A Mutation in a Methionine tRNA Gene Suppresses the prp2-1 Ts Mutation and Causes a Pre-mRNA Splicing Defect in Saccharomyces cerevisiae

Corresponding author: Ren-Jang Lin, Department of Molecular Biology, Beckman Research Institute of the City of Hope, 1450 E. Duarte Rd., Duarte, CA 91010-3011., rlin{at}coh.org (E-mail)

Communicating editor: S. SANDMEYER

	ABSTRACT

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

The PRP2 gene in Saccharomyces cerevisiae encodes an RNA-dependent ATPase that activates spliceosomes for the first transesterification reaction in pre-mRNA splicing. We have identified a mutation in the elongation methionine tRNA gene EMT1 as a dominant, allele-specific suppressor of the temperature-sensitive prp2-1 mutation. The EMT1-201 mutant suppressed prp2-1 by relieving the splicing block at high temperature. Furthermore, EMT1-201 single mutant cells displayed pre-mRNA splicing and cold-sensitive growth defects at 18°. The mutation in EMT1-201 is located in the anticodon, changing CAT to CAG, which presumably allowed EMT1-201 suppressor tRNA to recognize CUG leucine codons instead of AUG methionine codons. Interestingly, the prp2-1 allele contains a point mutation that changes glycine to aspartate, indicating that EMT1-201 does not act by classical missense suppression. Extra copies of the tRNA^Leu(UAG) gene rescued the cold sensitivity and in vitro splicing defect of EMT1-201. This study provides the first example in which a mutation in a tRNA gene confers a pre-mRNA processing (prp) phenotype.

PRE-mRNA splicing is a multistep process in which introns are removed from pre-mRNAs and exons are joined. Reactions occur in a dynamic RNA-protein complex called the spliceosome, which is composed of U1, U2, U4/U6, and U5 small ribonucleoprotein (snRNP) particles, non-snRNP proteins, and the pre-mRNA (reviewed in SHARP 1994 ). Two classes of proteins involved in pre-mRNA splicing have been identified (GUTHRIE 1991 ; KRAMER 1996 ; WILL and LUHRMANN 1997 ): integral proteins, which are the snRNP proteins that bind to one or more snRNAs, and extrinsic factors, which are non-snRNP proteins that are not tightly associated with snRNAs and may interact only transiently with the spliceosome. Following spliceosome assembly splicing proceeds via two sequential transesterification reactions. ATP is not required for the transesterification reactions per se, since catalysis occurs by two phosphoryl transfer reactions (reviewed in MOORE et al. 1993 ; STALEY and GUTHRIE 1998 ). However, ATP hydrolysis is required for pre-mRNA splicing, perhaps for rearrangements of RNAs that occur during the assembly and maturation of the spliceosome (ARES and WEISER 1995 ; NILSEN 1998 ). Several RNA-dependent ATPases that are essential for pre-mRNA splicing and that may play a role in these rearrangements have been identified (reviewed in BEGGS 1993 ; STALEY and GUTHRIE 1998 ). The RNA-dependent ATPases identified in the yeast Saccharomyces cerevisiae include Prp2 (KIM et al. 1992 ), Prp5 (O'DAY et al. 1996 ), Prp16 (SCHWER and GUTHRIE 1991 ), Prp22 (COMPANY et al. 1991 ), Prp28 (STRAUSS and GUTHRIE 1991 ), Prp43 (ARENAS and ABELSON 1997 ), and Rss1 (LIN and ROSSI 1996 ) [also known as Brr2 (NOBLE and GUTHRIE 1996 ), Slt22 (XU et al. 1996 ), and Snu246 (LAUBER et al. 1996 )]. All contain conserved RNA helicase motifs, including the signature DEAD or DEAH sequence and some have RNA helicase activity in vitro (LAGGERBAUER et al. 1998 ; SCHWER and GROSS 1998 ; WAGNER et al. 1998 ; WANG et al. 1998 ).

The Prp2 protein is an extrinsic factor that interacts transiently with spliceosomes prior to the first transesterification reaction in pre-mRNA splicing (KING and BEGGS 1990 ; KIM and LIN 1993 ; PLUMPTON et al. 1994 ). Prp2 binds to the pre-mRNA-containing spliceosome in the absence of ATP in vitro and is released from the spliceosome following ATP hydrolysis (KIM and LIN 1993 ; PLUMPTON et al. 1994 ); as a result, the spliceosome is rearranged and activated for the first transesterification reaction (KIM and LIN 1996 ). Prp2 has not been shown to have RNA helicase activity in vitro; however, Prp2 may require additional protein factor(s) for this activity (KIM et al. 1992 ). Thus far, one factor, Spp2, has been identified that interacts directly with Prp2 (ROY et al. 1995 ). SPP2 was identified as a high-copy suppressor of temperature-sensitive prp2 mutant strains (LAST et al. 1987 ). Biochemical analysis demonstrated that Spp2 is an essential splicing factor required for Prp2 binding to the spliceosome prior to the first transesterification reaction (ROY et al. 1995 ).

Genetic approaches to the identification of factors involved in yeast pre-mRNA splicing have been fruitful. Thus far, at least 40 mutants have been identified that have defects in RNA processing (prp), as measured by the accumulation of pre-mRNA or splicing intermediates (reviewed in RUBY and ABELSON 1991 ; RYMOND and ROSBASH 1992 ). Successful strategies for isolation of mutants in pre-mRNA splicing have included screens of heat-sensitive (HARTWELL 1967 ; VIJAYRAGHAVAN et al. 1989 ; BLANTON et al. 1992 ; MADDOCK et al. 1996 ) or cold-sensitive (STRAUSS and GUTHRIE 1991 ; NOBLE and GUTHRIE 1996 ) banks of mutants. Identification of extragenic suppressors or of mutants that show a synthetic lethal phenotype with mutations in known splicing factors has also been informative (COUTO et al. 1987 ; CHAPON and LEGRAIN 1992 ; FRANK et al. 1992 ; LIAO et al. 1993 ; WELLS et al. 1996 ; XU et al. 1998 ).

Extragenic suppressors and synthetic lethal mutations are often in genes whose products physically interact with the original mutant gene product (HUFFAKER et al. 1987 ). To identify factors that interact with Prp2, we isolated an extragenic suppressor of prp2-1. The suppressor is an anticodon mutation in EMT1, one of the genes encoding elongation tRNA^Met, which changes CAT to CAG. This anticodon mutation in EMT1-201 presumably allowed EMT1-201 suppressor tRNA to recognize CUG leucine codons instead of AUG methionine codons. We identified the prp2-1 mutation as a change from glycine to aspartate at amino acid 360, indicating that EMT-201 does not act by missense suppression of prp2-1. In addition, cells carrying EMT1-201 have a Cs^- phenotype and a splicing defect at 18°, which could be rescued by extra copies of a tRNA^Leu gene. This study provides the first example in which a mutation in a tRNA gene confers a pre-mRNA processing (prp) phenotype.

	MATERIALS AND METHODS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Yeast strains:
Yeast strains used in this study are listed in Table 1. All genetic manipulations, tetrad dissections, and yeast growth conditions were performed as described in ROSE et al. 1990 . Yeast were transformed with DNA using the lithium acetate method as described in ROSE et al. 1990 . The prp2-1::URA3 marked strain was constructed as follows to distinguish intragenic from extragenic suppressors by genetic crosses. A HindIII/BamHI fragment of PRP2 (CHEN and LIN 1990 ) was cloned into the HindIII and BamHI site of the plasmid YIp5 and named YIp5-H/B. The plasmid YIp5-H/B was linearized with XbaI, which cut within the HindIII/BamHI fragment, before transformation into the prp2-1 strain P30-6D, which has a point mutation between the HindIII and XbaI sites of PRP2. Homologous recombination results in one copy of the complete prp2-1 allele and a 5'-truncated PRP2, with the integrated URA3 marker lying between them. All Ura⁺ transformants had Ts^- phenotypes. Transformants were crossed with a wild-type strain and the resulting tetrads were analyzed, showing two Ts^-/Ura⁺ and two Ts⁺/Ura^- spores (data not shown). Ts^-/Ura⁺ strains with two different mating types were obtained as the prp2-1::URA3 marked strain A (MATa) and B (MAT).

