2) shows a pattern more consistent with the patterns observed at In(2L)t and In(3L)P. The rp49 data may be unusual due to the complex nature of the associated inversion system in D. subobscura (
Unusual haplotype structure at the In(2L)t breakpoint:
An unexpected feature of our data is a marked heterogeneity in levels of linkage disequilibrium across the sequence (Figure 2) among standard chromosomes. Two deeply diverged standard arrangement haplotypes exhibit strong associations among sites close to the inversion breakpoint. Yet there is ample evidence for recombination in other regions of the data set.
Our statistical test reveals that an ~1.4-kb region immediately spanning the In(2L)t breakpoint (Figure 2) has too few haplotypes to be compatible with a neutral equilibrium model under the expected level of recombination (i.e., Clab; see Table 4). It also suggests that the haplotype structure observed at In(2L)t is more extreme than at two other loci (i.e., white and Acp70A, Table 5) where unusual haplotype structure had previously been reported (
Unfortunately, the true recombination rate is unknown. Simulations run with Ccon do not always show a significant deficiency in the number of haplotypes at the In(2L)t breakpoint. However, on the basis of comparisons of physical and genetic maps () is likely to be a considerable underestimate of the true rate of exchange because it ignores the added contribution of gene conversion to C. Over small physical distances (i.e., on the order of ~1 kb), gene conversion is expected to contribute as much to the recombination rate as (
It is difficult to imagine that recombination rates are different enough in natural populations (relative to lab strains) to account for the unusual haplotype structure observed at the breakpoint. A study of 2nd chromosome recombination rates in the F1 progeny of lab strains and wild-caught D. melanogaster lines suggests that genetic background does not have a large effect (
Population genetic models:
There are several alternatives to the panmictic neutral model that make it more likely to observe fewer-than-expected haplotypes in a sample. These include some forms of selection and population subdivision. Epistatic selection (
The findings of strong associations among polymorphic sites in standard chromosomes and the extreme divergence between the two major haplotype classes (Figure 4B) raise the possibility that some form of selection on standard alleles predated the appearance of In(2L)t, and that these standard haplotype classes are quite old. Since we do not have a reasonable estimate of the divergence between species across this region, a plausible alternative explanation for the high level of nucleotide polymorphism at the breakpoint is that either the mutation rate or the level of selective constraint varies across the sequenced region. The possibility of a "hotspot" for mutation at the breakpoint seems unlikely given that polymorphisms in the In(2L)t class of chromosomes do not cluster near the location of this elevated window of polymorphism in standard chromosomes. The finding of at least one putative exon in the sequenced region does suggest that the level of selective constraint is likely to vary. Note, however, that while heterogeneity in selective constraint may be a sufficient explanation for the peak of elevated polymorphism, it does not explain the deficiency in the number of haplotypes.
An alternative to selection models for the pattern at the In(2L)t breakpoint are demographic models (cf.
The main difference between selective and demographic models is that the latter are expected to affect the whole genome with equal strength, while with selection, recombination will tend to uncouple the histories of neutral sites from that of the site under selection. Thus, depending on the rate of recombination, selection models can lead to considerable heterogeneity in linkage disequilibrium across a given region (
Implications for clines and linkage disequilibrium between Adh and In(2L)t:
The Fast/Slow allozyme polymorphism of the Adh locus in D. melanogaster is in complete linkage disequilibrium with In(2L)t in many populations (reviewed in 
1 insertion-deletion were in significant linkage disequilibrium with In(2L)t. Thus, while all In(2L)t chromosomes have the Adh-Slow allele, there is evidence for considerable between-arrangement exchange at Adh (i.e., shared polymorphisms; see Table 2). In fact, laboratory estimates of recombination between Adh and In(2L)t are very high (~10-3 to 10-4;
Standard-Adh-Fast and In(2L)t-Adh-Slow alleles coexist at intermediate frequencies in many populations world-wide (
| ACKNOWLEDGMENTS |
|---|
We thank J. Comeron, R. Hudson, A. Llopart, and M. Przeworski for computer programs and helpful discussions. Comments from G. Churchill, A. Crawford, B. Charlesworth, D. Charlesworth, M. Jensen, J. Karubian, and especially M. Przeworski significantly improved this manuscript. S.-C. Tsaur kindly provided unpublished Adh data. We are grateful to J. Gladstone for expert technical assistance. This research was supported by National Science Foundation grant DEB-9408869 to M.K. P.A. holds a Postgraduate Scholarship from the National Science and Engineering Research Council of Canada.