Isolation of suppressors:
The prp2-1 strain 3.2A10C was mutagenized using ethyl methanesulfonate (EMS) as described in VIJAYRAGNATHAN et al. (1989). The treatment resulted in 10–30% survival. Spontaneous Ts⁺ revertants of the prp2-1 strain SS304 were isolated from cells plated on YPD plates (about 1 x 10⁸ cells per plate), and incubated for 4 days at 35°. Ts⁺ colonies were selected and tested for cold sensitivity on YPD plates incubated at 18°.

RNA isolation and analysis:
RNA was extracted from yeast by the glass bead method described by LIN et al. 1996 . A 10-ml yeast culture grown in YPD, OD₆₀₀ of 1.5, was shifted to different temperatures of 34°, 26°, or 18° for 2 or 4 hr. Cells were harvested by centrifugation and cell pellets were frozen at -80° prior to RNA extraction. A total of 20 µg of total cellular RNA per lane was separated on 1.2% agarose-formaldehyde gels and transferred to nylon membranes. Northern blot analysis was performed according to ROSE et al. 1990 . The blots were probed with a 2.2-kb HindIII fragment of the CRY1 gene and an EcoRI fragment of the ACT1 gene, which were uniformly labeled with ³²P by random priming.

Preparation of extracts and in vitro splicing reactions:
Preparation of splicing extracts and actin pre-mRNA substrate was done as described (LIN et al. 1987 ; KIM and LIN 1993 , KIM and LIN 1996 ). Heat-inactivated prp2 extract (prp2) was made by incubating the prp2 splicing extract at 37° for 30 min. Glass bead extracts were used as a source of the Prp2 protein and were prepared as follows: cells from 5 ml of yeast culture (OD₆₀₀ 3) were harvested, washed with water, and frozen at -80° until use. Frozen cells were thawed and washed with prechilled buffer A (10 mM HEPES, pH 7.8, 1.5 mM MgCl₂, 10 mM KCl, 0.5 mM DTT) containing the protease inhibitors phenylmethylsulfonyl fluoride (1 mM), benzamidic acid (1 mM), leupeptin (1 µM), and pepstatin A (1 µM), and finally resuspended in 300 µl of the same solution. An equal volume of glass beads (0.45 mM, Sigma, St. Louis) was added and the cells were broken by vortexing for 1 min, followed by chilling on ice for 1 min. The vortexing procedure was repeated three times. After a 1-min spin at 4°, supernatants were collected and mixed with 1/10 volume of 2 M KCl. The mix was centrifuged at 14,000 rpm at 4° for 15 min, and the resulting supernatant was collected and used as glass bead extract.

Spliceosome assembly assay:
Nondenaturing composite gel electrophoresis was performed essentially as described (SERAPHIN and ROSBASH 1989 ). The polyacrylamide-agarose mixture was cooled to 36° before N,N,N',N'-tetramethylenediamine was added. The gel was polymerized between two glass plates at room temperature for 1 hr and stored at 4°. In vitro splicing reactions (10 µl) were stopped by the addition of 10 µl ice-cold buffer R (2 mM (MgOAc)₂, 50 mM HEPES, pH 7.5), and 1 µl yeast total RNA (10 mg/ml). The mixture was incubated at 0° for 10 min and then 5 µl loading buffer was added and 5 µl of the final mixture was loaded onto the gel.

Library construction and cloning:
Yeast genomic DNA from strain P30-4C (prp2-1, EMT1-201) was prepared from 500 ml of an overnight culture using glass beads and polyethylene glycol precipitation as described in FUJIMURA and SAKUMA 1993 . Purified DNA (200 mg) was divided into five aliquots, and each was digested in a 100-µl reaction with 10 units of restriction enzyme DpnII (New England Biolabs, Beverly, MA) at 37°. The extent of digestion was monitored by gel electrophoresis of a small aliquot, while the remaining samples were frozen in liquid nitrogen and stored at -80°. Digestion with DpnII was continued until the average length of DNA fragments was ~10 kb. DNA fragments around the 10-kb marker were purified from agarose gels by phenol extraction. Purified DNA fragments were ligated overnight at 18° with an equal amount of YCp50 DNA, which had been digested with BamHI and treated with calf intestine alkaline phosphatase. The ligated DNA was separated from unligated DNA by electrophoresis on agarose gels and purified by phenol extraction. A total of 5 µg of the ligated, unamplified genomic library from P30-4C (prp2-1, EMT1-201) was used to transform strain P30-6D (prp2-1) by the lithium acetate method. After transformation, plates were incubated at 26° for 12 hr and then shifted to 35° for 3 to 4 days.

A wild-type library in YCp50 (a gift of Dr. Clarence Chan, University of Texas, Austin) was used to transform strain P30-13 (EMT1-201) to select for Cs⁺ clones and isolate the gene encoding tRNA^Leu (UAG). After transformation, plates were incubated directly at 18°.

For mapping the prp2-1 mutation, PRP2 clones with sequential deletions from the N terminus were used in a marker rescue experiment. The YCp50-EB plasmid was constructed by inserting the 3.2-kb EcoRI/BamHI fragment containing the PRP2 gene into YCp50 (Figure 5B). YCp50-HB contains the HindIII/BamHI fragment of PRP2, which removes the N-terminal amino acids 1–205, YCp50-XB contains the XbaI/BamHI fragment of PRP2, removing amino acids 1–464, and YCp50-PB contains the PvuII/BamHI fragment of PRP2, removing amino acids 1–668. After transformation of each plasmid into the prp2-1 strain P30-6D, Ura⁺ colonies were selected. One milliliter of culture (OD₆₀₀ 3) was washed with sterile water, spread on Ura^- plates, and incubated at 37°. Ts⁺ revertants were counted after 4 days.

View larger version (100K): In this window In a new window Download PPT slide   Figure 1. SPP201-1 is not linked to PRP2. The prp2-1, SPP201-1 strain 5-23 was crossed with a prp2-1 marked strain (prp2-1::URA3), sporulated, and the tetrads dissected. Progeny cells were suspended in water and aliquots spotted on YPD or -Ura plates. Each row contains 2 tetrads, and 12 complete tetrads were tested on (a) YPD at 26°, (b) -Ura at 26°, (c) YPD at 34°, and (d) YPD at 18°.

View larger version (83K): In this window In a new window Download PPT slide   Figure 2. SPP201-1 suppresses the splicing defect of prp2-1 at 34° and has a splicing defect at low temperatures in vivo. Cells from the indicated haploid strains were grown at 26° in YPD to OD600 of 1.5 and then were shifted to 34° for 2 hr, 18° for 2 or 4 hr, or maintained at 26° for 2 hr. RNA was extracted from each culture, and 20 µg of total RNA per lane was separated on a 1.2% denaturing agarose gel and blotted. Blots were hybridized with 32P-labeled CRY1, ACT1, or LEU2 DNA probes, as indicated. The positions of the unspliced pre-mRNAs and spliced mRNAs are indicated. Lanes 1 and 2, RNA from wild-type strain SS328; lanes 3 and 4, RNA from prp2-1 strain P30-6D; lanes 5–8, RNA from prp2-1, SPP201-1 strain P30-4C; lanes 9–12, RNA from SPP201-1 strain P30-13.

View larger version (99K): In this window In a new window Download PPT slide   Figure 3. Extract from the SPP201-1 mutant strain is not efficient in in vitro splicing. (A) Splicing extracts were prepared from the indicated strains, which were derived from a single tetrad. Extracts were assayed separately for splicing activity by incubating each with ATP and 32P-labeled actin pre-mRNA as described in KIM et al. 1992 for either 0, 2, 5, 15, or 30 min, as indicated. After incubation, RNA was extracted and separated on a denaturing acrylamide gel. The positions of the pre-mRNA, mRNA, released intron lariat (IVS*), and intron lariat-exon 2 (IVS*–E2) intermediates are indicated. Lanes 1–5, extract derived from the wild-type strain P25-7A; lanes 6–10, extract derived from the SPP201-1 strain P25-7C. (B) Spliceosome complex assembly. Splicing extracts prepared as above were incubated with ATP and 32P-labeled actin pre-mRNA under splicing conditions and assayed for spliceosome complex assembly on a nondenaturing polyacrylamide-agarose gel. Complexes are designated as described in CHENG and ABELSON 1987 . Lane 1, wild-type extract; lane 2, heat-treated prp2-1 extract; lane 3, heat-treated prp2-1 extract with Prp2 protein added; lane 4, SPP201-1 extract.