Manuscript received September 23, 1998; Accepted for publication July 9, 1999.
| LITERATURE CITED |
|---|
| TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
AGUADÉ, M., 1988 Restriction map variation at the Adh locus of Drosophila melanogaster in inverted and noninverted chromosomes. Genetics 119:135-140
ANDOLFATTO, P. and M. NORDBORG, 1998 The effect of gene conversion on intralocus associations. Genetics 148:1397-1399
AQUADRO, C. F., S. F. DEESE, M. M. BLAND, C. H. LANGLEY, and C. C. LAURIE-AHLBERG, 1986 Molecular population genetics of the Alcohol dehydrogenase gene region of Drosophila melanogaster.. Genetics 114:1165-1190
AQUADRO, C. F., A. L. WEAVER, S. W. SCHAEFFER, and W. W. ANDERSON, 1991 Molecular evolution of inversions in Drosophila pseudoobscura—the amylase gene region. Proc. Natl. Acad. Sci. USA 88:305-309
ASHBURNER, M., 1989 Drosophila: A Laboratory Handbook. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
BABCOCK, C. S. and W. W. ANDERSON, 1996 Molecular evolution of the sex ratio inversion complex in Drosophila pseudoobscura: analysis of the Esterase-5 region. Mol. Biol. Evol. 13:297-308[Abstract].
BEGUN, D. J. and C. F. AQUADRO, 1993 African and North American populations of Drosophila melanogaster are very different at the DNA level. Nature 365:548-550[Medline].
BEGUN, D. J. and C. F. AQUADRO, 1995 Molecular variation at the vermilion locus in geographically diverse populations of Drosophila melanogaster and Drosophila simulans.. Genetics 140:1019-1032[Abstract].
BÉNASSI, V., S. AULARD, S. MAZEAU, and M. VEUILLE, 1993 Molecular variation of Adh and P6 genes in an African population of Drosophila melanogaster and its relation to chromosomal inversions. Genetics 134:789-799[Abstract].
BÉNASSI, V., F. DEPAULIS, G. K. MEGHLAOUI, and M. VEUILLE, 1999 Partial sweeping of variation of the Fbp2 locus in a West African population of Drosophila melanogaster.. Mol. Biol. Evol. 16:347-353[Abstract].
BRAVERMAN, J. M., R. R. HUDSON, N. L. KAPLAN, C. H. LANGLEY, and W. STEPHAN, 1995 The hitchhiking effect on the site frequency-spectrum of DNA polymorphisms. Genetics 140:783-796[Abstract].
BROOKS, L. D. and R. W. MARKS, 1986 The organization of genetic variation for recombination in Drosophila melanogaster.. Genetics 114:525-547
CHARLESWORTH, B., M. T. MORGAN, and D. CHARLESWORTH, 1993 The effect of deleterious mutations on neutral molecular variation. Genetics 134:1289-1303[Abstract].
CIRERA, S. and M. AGUADÉ, 1997 Evolutionary history of the sex-peptide (Acp70A) gene region in Drosophila melanogaster.. Genetics 147:189-197[Abstract].
COMERON, J. M., M. KREITMAN, and M. AGUADÉ, 1999 Natural selection on synonymous sites is correlated with gene length and recombination in Drosophila. Genetics 151:239-249
DAVID, J. R. and P. CAPY, 1988 Genetic variation of Drosophila melanogaster natural populations. Trends Genet. 4:106-111[Medline].
DINOCERA, P. P. and Y. SAKAKI, 1990 LINEs: a superfamily of retrotransposable ubiquitous DNA elements. Trends Genet. 6:29-30[Medline].
DOBZHANSKY, T., 1970 Genetics of the Evolutionary Process. Columbia University Press, New York.
FLEISCHER, R. C., C. E. MCINTOSH, and C. L. TARR, 1998 Evolution on a volcanic conveyer belt: using phylogeographic reconstructions and K-Ar-based ages of the Hawaiian Islands to estimate molecular evolutionary rates. Mol. Ecol. 7:533-545[Medline].