View larger version (123K): In this window In a new window Download PPT slide   Figure 4. Heat sensitivity of Prp2 activity in extracts. (A) The Prp2 protein from a prp2-1, SPP201-1 strain is active in splicing after heat treatment. The heat sensitivities of Prp2 proteins derived from strains P30-6D (prp2-1) and P30-4C (prp2-1, SPP201-1) were compared for their abilities to complement heat-inactivated prp2-1 extract. Glass bead extracts derived from the prp2-1 strain P30-6D (lanes 1 and 2) and the prp2-1, SPP201-1 strain P30-4C (lanes 3 and 4) were either incubated at 33° for 10 min (+ heat treatment, lanes 1 and 3) or left on ice (- heat treatment, lanes 2 and 4). One microliter of glass bead extract was added to 4 µl of heat-inactivated prp2-1 splicing extract (prp2-1) in a 10-µl splicing reaction with ATP and 32P-labeled actin transcript. After incubation for 30 min at 23°, RNA was recovered by phenol extraction and ethanol precipitation and separated on a 7.5% acrylamide/7 M urea gel. The positions of the pre-mRNA, mRNA, released intron lariat (IVS*), and intron lariat-exon 2 (IVS*–E2) are indicated. (B) The Prp2 protein from a SPP201-1 strain is less stable than Prp2 from a wild-type strain. Glass bead extracts were prepared from the wild-type strain P25-7A (lanes 1, 3, and 5) and the SPP201-1 strain P25-7C (lanes 2, 4, and 6). Both express the Prp2 protein from the chromosomal wild-type gene. Aliquots of each glass bead extract were incubated at 33° for 10 min (lanes 1 and 2), 20 min (lanes 3 and 4), or 30 min (lanes 5 and 6) prior to use. One microliter glass bead extract was added to 4 µl heat-inactivated prp2-1 extract (prp2-1) in a 10-µl splicing reaction containing ATP and 32P-labeled actin pre-mRNA, and processed as described in Figure 4A.

View larger version (123K): In this window In a new window Download PPT slide   Figure 5. An elevated copy number of EMT1-201 is lethal to the cell. The prp2-1 strain P30-6D was transformed with 2 µg of the indicated plasmid DNA and then incubated at 26° for 3–4 days. (a) pRS426 vector alone; (b) pRS316/EMT1-201, which has a single copy of EMT1-201 on a single copy vector; (c) pRS426/EMT1-201, which has a single copy of EMT1-201 on a multicopy vector; (d) pRS426/3 copies of EMT1-201.

The plasmid YCp51 was derived from YCp50 by removal of the EcoRI and HindIII sites. A BamHI/BamHI fragment of PRP2 was inserted into YCp51 and the resulting plasmid was used to clone the prp2-1 mutation by the gap repair method (ORR-WEAVER et al. 1981 ). A gap was created by digestion of YCp51-PRP2 with HindIII and XbaI since the mutation is located between those restriction sites. The plasmid with the gap was gel purified and used to transform the prp2-1 strain P30-6D. Plasmids from Ura⁺/Ts^- transformants were recovered through Escherichia coli transformation as described in ROSE et al. 1990 .

PCR:
Primers EMT1-1 (5' ATGAGAATTCAGGATAATGTATTG 3') and EMT1-2 (5' ATTTGAATTCTCAAATAAATGAGC 3') were designed to PCR amplify the entire EMT1 gene from wild-type and suppressor strains. The PCR product was gel purified and ligated to the EcoRI site of the CEN vector pRS316 (SIKORSKI and HIETER 1989 ) or the 2µ vector pRS426 (CHRISTIANSON et al. 1992 ). Primers Leu-1 (5' TTCTTGAATTCATTTAAAGATATT 3') and Leu-2 (5' TTCAGGTACCATTTGCCATTTTGC 3') were used to amplify the tRNA ^Leu (UAG) gene. The PCR product was gel purified and ligated to the EcoRI and KpnI sites of the CEN vector pRS316. Primers Leu-3 (5' GGGAGTTTGGCCGAGTGG 3') and Leu-4 (5' TGAGAGCTAAGGGATTCG 3') were used to test DNA fragments for the presence of the tRNA^Leu(UAG). Sequencing of EMT1-1 was performed using Sequenase (Stratagene, La Jolla, CA) and the primer 5' TCATATGTGTTCTAT 3'.

	RESULTS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Isolation and characterization of extragenic suppressors:
To understand the nature of the binding of Prp2 to the spliceosome, we used a genetic suppression approach to identify Prp2-interacting factors. Spontaneous or EMS-induced Ts⁺ (at 35°) revertants of temperature-sensitive prp2-1 strains SS304 and 3.2A10C were selected (see Table 1 for a complete description of the strains used in this study). There were 89 Ts⁺ revertants from 1 x 10⁹ EMS-treated cells and 31 spontaneous Ts⁺ revertants from 2 x 10⁹ untreated SS304 cells. To eliminate intragenic revertants as well as to facilitate genetic analysis of the suppressors, the cold sensitivity of single Ts⁺ colonies was tested on YPD plates at 18°. Seven Ts⁺Cs^- suppressors were isolated from the two prp2-1 strains. Revertants were twice backcrossed to prp2-1 strain 3.2A10B to obtain clean Ts⁺Cs^- cosegregation. Analysis of at least 12 tetrads from each of the seven revertants showed two Ts⁺Cs^-, two Ts^-Cs⁺ segregation patterns, indicating that suppression and Cs^- were linked and could be caused by a single mutation. One of the Ts⁺Cs^- suppressors, SPP201-1 (suppressor of prp2-1), was characterized further; the remaining six suppressors later were found to be identical to SPP201-1 (see below).

The putative suppressor-carrying strain was crossed to the prp2-1 strain 3.2A10B and to the wild-type strain SS330 to determine the dominance of the Ts suppression and Cs growth traits. Diploid cells with the genotype prp2-1/prp2-1, spp201⁺/SPP201-1 were Ts⁺ at 35°, and diploid cells with PRP2/prp2-1, spp201⁺/SPP201-1 were Cs^- at 18°, indicating that suppression of prp2-1 and cold-sensitive growth were both dominant traits (data not shown). Interestingly, further analysis of SPP201-1 revealed that while it can grow at 35° it is Ts^- at 37°, suggesting that SPP201-1 not only caused the Cs^- phenotype but also is partially Ts^-. In fact, SPP201-1 strains grew more slowly than wild-type strains at 26°. To confirm that the Cs^- phenotype cosegregated with suppression and the mutation was not linked to the PRP2 locus, the prp2-1, SPP201-1 strain was crossed to a strain carrying a prp2-1::URA3 marked allele. Upon sporulation, tetrads were dissected and the spore colonies were tested for temperature sensitivity, cold sensitivity, and uracil auxotrophy. Cold sensitivity and resistance to high temperature always cosegregated in 96 tetrads but did not cosegregate with uracil prototrophy, indicating that suppression and cold sensitivity were tightly linked but were not linked to the original prp2-1 allele (Figure 1).

We also tested the specificity of suppression by SPP201-1. A prp2-5 strain (2-5.1D1D) and a prp2-8 strain (2-8.3A1D) were crossed individually with a prp2-1::URA3, SPP201-1 strain and the resulting tetrads were analyzed. Consistent with SPP201-1 being an allele-specific suppressor of prp2-1, only spore colonies that were cold sensitive and uracil prototrophs could also grow at 35° (data not shown).

SPP201-1 relieves the splicing defect of prp2-1 and has a prp phenotype at low temperature:
If SPP201-1 suppressed the splicing defect of prp2-1, spliced messages should be detected in prp2-1, SPP201-1 double mutant cells at high temperature. Analysis of RNA from prp2 mutant strains isolated after a temperature shift to the nonpermissive temperature shows accumulation of unspliced pre-mRNA. To examine the effects of SPP201-1 on the prp2-1 splicing defect, total RNA was prepared from four different haploid strains: wild type (SS328); prp2-1 (P30-6D); prp2-1, SPP201-1 (P30-4C); and SPP201-1 (P30-13), with or without temperature shifts. Northern blot analysis was used to observe the steady-state levels of two intron-containing pre-mRNAs: CRY1, which encodes a ribosomal protein, and ACT1, which encodes actin. Intron-less LEU2 mRNA was used as a loading control (Figure 2, bottom). As expected, the wild-type strain showed only fully processed ACT1 or CRY1 mRNAs at both high and low temperatures (Figure 2, lanes 1 and 2). The prp2-1 strain did not accumulate pre-mRNA at the permissive temperature (lane 3) but accumulated both ACT1 and CRY1 pre-mRNAs after a temperature shift to 34° for 2 hr (lane 4). The prp phenotype was relieved in the prp2-1, SPP201-1 strain, as seen by the lack of pre-mRNA accumulation after a temperature shift to 34° for 2 hr (lane 5). This result is in accord with the Ts⁺ phenotype of the prp2-1, SPP201-1 strain at 34°, and suggests that SPP201-1 suppressed the Ts growth defect of the prp2-1 mutant by rescuing the splicing defect at 34°. Interestingly, Northern blots of RNA prepared from cells maintained at 26° show accumulation of ACT1 and CRY1 pre-mRNAs in both the prp2-1, SPP201-1 and SPP201-1 strains, suggesting that SPP201-1 has a splicing defect at 26°, the permissive temperature for prp2-1 (lanes 6 and 10). Pre-mRNA also accumulated in SPP201-1 strains after a shift to 18° for 2 or 4 hr (lanes 7, 8, 11, 12). Therefore, SPP201-1 rescues the temperature sensitivity and splicing defect of prp2-1, but confers a prp phenotype at low temperatures.

In vitro splicing activity of SPP201-1:
Data from the Northern analysis indicated that SPP201-1 is involved in pre-mRNA splicing in vivo. Splicing extracts from SPP201-1 prepared at low temperatures might therefore be defective for splicing in vitro. Splicing extracts were prepared in parallel from a spp201⁺ wild-type (P25-7A) and a SPP201-1 mutant (P25-7C) strain and tested for their abilities to process ³²P-labeled ACT1 pre-mRNA. Splicing reactions were incubated at 23° for the indicated times, and the RNA was extracted and analyzed on a denaturing acrylamide gel (Figure 3A). The SPP201-1 extract showed a low level of splicing activity after 15 min (Figure 3A, lane 9), whereas the wild-type extract showed a noticeable amount of pre-mRNA processing by 2 min of incubation (Figure 3A, lane 2). At 30 min, much more mRNA was produced in the wild-type extract than in the SPP201-1 extract (Figure 3A; compare lanes 5 and 10). To show that the low splicing activity of the SPP201-1 extract was not due to poor extract preparation, splicing complexes were formed with ³²P-labeled actin pre-mRNA and analyzed on nondenaturing gels (Figure 3B). Complexes corresponding to A₁, A₂, and B complex were formed after incubation with wild-type extract (Figure 3B, lane 1; CHENG and ABELSON 1987 ). Heat-treated prp2-1 extract (prp2) accumulates A₁ complex, which is the complex formed prior to active spliceosome A₂ (Figure 3B, lane 2). Addition of purified Prp2 protein to prp2 permits formation of the A₂ complex (Figure 3B, lane 3). B complex and a low level of A complexes formed in the SPP201-1 extract (Figure 3B, lane 4), and the IVS*–E2 splicing intermediate was seen in an aliquot of the reaction separated on a denaturing polyacrylamide gel (data not shown). The SPP201-1 extract was quite active in forming the B complex, indicating that the extract preparation was fine. The partial block to the transition from B to A₁ in the SPP201-1 extract suggested that some splicing factors involved in the loading of U4/U6.U5 tri-snRNP might be affected by the mutation. Thus, both the in vivo and in vitro assays indicated that the gene product of SPP201 may be involved in pre-mRNA splicing and possibly interacts with Prp2.

To examine the mechanism by which SPP201-1 suppressed the Ts^- growth of prp2-1, the thermal stability Prp2 activity was tested in SPP201-1 and spp201⁺ extracts. Glass bead extracts, which by themselves cannot carry out a complete splicing reaction, were prepared from a prp2-1 strain (P30-6D) and a prp2-1, SPP201-1 strain (P30-4C) and compared for their ability to complement heat-inactivated prp2-1 splicing extracts (prp2; Figure 4A). The mutant Prp2 protein encoded by prp2-1 can be inactivated after heat treatment of the prp2-1 extract (LUSTIG et al. 1986 ); thus, the only active Prp2 must be supplied by the complementing extract (LIN et al. 1987 ). Both glass bead extracts could complement the prp2 extract, indicating that Prp2 from either complementing extract was active (Figure 4A, lanes 2 and 4). Extract from the prp2-1 strain could no longer complement prp2 after heat treatment as expected (Figure 4A, lane 1), whereas the prp2-1, SPP201-1 extract remained active after the same treatment (Figure 4A, lane 3). These results suggest that the Prp2 protein in the prp2-1, SPP201-1 extract is more heat resistant than the Prp2 protein in the prp2-1 extract. Therefore the suppression of prp2-1 by SPP201-1 may be due to the synthesis of a more heat-stable protein in the suppressor-containing strain.

It is possible that SPP201-1 has a global effect on protein stability at high temperature, such as by inactivating a protease. If that were true, the wild-type Prp2 protein should be more heat stable in the presence of SPP201-1. To test this, glass bead extracts were prepared from a wild-type (P25-7A) and SPP201-1 mutant strain (P25-7C), heat treated by incubation at 33° for different times, and compared for their ability to complement heat-treated prp2-1 splicing extracts (prp2) in an in vitro splicing assay (Figure 4B). There was an increase in pre-mRNA accumulation and a decrease in processing intermediates in the SPP201-1 extract relative to wild type after 10 min (Figure 4B, lanes 1 and 2), 20 min (Figure 4B, lanes 3 and 4), or 30 min (Figure 4B, lanes 5 and 6) of heat treatment. Thus, the SPP201-1 extract was more heat sensitive than the wild-type extracts, indicating that SPP201-1 may decrease the stability of the wild-type Prp2 protein at high temperatures. Moreover, these data may also suggest that the growth defect of SPP201-1 strains at 37° may be due to increased heat sensitivity of the Prp2 protein.

SPP201-1 is an allele of the EMT1 gene:
Because SPP201-1 was a dominant suppressor, cloning of the SPP201-1 gene required a library made from a suppressor strain. We made a yeast genomic library from the prp2-1, SPP201-1 strain P30-4C and transformed the prp2-1 strain P30-6D with it. Seventeen thousand transformants of P30-6D were screened for their ability to grow at 35° since the SPP201-1 allele is dominant for reversion of the prp2-1 Ts growth phenotype. Eleven isolates were identified that met the screening criterion. Strains of prp2-1 transformed with these plasmids grew at 35° but not at 18°, indicating that the clones could contain the SPP201-1 gene since both suppression and cold sensitivity were dominant. Further restriction enzyme analysis showed that all clones had a common 1.7-kb BstBI fragment (data not shown). A 2.4-kb HindIII/HindIII fragment containing the common 1.7-kb fragment was cloned into the vector pRS316 and the DNA sequence was determined. The sequence information was used to search the yeast genomic sequence database and a unique segment of the yeast genome was identified. The fragment included part of a Ty1 element and the EMT1 gene, one of the five genes encoding elongator methionine tRNA in Saccharomyces cerevisiae (ASTROM et al. 1993 ). Since the tRNA gene was the only complete gene on the 2.4-kb segment, it was likely that it was SPP201. The EMT1 region on the plasmid was amplified by PCR and inserted into pRS316. Complete sequence determination of the EMT1 gene on the recombinant plasmid pRS316-EMT1 demonstrated that the anticodon sequence of EMT1 in the complementing clone had a mutation from CAT to CAG (data not shown), which presumably would cause the tRNA to recognize a leucine codon instead of a methionine codon. To confirm that the mutant EMT1 encoded SPP201-1, primers from the EMT1 gene were used to amplify the EMT1 gene from wild type and six additional SPP201-1 strains by PCR. Sequencing of the PCR products showed that the emt1⁺ gene from the wild-type strain had CAT at the anticodon, whereas EMT1 from all seven SPP201-1 strains had CAG at the anticodon.