FU, Y. X., 1996 New statistical tests of neutrality for DNA samples from a population. Genetics 143:557-570[Abstract].
GRELL, R., 1962 A new model for secondary nondisjunction: the role of distributive pairing. Genetics 47:1737-1754
GRIFFITHS, R. C., 1981 Neutral two-locus multiple allele models with recombination. Theor. Popul. Biol. 19:169-186.
HASSON, E. and W. F. EANES, 1996 Contrasting histories of three gene regions associated with In(3L)Payne of Drosophila melanogaster.. Genetics 144:1565-1575[Abstract].
HEY, J. and J. WAKELEY, 1997 A coalescent estimator of the population recombination rate. Genetics 145:833-846[Abstract].
HUDSON, R. R., 1987 Estimating the recombination parameter of a finite population model without selection. Genet. Res. 50:245-250[Medline].
HUDSON, R. R., 1993 The how and why of generating gene genealogies, pp. 23–36 in Mechanisms of Molecular Evolution, edited by N. TAKAHATA and A. G. CLARK. Japan Sci. Soc., Tokyo.
HUDSON, R. R. and N. F. KAPLAN, 1985 Statistical properties of the number of recombination events in the history of a sample of DNA sequences. Genetics 111:147-164
HUDSON, R. R. and N. F. KAPLAN, 1986 On the divergence of alleles in nested subsamples from finite populations. Genetics 113:1057-1076
HUDSON, R. R. and N. F. KAPLAN, 1988 The coalescent process in models with selection and recombination. Genetics 120:831-840
HUDSON, R. R., M. KREITMAN, and M. AGUADÉ, 1987 A test of neutral molecular evolution based on nucleotide data. Genetics 116:153-159
HUDSON, R. R., D. D. BOOS, and N. F. KAPLAN, 1992 A statistical test for detecting geographic subdivision. Mol. Biol. Evol. 9:138-151[Abstract].
HUDSON, R. R., K. BAILEY, D. SKARECKY, J. KWIATOWSKI, and F. J. AYALA, 1994 Evidence for positive selection in the Superoxide Dismutase (Sod) region of Drosophila melanogaster.. Genetics 136:1329-1340[Abstract].
HUDSON, R. R., A. G. SÁEZ, and F. J. AYALA, 1997 DNA variation at the Sod locus of Drosophila melanogaster: an unfolding story of natural selection. Proc. Natl. Acad. Sci. USA 94:7725-7729
IRVIN, S. D., K. A. WETTERSTRAND, C. M. HUTTER, and C. F. AQUADRO, 1998 Genetic variation and differentiation at microsatellite loci in Drosophila simulans: evidence for founder effects in New World populations. Genetics 150:777-790
ISHII, K. and B. CHARLESWORTH, 1977 Associations between allozyme loci and gene arrangements due to hitch-hiking effects of new inversions. Genet. Res. 30:93-106.
KARLIN, S. and C. MACKEN, 1991 Some statistical problems in the assessment of inhomogeneities in DNA sequence data. JASA 86:27-35.
KIRBY, D. A. and W. STEPHAN, 1996 Multi-locus selection and the structure of variation at the white gene of Drosophila melanogaster.. Genetics 144:635-645[Abstract].
KLIMAN, R. M. and J. HEY, 1993 Reduced natural-selection associated with low recombination in Drosophila melanogaster.. Mol. Biol. Evol. 10:1239-1258[Abstract].
KNIBB, W. R., 1982 Chromosomal inversion polymorphism in Drosophila melanogaster II. Geographic clines and climatic associations in Australasia, North America and Asia. Genetica 58:213-221.
KNIBB, W. R., 1986 Temporal variation of Drosophila melanogaster Adh allele frequencies, inversion frequencies and population sizes. Genetica 71:175-190.
KREITMAN, M., 1983 Nucleotide polymorphism at the Alcohol Dehydrogenase locus of Drosophila melanogaster.. Nature 304:412-417[Medline].
KREITMAN, M. and R. R. HUDSON, 1991 Inferring the evolutionary histories of the Adh and Adh-dup loci in Drosophila melanogaster from patterns of polymorphism and divergence. Genetics 127:565-582[Abstract].