The relevance of the anticodon mutation in EMT1 to the suppression of prp2-1 was demonstrated by transformation of the prp2-1 strain P30-6D with EMT1 from either the wild-type (P30-6D) or SPP201-1 (P30-4C) strain. Transformation of prp2-1 by pRS316-EMT1 from SPP201-1 converted the phenotype from Ts^-Cs⁺ to Ts⁺Cs^-, whereas the gene from the wild-type strain did not (data not shown). Transformation of a wild-type strain with EMT1 from the suppressor strain caused the cell to be Cs^- at 18° and Ts^- at 37° (data not shown). The transformation data indicate that the suppressor is an allele of EMT1, and therefore it was renamed EMT1-201.

We sequenced the mutation in prp2-1 to determine if suppression by EMT1-201 was due to missense suppression. The location of the prp2-1 mutation was determined by marker rescue using sequentially deleted PRP2 clones. The mutated region in the prp2-1 gene was cloned by gap repair and sequenced (ORR-WEAVER et al. 1981 ; see MATERIALS AND METHODS). The mutation in prp2-1 is a G to A, changing a glycine to aspartate at amino acid 360 (data not shown). Because EMT1-201 codes for a mutated tRNA^Met, which could recognize a leucine codon, it is unlikely that EMT1-201 suppresses prp2-1 by missense suppression.

If EMT1-201 misincorporates methionine into leucine codons during translation, cells with a high-copy number of EMT1-201 could be unable to grow due to a decrease in the fidelity of protein synthesis. The EMT1-201 mutation creates a perfect anticodon:codon recognition for the CUG leucine codon. S. cerevisiae does not have a tRNA^Leu with a CAG anticodon, but instead requires a G:U wobble pairing with tRNA^Leu (UAG; PERCUDANI et al. 1997 ). Therefore, the mutant tRNA in EMT1-201 expressed at high levels may have a higher affinity than the endogenous tRNA^Leu(UAG) for recognition of the CUG leucine codon in the mRNA. To test this idea, plasmids carrying the EMT1-201 gene were constructed in pRS316, a single copy CEN vector, and in pRS426, a multicopy 2µ vector. The prp2-1 strain P30-6D was transformed with three different EMT1-201 constructs and the vector alone (Figure 5). Cells transformed with pRS316/EMT1-201, a single copy plasmid with one copy of EMT1-201, grew somewhat slower than the control at 26° (Figure 5B). Cells transformed with pRS426/EMT1-201, a multicopy plasmid with one copy of EMT1-201, grew more slowly than both the pRS316/EMT1-201 and control transformants, forming only tiny colonies (Figure 5C). No transformants were observed when cells were transformed with a multicopy plasmid with three copies of EMT1-201, indicating that overexpression of EMT1-201 is deleterious to wild-type yeast cells (Figure 5D).

The cold-sensitive growth of EMT1-201 could be caused by misincorporation of methionine into leucine codons during translation. If that is so, additional copies of the leucine tRNA may rescue the Cs^- and splicing defects conferred by EMT1-201 by competing with the EMT1-201 mutant tRNA. We addressed this possibility by screening a wild-type yeast genomic library on the CEN vector YCp50 for complementation of Cs growth. The library was used to transform an EMT1-201 mutant strain (P30-13) and select for the ability to grow at 18°. Three cold-resistant clones were isolated among 7200 Ura⁺ transformants. Sequence analysis of a 0.9-kb complementing fragment identified a 104-bp region with complete sequence identity to the tRNA ^Leu(UAG) gene. The gene was amplified by PCR and subcloned into the single-copy centromere vector pRS316. The resulting plasmid, pRS316-tRNA^leu(UAG), suppressed the Cs^- phenotype of EMT1-201 strains in vivo (data not shown).

Suppression of the in vitro splicing defect was tested by preparing extracts from EMT1-201 strains that either did or did not carry the pRS316-tRNA^Leu (UAG) plasmid. Splicing of actin pre-mRNA was detected in wild-type extract (Figure 6, lane 1) but not in the EMT1-201 extract (Figure 6, lane 2). The EMT1-201 extract could be complemented by a splicing extract missing only functional Prp2 (Figure 6, prp2, lane 3), but not by purified Prp2 protein (Figure 6, lane 4), supporting the in vivo evidence that EMT1-201 confers a splicing defect at low temperatures that is independent of its suppression of the prp2-1 splicing defect. Splicing activity was restored in the EMT1-201/tRNA^Leu (UAG) strain (Figure 6, lane 5), indicating that the leucine tRNA was able to suppress the Cs^- and splicing defects conferred by EMT1-201 both in vivo and in vitro. These suppression data support the idea that the EMT1-201 phenotype is caused by misincorporation of methionine into leucine codons during translation.

View larger version (68K): In this window In a new window Download PPT slide   Figure 6. A tRNALeu gene rescues the splicing defect of EMT1-201. Splicing extracts were prepared from the wild-type strain P25-7A, the EMT1-201 strain P25-7C, and strain P25-7C carrying the plasmid pRS316/tRNALeu(UAG). Splicing reactions were done in 10 µl, containing 4 µl splicing extract, ATP, and 32P-labeled actin pre-mRNA, with or without 1 µl of the complementing factor. After incubation at 23° for 30 min, RNA was extracted and separated on a 7.5% acrylamide/7 M urea gel. Lane 1, wild-type extract (P25-7A); lane 2, EMT1-201 extract (P25-7C); lane 3, EMT1-201 extract plus 1 µl heat-treated prp2-1 splicing extract ( 2-1); lane 4, EMT1-201 extract plus 1 µl purified Prp2 protein; lane 5, extract from the EMT1-201 strain carrying the plasmid pRS316/tRNALeu(UAG). The positions of the actin pre-mRNA, mRNA, released intron-lariat (IVS*), and intron lariat-exon 2 (IVS*–E2) are indicated.

	DISCUSSION

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Prp2 is an RNA-dependent ATPase required before the first transesterification reaction in pre-mRNA splicing. Temperature-sensitive prp2-1 mutants are defective in pre-mRNA splicing in vivo and in vitro. To identify factors that interact genetically with PRP2, dominant Cs^- suppressors of prp2-1 were isolated. The Cs mutation suppressed the prp2-1 splicing defect in vivo. Interestingly, the Cs suppressor by itself has a splicing defect in vivo and in vitro. We identified the suppressor as one of the genes encoding elongator methionine tRNA, which had a mutation allowing it to read a leucine codon. We identified the prp2-1 mutation as a glycine to aspartate substitution, indicating that the mutant tRNA does not act by classical missense suppression. Our work is the first example of a mutation in a tRNA gene showing a prp phenotype.

Genetic suppression studies have been used successfully to identify new splicing factors. For example, SPP2 was identified as a high-copy suppressor of prp2 mutants (LAST et al. 1987 ). The genetic interaction was confirmed biochemically; SPP2 is an essential gene whose product interacts with Prp2 protein and is required prior to the first step in splicing (ROY et al. 1995 ). Genetic suppression experiments have also identified PRP16 as a suppressor of a branchpoint mutation (COUTO et al. 1987 ). SPP91-1 was initially identified as a suppressor of PRP9 (CHAPON and LEGRAIN 1992 ) and is an allele of PRP21, a gene whose product is associated with the U2 snRNP (ARENAS and ABELSON 1993 ).