KRIMBAS, C. B., and J. R. POWELL, 1992 Drosophila Inversion Polymorphism. CRC Press, Boca Raton, FL.
LACHAISE, D., M. L. CARIOU, J. R. DAVID, F. LEMEUNIER, and L. TSACAS et al., 1988 Historical biogeography of the Drosophila melanogaster species subgroup. Evol. Biol. 22:159-225.
LEICHT, B. G., E. M. S. LYCKEGAARD, C. M. BENEDICT, and A. G. CLARK, 1993 Conservation of alternative splicing and genomic organization of the myosin alkali light-chain (Mlc1) gene among Drosophila species. Mol. Biol. Evol. 10:769-790[Abstract].
LEMEUNIER, F., and S. AULARD, 1992 Inversion polymorphism in Drosophila melanogaster, pp. 339–405 in Drosophila Inversion Polymorphism, edited by C. B. KRIMBAS and J. R. POWELL. CRC Press, Boca Raton, FL.
LEWONTIN, R. C., 1974 The genetic basis of evolutionary change. Columbia University Press, New York.
LYTTLE, T. W. and D. S. HAYMER, 1992 The role of transposable element hobo in the origin of endemic inversions in wild populations of Drosophila melanogaster.. Genetica 86:113-126[Medline].
MALPICA, J. M., J. M. VASSALLO, A. FRIAS, and F. FUENTES-BOL, 1984 On recombination among In(2L)t, 
Gpdh and Adh in Drosophila melanogaster.. Genetics 115:141-142
MATHIOPOULOS, K. D., A. DELLA TORRE, V. PREDAZZI, V. PETRARCA, and M. COLUZZI, 1998 Cloning of inversion breakpoints in the Anopheles gambiae complex traces a transposable element at the inversion junction. Proc. Natl. Acad. Sci. USA 95:12444-12449
MAYNARD SMITH, J. and J. HAIGH, 1974 The hitch-hiking effect of a favorable gene. Genet. Res. 23:23-35[Medline].
METTLER, L. E., R. A. VOELKNER, and T. MUKAI, 1977 Inversion clines in natural populations of Drosophila melanogaster.. Genetics 87:169-176
MORIYAMA, E. N. and J. R. POWELL, 1996 Intraspecific nuclear DNA variation in Drosophila. Mol. Biol. Evol. 13:261-277[Abstract].
MUKAI, T. and R. A. VOELKER, 1977 The genetic structure of natural populations of Drosophila melanogaster XIII. Further studies in linkage disequilibrium. Genetics 86:175-185
NAVARRO, A., E. BETRÁN, A. BARBADILLA, and A. RUIZ, 1997 Recombination and gene flux caused by gene conversion and crossing over in inversion heterokaryotypes. Genetics 146:695-709[Abstract].
NEI, M. and W. H. LI, 1980 Non-random association between electromorphs and inversion chromosomes in finite populations. Genet. Res. 35:65-83[Medline].
NOVITSKI, E. and G. BRAVER, 1954 An analysis of crossing-over within a heterozygous inversion in Drosophila melanogaster.. Genetics 39:197-209
OCHMAN, H., F. J. AYALA, and D. L. HARTL, 1993 Use of polymerase chain reaction to amplify segments outside boundaries of known sequences. Meth. Enzymol. 218:309-321[Medline].
ROZAS, J. and M. AGUADÉ, 1994 Gene conversion is involved in the transfer of genetic information between naturally occurring inversions of Drosophila. Proc. Natl. Acad. Sci. USA 91:11517-11521
ROZAS, J., C. SEGARRA, G. RIBO, and M. AGUADÉ, 1999 Molecular population genetics of the rp49 gene region in different chromosomal inversions of Drosophila subobscura. Genetics 151:189-202
SHARP, P. M. and W. H. LI, 1989 On the rate of DNA sequence evolution in Drosophila. J. Mol. Evol. 28:398-402[Medline].
SNIEGOWSKI, P. and B. CHARLESWORTH, 1994 Transposable element numbers in cosmopolitan inversions from a natural population in Drosophila melanogaster.. Genetics 137:815-827[Abstract].