Extragenic suppressors of mutations in splicing factors that affect splicing only indirectly have also been identified. SPP41, an allele of SRN1, was isolated in a screen for suppressors of prp4 (MADDOCK et al. 1994 ). The gene product of SRN1 is a negative regulator of glucose-repressed genes (TUNG et al. 1992 ) and is allelic to REG1, which encodes a regulatory subunit of protein phosphatase 1 (TU and CARLSON 1995 ). It was thought that SRN1/REG1/SPP41 suppresses the prp4 mutant by derepressing its expression (MADDOCK et al. 1994 ). Interestingly, mutations in SRN1 can suppress a prp2, prp6 double mutant (PEARSON et al. 1982 ). Another example is spp81, an allele of the DED1 gene, which encodes a putative RNA helicase (JAMIESON et al. 1991 ). Spp81 was identified as a suppressor of prp8 (JAMIESON et al. 1991 ), whose gene product is a U5-associated protein. Recent evidence, however, indicates that Ded1 is a cytoplasmic protein required for translation, and no role for Ded1 in pre-mRNA splicing has been found (CHUANG et al. 1997 ).

In our study, the suppressors of prp2-1 were mapped to the EMT1 locus, which is one of five genes encoding elongator methionine tRNAs (ASTROM et al. 1993 ). All suppressors have a T to G mutation in the anticodon, changing the anticodon from CAT, which reads the AUG methionine codon, to CAG, which reads the CUG leucine codon. The EMT1-201 mutation suppressed the in vivo splicing defect of prp2-1 cells (Figure 2). However, unlike the indirect suppressors of splicing defects described above, EMT1-201 has a splicing defect even in a wild-type background (Figure 2, Figure 3, and Figure 6). The EMT1-201 mutation could be suppressed by overexpression of tRNA^Leu (UAG), which reads the CUG leucine codon (Figure 6).

We identified the mutation in prp2-1 as Gly360 to Asp360, which is in the ATPase domain between the DEAH box (motif II) and the SAT motif (motif III). Since EMT1-201 has a mutation in a tRNA for methionine, EMT1-201 probably does not act by missense suppression of prp2-1. Although tRNA plays a role in many cellular functions in addition to translation, the mutant tRNA most likely works as an intragenic suppressor of prp2-1 by insertion of methionine at some leucine codons of prp2-1 so that the protein is active at high temperature. This model is supported by several observations. First, SENGER et al. 1992 reported that in S. cerevisiae, a methionine tRNA with a CAG anticodon could be charged with methionine by the methionyl tRNA synthetase, although with reduced efficiency relative to wild type. Second, there are six CUG leucine codons in PRP2, and two are near codon 360. Third, the Prp2 protein isolated from a prp2-1, EMT1-201 double mutant strain is more heat resistant than Prp2 from a prp2-1 single mutant strain (Figure 4A), but not as heat resistant as the wild-type Prp2 protein (Figure 4B). These data suggest that the Prp2 protein is altered in the presence of EMT1-201. EMT1-201 suppressed the prp2-1 allele but not prp2-5 or prp2-8, the two other prp2 alleles tested (data not shown). The prp2-5 mutation is not known. The prp2-8 mutation is in codon 701, a G to A mutation that causes a predicted change of aspartate to asparagine (data not shown). Presumably the substitution of methionine for leucine in the Prp2 proteins in these strains does not make them heat stable as it does in prp2-1.

Expression of one additional copy of the tRNA^Leu (UAG) gene rescues the EMT1-201 mutant (Figure 6). The tRNA^Leu(UAG) that recognizes the CUG leucine does so with a G-U wobble interaction, whereas the EMT1-201 mutant is perfectly matched with CUG, giving the mutant a competitive advantage over the endogenous tRNA^Leu (PERCUDANI et al. 1997 ). Therefore, the additional tRNA^Leu(UAG) is required to compete with the EMT1-201 tRNA for incorporation of leucine at CUG codons during translation. This result suggests that EMT1-201 could suppress prp2-1 by insertion of methionine at one or more leucine codons in the prp2-1 protein, thereby restoring its ability to function in splicing. It is also possible that misincorporation of methionine in place of leucine occurs in proteins that affect the activity or stability of the Prp2 protein.

Overexpression of EMT1-201 is lethal to wild-type yeast cells (Figure 5). Although the EMT1-201 tRNA can be charged with methionine, it is 55-fold less efficient than charging of the wild-type tRNA^Met (SENGER et al. 1992 ); therefore, overexpression of EMT1-201 may result in the presence of uncharged tRNA in the cell. Excess uncharged tRNA in the cell acts as a starvation signal and can induce the stringent response in yeast (WARNER and GORENSTEIN 1978 ). Changes in the cell during the stringent response include decreased rRNA and protein synthesis, and induction of genes specific for amino acid biosynthesis (reviewed in HINNEBUSCH 1988 ). The decrease in splicing activity in the EMT1-201 mutant, therefore, would be a nonspecific effect of the decrease in protein synthesis and increase in transcription of genes whose products are required directly for amino acid biosynthesis. In addition, uncharged tRNA is not exported efficiently from the nucleus (LUND and DAHLBERG 1998 ). The lethality caused by EMT1-201 overexpression may be due both to decreased fidelity of translation and the presence of excess uncharged EMT1-201 tRNA in the cell.

The EMT1-201 mutation confers a defect in pre-mRNA processing. HAPPEL and WINSTON 1992 identified a frameshift suppressor glycine tRNA as an extragenic suppressor of spt3, a gene whose product is involved in initiation of transcription from sequences. The glycine frameshift suppressor tRNA did not act by missense suppression of spt3, was not allele specific, and showed a transcriptional defect in an SPT background. It was not clear whether the effect of the mutant tRNA on transcription was direct or indirect, but the authors suggest that the frameshift tRNA caused defects in translation that in turn affected transcription (HAPPEL and WINSTON 1992 ).

Cells carrying the EMT1-201 allele are Cs^- and defective in pre-mRNA splicing in vivo and in vitro. Why does EMT1-201 have a prp phenotype? The rescue of the EMT1-201 mutant by overexpression of tRNA^Leu (UAG) suggests that the mutant tRNA may insert methionine into leucine codons of some splicing factors, causing them to be inactive. GUTHRIE and ABELSON 1982 reported that CUG codon usage is rare since none of 10 proteins examined used that codon. We searched for CUG codon usage among randomly selected yeast sequences including some pre-mRNA splicing factors and ribosomal proteins (data not shown). There was a greater distribution of the CUG codon in splicing factors when compared with ribosomal proteins; however, the CUG codon was also found in proteins that play a role in the cell cycle, DNA replication, and transcription. Incorporation of methionine into leucine codons in some of the splicing factors may confer the prp phenotype in EMT1-201; however, it is unlikely that CUG can be used specifically for regulating the expression of splicing factors. Nevertheless, this study provides the first example describing a mutation in a tRNA gene that leads to a splicing defect in vivo.

	FOOTNOTES

¹ Present address: Scott Department of Urology, Baylor College of Medicine, Houston, TX 77030.

	ACKNOWLEDGMENTS

We thank J. Woolford for the CRY1 DNA probe, C. Chan for the yeast genomic library and yeast strains, A. Ehsani for preparation of splicing extracts, and S.-H. Kim for providing Prp2 protein. We also acknowledge the helpful comments and suggestions by A. Bailis, T.-H. Chang, C. Greer, A. Hopper, and J. Rossi. This work was supported by U.S. Public Health Service grant GM-40639 from the National Institutes of Health.

Manuscript received January 15, 1999; Accepted for publication July 12, 1999.

	LITERATURE CITED

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

ARENAS, J. E. and J. N. ABELSON, 1993  The Saccharomyces cerevisiae PRP21 gene product is an integral component of the prespliceosome. Proc. Natl. Acad. Sci. USA 90:6771-6775[Abstract/Free Full Text].

ARENAS, J. E. and J. N. ABELSON, 1997  Prp43: an RNA helicase-like factor involved in spliceosome disassembly. Proc. Natl. Acad. Sci. USA 94:11798-11802[Abstract/Free Full Text].

ARES, M., JR. and B. WEISER, 1995  Rearrangement of snRNA structure during assembly and function of the spliceosome. Prog. Nucleic Acid Res. Mol. Biol. 50:131-159[Medline].

ÅSTRÖM, S. U., U. VON PAWEL-RAMMINGEN, and A. S. BYSTRÖM, 1993  The yeast initiator tRNA-Met can act as an elongator tRNA-Met in vivo.. J. Mol. Biol. 233:43-58[Medline].

BEGGS, J. D., 1993  Yeast protein splicing factors involved in nuclear pre-mRNA splicing. Mol. Biol. Rep. 18:99-103[Medline].

BLANTON, S., A. SRINIVASAN, and B. C. RYMOND, 1992  PRP38 encodes a yeast protein required for pre-mRNA splicing and maintenance of stable U6 small nuclear RNA levels. Mol. Cell. Biol. 12:3939-3947[Abstract/Free Full Text].

CHAPON, C. and P. LEGRAIN, 1992  A novel gene, spp91-1, suppresses the splicing defect and the pre-mRNA nuclear export in the prp9-1 mutant. EMBO J. 11:3279-3288[Medline].

CHEN, J. H. and R. J. LIN, 1990  The yeast PRP2 protein, a putative RNA-dependent ATPase, shares extensive sequence homology with two other pre-mRNA splicing factors. Nucleic Acids Res. 18:6447[Free Full Text].

CHENG, S.-C. and J. ABELSON, 1987  Spliceosome assembly in yeast. Genes Dev. 1:1014-1027[Abstract/Free Full Text].

CHRISTIANSON, T. W., R. S. SIKORSKI, M. DANTE, J. H. SHERO, and P. HIETER, 1992  Multifunctional yeast high-copy-number shuttle vectors. Gene 110:119-122[Medline].

CHUANG, R. Y., P. L. WEAVER, Z. LIU, and T. H. CHANG, 1997  Requirement of the DEAD-Box protein ded1p for messenger RNA translation. Science 275:1468-1471[Abstract/Free Full Text].

COMPANY, M., J. ARENAS, and J. ABELSON, 1991  Requirement of the RNA helicase-like protein PRP22 for release of messenger RNA from spliceosomes. Nature 349:487-493[Medline].

COUTO, J. R., J. TAMM, R. PARKER, and C. GUTHRIE, 1987  A trans-acting suppressor restores splicing of a yeast intron with a branch point mutation. Genes Dev. 1:445-455[Abstract/Free Full Text].

FRANK, D., B. PATTERSON, and C. GUTHRIE, 1992  Synthetic lethal mutations suggest interactions between U5 small nuclear RNA and four proteins required for the second step of splicing. Mol. Cell. Biol. 12:5197-5205[Abstract/Free Full Text].

FUJIMURA, H.-A. and Y. SAKUMA, 1993  Simplified isolation of chromosomal and plasmid DNA from yeasts. Biotechniques 14:538-539[Medline].

GUTHRIE, C., 1991  Messenger RNA splicing in yeast: clues to why the spliceosome is a ribonucleoprotein. Science 253:157-163[Abstract/Free Full Text].

GUTHRIE, C., and J. ABELSON, 1982 Organization and expression of tRNA genes in Saccharomyces cerevisiae, pp. 487–528 in The Molecular Biology of the Yeast Saccharomyces: Metabolism and Gene Expression, edited by J. N. STRATHERN, E. W. JONES and J. R. BROACH. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

HAPPEL, A. M. and F. WINSTON, 1992  A mutant tRNA affects -mediated transcription in Saccharomyces cerevisiae.. Genetics 132:361-374[Abstract].

HARTWELL, L. H., 1967  Macromolecule synthesis in temperature-sensitive mutants of yeast. J. Bacteriol. 93:1662-1670[Abstract/Free Full Text].

HINNEBUSCH, A. G., 1988  Mechanisms of gene regulation in the general control of amino acid biosynthesis in Saccharomyces cerevisiae.. Microbiol. Rev. 52:248-273[Free Full Text].

HUFFAKER, T. C., M. A. HOYT, and D. BOTSTEIN, 1987  Genetic analysis of the yeast cytoskeleton. Annu. Rev. Genet. 21:259-284[Medline].

JAMIESON, D. J., B. RAHE, J. PRINGLE, and J. D. BEGGS, 1991  A suppressor of a yeast splicing mutation (prp8-1) encodes a putative ATP-dependent RNA helicase. Nature 349:715-717[Medline].

KIM, S. H. and R. J. LIN, 1993  pre-mRNA splicing within an assembled yeast spliceosome requires an RNA-dependent ATPase and ATP hydrolysis. Proc. Natl. Acad. Sci. USA 90:888-892[Abstract/Free Full Text].

KIM, S.-H. and R. J. LIN, 1996  Spliceosome activation by PRP2 ATPase prior to the first transesterification reaction of pre-mRNA splicing. Mol. Cell. Biol. 16:6810-6819[Abstract].

KIM, S. H., J. SMITH, A. CLAUDE, and R. J. LIN, 1992  The purified yeast pre-mRNA splicing factor PRP2 is an RNA-dependent NTPase. EMBO J. 11:2319-2326[Medline].

KING, D. S. and J. D. BEGGS, 1990  Interactions of PRP2 protein with pre-mRNA splicing complexes in Saccharomyces cerevisiae.. Nucleic Acids Res. 18:6559-6564[Abstract/Free Full Text].

KRÄMER, A., 1996  The structure and function of proteins involved in mammalian pre-mRNA splicing. Annu. Rev. Biochem. 65:367-409[Medline].

LAGGERBAUER, B., T. ACHSEL, and R. LUHRMANN, 1998  The human U5-200kD DEXH-box protein unwinds U4/U6 RNA duplices in vitro. Proc. Natl. Acad. Sci. USA 95:4188-4192[Abstract/Free Full Text].

LAST, R. L., J. R. MADDOCK, and J. L. WOOLFORD, JR., 1987  Evidence for related functions of the RNA genes of Saccharomyces cerevisiae.. Genetics 117:619-631[Abstract/Free Full Text].

LAUBER, J., P. FABRIZIO, S. TEIGELKAMP, W. S. LANE, and E. HARTMANN et al., 1996  The HeLa 200 kDa U5 snRNP-specific protein and its homologue in Saccharomyces cerevisiae are members of the DEXH-box protein family of putative RNA helicases. EMBO J. 15:4001-4015[Medline].

LIAO, X. C., J. TANG, and M. ROSBASH, 1993  An enhancer screen identifies a gene that encodes the yeast U1 snRNP A protein: implications for snRNP protein function in pre-mRNA splicing. Genes Dev. 7:419-428[Abstract/Free Full Text].

LIN, J. and J. J. ROSSI, 1996  Identification and characterization of yeast mutants that overcome an experimentally introduced block to splicing at the 3' splice site. RNA 2:835-848[Abstract].

LIN, R. J., A. J. LUSTIG, and J. ABELSON, 1987  Splicing of yeast nuclear pre-mRNA in vitro requires a functional 40S spliceosome and several extrinsic factors. Genes Dev. 1:7-18[Abstract/Free Full Text].

LIN, R. J., D.-H. KIM, D. CASTANOTTO, S. WESTAWAY and J. J. ROSSI, 1996 RNA preparations from yeast cells, pp. 43–50 in A Laboratory Guide to RNA: Isolation, Analysis, and Synthesis, edited by P. A. KRIEG. Wiley-Liss, Inc., New York.

LUND, E. and J. E. DAHLBERG, 1998  Proofreading and aminoacylation of tRNAs before export from the nucleus. Science 282:2082-2085[Abstract/Free Full Text].

LUSTIG, A. J., R. J. LIN, and J. ABELSON, 1986  The yeast RNA gene products are essential for mRNA splicing in vitro. Cell 47:953-963[Medline].