STROBECK, C., 1983 Expected linkage disequilibrium for a neutral locus linked to a chromosomal rearrangement. Genetics 103:545-555
STROBECK, C., 1987 Average number of nucleotide differences in a sample from a single subpopulation: a test for population subdivision. Genetics 117:149-153
SWOFFORD, D. L., 1993 PAUP: Phylogenetic Analysis Using Parsimony. v.3.1.1, Illinois Natural History Survey, Champaign, IL.
TAJIMA, F., 1983 Evolutionary relationship of DNA sequences in finite populations. Genetics 105:437-460
TAJIMA, F., 1989 Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics 123:585-595
TAKANO, T. S., 1998 Rate variation of DNA sequence evolution in the Drosophila lineages. Genetics 149:959-970
VAN DELDEN, W. and A. KAMPING, 1989 The relation between the polymorphisms at the Adh and Gpdh loci and the In(2L)t inversion in Drosophila melanogaster in relation to temperature. Evolution 43:775-793.
VAN DELDEN, W. and A. KAMPING, 1991 Changes in relative fitness with temperature among second chromosome arrangements in Drosophila melanogaster.. Genetics 127:507-514[Abstract].
VEUILLE, M., V. BÉNASSI, S. AULARD, and F. DEPAULIS, 1998 Allele-specific population structure of Drosophila melanogaster Alcohol dehydrogenase at the molecular level. Genetics 149:971-981
VOELKER, R. A., C. C. COCKERHAM, F. M. JOHNSON, H. E. SCHAFFER, and T. MUKAI et al., 1978 Inversions fail to account for allozyme clines. Genetics 88:515-527
WALL, J. D., 1999 Recombination and the power of statistical tests of neutrality. Genet. Res. 74:65-79.
WASSERMAN, M., 1968 Recombination-induced chromosomal heterosis. Genetics 58:125-139
WATTERSON, G. A., 1975 On the number of segregating sites in genetical models without recombination. Theor. Popul. Biol. 7:256-276[Medline].
WESLEY, C. S. and W. F. EANES, 1994 Isolation and analysis of the breakpoint sequences of chromosome inversion In(3L)Payne in Drosophila melanogaster.. Proc. Natl. Acad. Sci. USA 91:3132-3136
This article has been cited by other articles:
 |
|
 |
|
  M. Aguade Nucleotide and Copy-Number Polymorphism at the Odorant Receptor Genes Or22a and Or22b in Drosophila melanogaster Mol. Biol. Evol., January 1, 2009; 26(1): 61 - 70. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Nobrega, M. Khadem, M. Aguade, and C. Segarra Genetic Exchange versus Genetic Differentiation in a Medium-Sized Inversion of Drosophila: The A2/Ast Arrangements of Drosophila subobscura Mol. Biol. Evol., August 1, 2008; 25(8): 1534 - 1543. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. J. WHITE, F. SANTOLAMAZZA, L. KAMAU, M. POMBI, O. GRUSHKO, K. MOULINE, C. BRENGUES, W. GUELBEOGO, M. COULIBALY, J. K. KAYONDO, et al. MOLECULAR KARYOTYPING OF THE 2LA INVERSION IN ANOPHELES GAMBIAE Am J Trop Med Hyg, February 1, 2007; 76(2): 334 - 339. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. A. Dyer, B. Charlesworth, and J. Jaenike Chromosome-wide linkage disequilibrium as a consequence of meiotic drive PNAS, January 30, 2007; 104(5): 1587 - 1592. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Gonzalez, F. Casals, and A. Ruiz Testing Chromosomal Phylogenies and Inversion Breakpoint Reuse in Drosophila Genetics, January 1, 2007; 175(1): 167 - 177. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Glinka, D. De Lorenzo, and W. Stephan Evidence of Gene Conversion Associated with a Selective Sweep in Drosophila melanogaster Mol. Biol. Evol., October 1, 2006; 23(10): 1869 - 1878. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Kirkpatrick and N. Barton Chromosome Inversions, Local Adaptation and Speciation Genetics, May 1, 2006; 173(1): 419 - 434. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Bachtrog Sex chromosome evolution: Molecular aspects of Y-chromosome degeneration in Drosophila Genome Res., October 1, 2005; 15(10): 1393 - 1401. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. M. Matzkin, T. J. S. Merritt, C.-T. Zhu, and W. F. Eanes The Structure and Population Genetics of the Breakpoints Associated With the Cosmopolitan Chromosomal Inversion In(3R)Payne in Drosophila melanogaster Genetics, July 1, 2005; 170(3): 1143 - 1152. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. A. Umina, A. R. Weeks, M. R. Kearney, S. W. McKechnie, and A. A. Hoffmann A Rapid Shift in a Classic Clinal Pattern in Drosophila Reflecting Climate Change Science, April 29, 2005; 308(5722): 691 - 693. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Sezgin, D. D. Duvernell, L. M. Matzkin, Y. Duan, C.-T. Zhu, B. C. Verrelli, and W. F. Eanes Single-Locus Latitudinal Clines and Their Relationship to Temperate Adaptation in Metabolic Genes and Derived Alleles in Drosophila melanogaster Genetics, October 1, 2004; 168(2): 923 - 931. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Takano-Shimizu, A. Kawabe, N. Inomata, N. Nanba, R. Kondo, Y. Inoue, and M. Itoh Interlocus nonrandom association of polymorphisms in Drosophila chemoreceptor genes PNAS, September 28, 2004; 101(39): 14156 - 14161. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. D. Meiklejohn, Y. Kim, D. L. Hartl, and J. Parsch Identification of a Locus Under Complex Positive Selection in Drosophila simulans by Haplotype Mapping and Composite-Likelihood Estimation Genetics, September 1, 2004; 168(1): 265 - 279. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Andolfatto and J. D. Wall Linkage Disequilibrium Patterns Across a Recombination Gradient in African Drosophila melanogaster Genetics, November 1, 2003; 165(3): 1289 - 1305. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Navarro-Sabate, M. Aguade, and C. Segarra Excess of Nonsynonymous Polymorphism at Acph-1 in Different Gene Arrangements of Drosophila subobscura Mol. Biol. Evol., November 1, 2003; 20(11): 1833 - 1843. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Quesada, U. E. M. Ramirez, J. Rozas, and M. Aguade Large-Scale Adaptive Hitchhiking Upon High Recombination in Drosophila simulans Genetics, October 1, 2003; 165(2): 895 - 900. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Toomajian, R. S. Ajioka, L. B. Jorde, J. P. Kushner, and M. Kreitman A Method for Detecting Recent Selection in the Human Genome From Allele Age Estimates Genetics, September 1, 2003; 165(1): 287 - 297. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Innan and M. Nordborg The Extent of Linkage Disequilibrium and Haplotype Sharing Around a Polymorphic Site Genetics, September 1, 2003; 165(1): 437 - 444. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Laayouni, E. Hasson, M. Santos, and A. Fontdevila The Evolutionary History of Drosophila buzzatii. XXXV. Inversion Polymorphism and Nucleotide Variability in Different Regions of the Second Chromosome Mol. Biol. Evol., June 1, 2003; 20(6): 931 - 944. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Casals, M. Caceres, and A. Ruiz The Foldback-like Transposon Galileo Is Involved in the Generation of Two Different Natural Chromosomal Inversions of Drosophila buzzatii Mol. Biol. Evol., May 1, 2003; 20(5): 674 - 685. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. L. Feder, J. B. Roethele, K. Filchak, J. Niedbalski, and J. Romero-Severson Evidence for Inversion Polymorphism Related to Sympatric Host Race Formation in the Apple Maggot Fly, Rhagoletis pomonella Genetics, March 1, 2003; 163(3): 939 - 953. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. A. Gomez and E. Hasson Transpecific Polymorphisms in an Inversion Linked Esterase Locus in Drosophila buzzatii Mol. Biol. Evol., March 1, 2003; 20(3): 410 - 423. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. G. Saez, A. Tatarenkov, E. Barrio, N. H. Becerra, and F. J. Ayala Patterns of DNA sequence polymorphism at Sod vicinities in Drosophila melanogaster: Unraveling the footprint of a recent selective sweep PNAS, February 18, 2003; 100(4): 1793 - 1798. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Mousset, L. Brazier, M.-L. Cariou, F. Chartois, F. Depaulis, and M. Veuille Evidence of a High Rate of Selective Sweeps in African Drosophila melanogaster Genetics, February 1, 2003; 163(2): 599 - 609. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. A. Saunders, M. F. Hammer, and M. W. Nachman Nucleotide Variability at G6pd and the Signature of Malarial Selection in Humans Genetics, December 1, 2002; 162(4): 1849 - 1861. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. A. Odgers, C. F. Aquadro, C. W. Coppin, M. J. Healy, and J. G. Oakeshott Nucleotide Polymorphism in the Est6 Promoter, Which Is Widespread in Derived Populations of Drosophila melanogaster, Changes the Level of Esterase 6 Expressed in the Male Ejaculatory Duct Genetics, October 1, 2002; 162(2): 785 - 797. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Gonzalez, J. M. Ranz, and A. Ruiz Chromosomal Elements Evolve at Different Rates in the Drosophila Genome Genetics, July 1, 2002; 161(3): 1137 - 1154. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Bartolome, X. Maside, and B. Charlesworth On the Abundance and Distribution of Transposable Elements in the Genome of Drosophila melanogaster Mol. Biol. Evol., June 1, 2002; 19(6): 926 - 937. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Schlotterer A Microsatellite-Based Multilocus Screen for the Identification of Local Selective Sweeps Genetics, February 1, 2002; 160(2): 753 - 763. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Kauer, B. Zangerl, D. Dieringer, and C. Schlotterer Chromosomal Patterns of Microsatellite Variability Contrast Sharply in African and Non-African Populations of Drosophila melanogaster Genetics, January 1, 2002; 160(1): 247 - 256. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Parsch, C. D. Meiklejohn, and D. L. Hartl Patterns of DNA Sequence Variation Suggest the Recent Action of Positive Selection in the janus-ocnus Region of Drosophila simulans Genetics, October 1, 2001; 159(2): 647 - 657. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. M. Bergman and M. Kreitman Analysis of Conserved Noncoding DNA in Drosophila Reveals Similar Constraints in Intergenic and Intronic Sequences Genome Res., August 1, 2001; 11(8): 1335 - 1345. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C.-T. Ting, A. Takahashi, and C.-I Wu Incipient speciation by sexual isolation in Drosophila: Concurrent evolution at multiple loci PNAS, June 5, 2001; 98(12): 6709 - 6713. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. C. Verrelli and W. F. Eanes Clinal Variation for Amino Acid Polymorphisms at the Pgm Locus in Drosophila melanogaster Genetics, April 1, 2001; 157(4): 1649 - 1663. [Abstract] [Full Text]
|
|
|
|
|
|
R. M. Kliman, P. Andolfatto, J. A. Coyne, F. Depaulis, M. Kreitman, A. J. Berry, J. McCarter, J. Wakeley, and J. Hey The Population Genetics of the Origin and Divergence of the Drosophila simulans Complex Species Genetics, December 1, 2000; 156(4): 1913 - 1931. [Abstract] [Full Text]
|
|
|
|
|
|
M. Kovacevic and S. W. Schaeffer Molecular Population Genetics of X-Linked Genes in Drosophila pseudoobscura Genetics, September 1, 2000; 156(1): 155 - 172. [Abstract] [Full Text]
|
|
|
|
|
|
P. Andolfatto and M. Przeworski A Genome-Wide Departure From the Standard Neutral Model in Natural Populations of Drosophila Genetics, September 1, 2000; 156(1): 257 - 268. [Abstract] [Full Text]
|
|
|
|
|
|
A. Navarro, A. Barbadilla, and A. Ruiz Effect of Inversion Polymorphism on the Neutral Nucleotide Variability of Linked Chromosomal Regions in Drosophila Genetics, June 1, 2000; 155(2): 685 - 698. [Abstract] [Full Text]
|
|
|
|
|
|
P. Andolfatto and M. Kreitman Molecular Variation at the In(2L)t Proximal Breakpoint Site in Natural Populations of Drosophila melanogaster and D. simulans Genetics, April 1, 2000; 154(4): 1681 - 1691. [Abstract] [Full Text]
|
|
|
|
|
|
M. Caceres, M. Puig, and A. Ruiz Molecular Characterization of Two Natural Hotspots in the Drosophila buzzatii Genome Induced by Transposon Insertions Genome Res., August 1, 2001; 11(8): 1353 - 1364. [Abstract] [Full Text] [PDF]
|
|
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Andolfatto, P.
- Articles by Kreitman, M.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Andolfatto, P.
- Articles by Kreitman, M.