MADDOCK, J. R., E. M. WEIDENHAMMER, C. C. ADAMS, R. L. LUNZ, and J. L. WOOLFORD, JR., 1994  Extragenic suppressors of Saccharomyces cerevisiae prp4 mutations identify a negative regulator of PRP genes. Genetics 136:833-847[Abstract].

MADDOCK, J. R., J. ROY, and J. L. WOOLFORD, JR., 1996  Six novel genes necessary for pre-mRNA splicing in Saccharomyces cerevisiae.. Nucleic Acids Res. 24:1037-1044[Abstract/Free Full Text].

MOORE, M. J., C. C. QUERY and P. A. SHARP, 1993 Splicing of precursors to mRNA by the spliceosome, pp. 303–357 in The RNA World, edited by R. F. GESTELAND and J. F. ATKINS. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

NILSEN, T. W., 1998 RNA-RNA interactions in nuclear pre-mRNA splicing, pp. 279–307 in RNA Structure and Function, edited by R. W. SIMONS and M. GRUNBERG-MANAGO. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

NOBLE, S. M. and C. GUTHRIE, 1996  Identification of novel genes required for yeast pre-mRNA splicing by means of cold-sensitive mutations. Genetics 143:67-80[Abstract].

O'DAY, C. L., G. DALBADIE-MCFARLAND, and J. ABELSON, 1996  The Saccharomyces cerevisiae Prp5 protein has RNA-dependent ATPase activity with specificity for U2 small nuclear RNA. J. Biol. Chem. 271:33261-33267[Abstract/Free Full Text].

ORR-WEAVER, T. L., J. W. SZOSTAK, and R. J. ROTHSTEIN, 1981  Yeast transformation: a model system for the study of recombination. Proc. Natl. Acad. Sci. USA 78:6354-6358[Abstract/Free Full Text].

PEARSON, N. J., P. C. THORBURN, and J. E. HABER, 1982  A suppressor of temperature-sensitive rna mutations that affect mRNA metabolism in Saccharomyces cerevisiae.. Mol. Cell. Biol. 2:571-577[Abstract/Free Full Text].

PERCUDANI, R., A. PAVESI, and S. OTTONELLO, 1997  Transfer RNA gene redundancy and translational selection in Saccharomyces cerevisiae.. J. Mol. Biol. 268:322-330[Medline].

PLUMPTON, M., M. MCGARVEY, and J. D. BEGGS, 1994  A dominant negative mutation in the conserved RNA helicase motif `SAT' causes splicing factor PRP2 to stall in spliceosomes. EMBO J. 13:879-887[Medline].

ROSE, M. D., F. WINSTON and P. HIETER, 1990 Methods in Yeast Genetics: A Laboratory Course Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

ROY, J., K. KIM, J. R. MADDOCK, J. G. ANTHONY, and J. L. WOOLFORD, JR., 1995  The final stages of spliceosome maturation require Spp2p that can interact with the DEAH box protein Prp2p and can promote step 1 of splicing. RNA 1:375-390[Abstract].

RUBY, S. W. and J. ABELSON, 1991  Pre-mRNA splicing in yeast. Trends Genet. 7:79-85[Medline].

RYMOND, B. C., and M. ROSBASH, 1992 Yeast pre-mRNA splicing, pp. 143–192 in The Molecular and Cellular Biology of the Yeast Saccharomyces cerevisiae: Gene Expression, edited by J. R. PRINGLE, E. W. JONES and J. R. BROACH. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

SCHWER, B. and C. H. GROSS, 1998  Prp22, a DExH-box RNA helicase, plays two distinct roles in yeast pre-mRNA splicing. EMBO J. 17:2086-2094[Medline].

SCHWER, B. and C. GUTHRIE, 1991  PRP16 is an RNA-dependent ATPase that interacts transiently with the spliceosome. Nature 349:494-499[Medline].

SENGER, B., L. DESPONS, P. WALTER, and F. FASIOLO, 1992  The anticodon triplet is not sufficient to confer methionine acceptance to a transfer RNA. Proc. Natl. Acad. Sci. USA 89:10768-10771[Abstract/Free Full Text].

SERAPHIN, B. and M. ROSBASH, 1989  Identification of functional U1 snRNA-pre-mRNA complexes committed to spliceosome assembly and splicing. Cell 59:349-358[Medline].

SHARP, P. A., 1994  Split genes and RNA splicing. Cell 77:805-815[Medline].

SIKORSKI, R. S. and P. HIETER, 1989  A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.. Genetics 122:19-27[Abstract/Free Full Text].

STALEY, J. P. and C. GUTHRIE, 1998  Mechanical devices of the spliceosome: motors, clocks, springs, and things. Cell 92:315-326[Medline].

STRAUSS, E. J. and C. GUTHRIE, 1991  A cold-sensitive mRNA splicing mutant is a member of the RNA helicase gene family. Genes Dev. 5:629-641[Abstract/Free Full Text].

TU, J. and M. CARLSON, 1995  REG1 binds to protein phosphatase type 1 and regulates glucose repression in Saccharomyces cerevisiae.. EMBO J. 14:5939-5946[Medline].

TUNG, K. S., L. L. NORBECK, S. L. NOLAN, N. S. ATKINSON, and A. K. HOPPER, 1992  SRN1, a yeast gene involved in RNA processing, is identical to HEX2/REG1, a negative regulator in glucose repression. Mol. Cell. Biol. 12:2673-2680[Abstract/Free Full Text].

VIJAYRAGHAVAN, U., M. COMPANY, and J. ABELSON, 1989  Isolation and characterization of pre-mRNA splicing mutants of Saccharomyces cerevisiae.. Genes Dev. 3:1206-1216[Abstract/Free Full Text].

WAGNER, J. D. O., E. JANKOWSKY, M. COMPANY, A. M. PYLE, and J. N. ABELSON, 1998  The DEAH-box protein PRP22 is an ATPase that mediates ATP-dependent mRNA release from the spliceosome and unwinds RNA duplexes. EMBO J. 17:2926-2937[Medline].

WANG, Y., J. D. O. WAGNER, and C. GUTHRIE, 1998  The DEAD-box splicing factor Prp16 unwinds RNA duplexes in vitro. Curr. Biol. 8:441-451[Medline].

WARNER, J. R. and C. GORENSTEIN, 1978  Yeast has a true stringent response. Nature 275:338-339[Medline].

WELLS, S. E., M. NEVILLE, M. HAYNES, J. WANG, and H. IGEL et al., 1996  CUS1, a suppressor of cold-sensitive U2 snRNA mutations, is a novel yeast splicing factor homologous to human SAP 145. Genes Dev. 10:220-232[Abstract/Free Full Text].

WILL, C. L. and R. LÜHRMANN, 1997  Protein functions in pre-mRNA splicing. Curr. Opin. Cell Biol. 9:320-328[Medline].

XU, D., S. NOURAINI, D. FIELD, S. J. TANG, and J. D. FRIESEN, 1996  An RNA-dependent ATPase associated with U2/U6 snRNAs in pre-mRNA splicing. Nature 381:709-713[Medline].

XU, D., D. J. FIELD, S. J. TANG, A. MORIS, and B. P. BOBECHKO et al., 1998  Synthetic lethality of yeast slt mutations with U2 small nuclear RNA mutations suggests functional interactions between U2 and U5 snRNPs that are important for both steps of pre-mRNA splicing. Mol. Cell. Biol. 18:2055-2066[Abstract/Free Full Text].

This article has been cited by other articles:

				D.-H. Kim, M.-A. Langlois, K.-B. Lee, A. D. Riggs, J. Puymirat, and J. J. Rossi HnRNP H inhibits nuclear export of mRNA containing expanded CUG repeats and a distal branch point sequence Nucleic Acids Res., July 15, 2005; 33(12): 3866 - 3874. [Abstract] [Full Text] [PDF]

				Y. Kimata and M. Yanagida Suppression of a mitotic mutant by tRNA-Ala anticodon mutations that produce a dominant defect in late mitosis J. Cell Sci., May 1, 2004; 117(11): 2283 - 2293. [Abstract] [Full Text] [PDF]