- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Zhang, Y. Q.
- Articles by Ashburner, M.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Zhang, Y. Q.
- Articles by Ashburner, M.
stress sensitive B Encodes an Adenine Nucleotide Translocase in Drosophila melanogaster
Yong Q. Zhang1,a, John Rootea, Saverio Brognaa, Andrew W. Davis2,a, Daniel A. Barbasha, David Nashb, and Michael Ashburneraa Department of Genetics, University of Cambridge, Cambridge CB2 3EH, England
b Department of Biological Sciences, University of Alberta, Edmonton, Alberta T6G 2E9, Canada
Corresponding author: Michael Ashburner, Department of Genetics, University of Cambridge, Downing St., Cambridge CB2 3EH, England., ma11{at}gen.cam.ac.uk (E-mail)
Communicating editor: V. G. FINNERTY
| ABSTRACT |
|---|
Adenine nucleotide translocases (ANT) are required for the exchange of ADP and ATP across the inner mitochondrial membrane. They are essential for life, and most eukaryotes have at least two different Ant genes. Only one gene had been described from Drosophila, and this had not been characterized genetically. We show that mutations in this gene correspond to the previously described loci, sesB and l(1)9Ed. Immediately adjacent to this gene is another encoding a second ANT protein, which has 78% identity to that encoded by sesB/l(1)9Ed. These two genes are transcribed from a common promoter, and their mRNAs are produced by differential splicing. Hutter and Karch suggested that the sesB ANT gene corresponded to Hmr, a gene identified by an allele that rescues otherwise inviable interspecific hybrids between Drosophila melanogaster and its sibling species. This hypothesis is not supported by our study of the ANT genes of D. melanogaster.
HYBRIDS between Drosophila melanogaster and its sibling species, D. simulans, D. mauritiana, and D. sechellia, are either sterile or inviable. Male hybrids from crosses between D. melanogaster females and sibling species males die as late larvae or early pupae, while female hybrids from the reciprocal crosses die as embryos. Mutations or strains of D. melanogaster and D. simulans that rescue either the embryonic or the larval/pupal lethality of interspecific hybrids have been characterized. One of these is Hybrid male rescue (Hmr), a mutation of D. melanogaster that rescues to viability otherwise inviable male hybrids from the cross of D. melanogaster females to sibling species males (![]()
![]()
![]()
![]()
![]()
![]()
![]()
sesB is one of a series of stress-sensitive mutants (sesAsesH) characterized by Homyk (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
| MATERIALS AND METHODS |
|---|
Stocks and chromosomes:
sesB1 was obtained from T. Homyk and l(1)DC701 (sesB9Ed-6) from N. Perrimon. l(1)A17 (sesB9Ed-1), l(1)G16 (sesB9Ed-2), l(1)H22 (sesB9Ed-3), l(1)M27 (sesB9Ed-4), l(1)Q10 (sesB9Ed-5), l(1)H6 (rasl17), l(1)J5 (rasl19), l(1)E20 (l(1)9Ec2), and l(1)G4 (l(1)9Ec3), as well as the chromosome aberrations Df(1)ras59 and Df(1)RJ7, were from the Edmonton collection. Both the sesB9Ed-1 and sesB9Ed-2 chromosomes carried extraneous X-linked lethal mutations; that from sesB9Ed-2 was removed by recombination. ![]()
![]()
![]()
![]()
A new sesB allele, sesB6, was isolated from a P-element screen for lethal mutations on In(1)AB in which P{ry+t7.2=HBDelta-23}9E (from the Bloomington Stock Center) was mobilized; the chromosomes were screened for lethals against Df(1)HC133.
Crosses:
All crosses were done at 25°, unless stated otherwise, and flies were reared on standard yeast-cornmeal medium. Care was taken to ensure that all eclosed flies were scored when scoring lethal complementation tests.
Cytology:
Polytene chromosome cytology was performed on propionic carmine-orcein squash preparations of salivary gland chromosomes, which were interpreted using the revised maps of Bridges (see ![]()
Bang-sensitivity assay:
Bang sensitivity was assayed essentially according to ![]()
Clones:
Cosmid 152F6 was obtained from the European Drosophila Mapping Consortium (![]()
DNA sequencing:
The sequence of the wild-type ANT genes was determined from cosmid 152F6. Mutant alleles were sequenced from adult genomic DNA PCR products amplified with Vent DNA polymerase (New England Biolabs, Beverly, MA). For the sequencing of sesB, PCR reactions were done with primers S5 and S3, corresponding to the nucleotides 51685187 and 62706291, respectively, of the sequence EMBL:Y10618 (all sequence coordinates are with respect to this record). The PCR products were cloned into pBluescript by PCR-introduced HindIII and XhoI sites in S5 and S3, respectively. Commercial forward and reverse primers for pBluescript and a synthesized internal primer, SM (nucleotides 54645484), were used for sequencing the full-length coding region of sesB.
To sequence the gene immediately distal to sesB (Ant2), two primers flanking the coding region were designed, SU (nucleotides 72917308) and SD (nucleotides 86468664). PCR products were cloned in pBluescript by primer-introduced EcoRI and XbaI sites. Two internal primers, S (nucleotides 77977817) and 2.8A (nucleotides 78237842), were used to obtain the full sequence of the 1.4-kb EcoRI-XbaI fragment.
To sequence the P-element insertion associated with sesB6, we used a protocol and primers designed for the PZ vector (![]()
The breakpoints of two chromosome aberrations were sequenced by inverse PCR. To sequence the distal breakpoint of In(1)AB, DNA from a homozygous stock was digested with PstI, ligated, and amplified with primers corresponding to (1) the reverse complement of Y10681:75147533 (AB1) and (2) bases 88308849 of this sequence (AB2). The 0.5-kb PCR fragment was purified and sequenced. DNA was prepared from Df(1)v64f/FM7 females, digested with EcoRI, ligated, and amplified with primer AB1 and one corresponding to bases 1025010270 of Y10168. The expected 0.8-kb band was gel purified and sequenced (amplification from the balancer chromosome gave the expected 1.7-kb product).
Sequencing was performed by using an ABI PRISM Dye Terminator Cycle Sequencing Ready Reaction Kit (Perkin Elmer, Norwalk, CT) and an ABI 377 sequencer (Applied Biosystems, Foster City, CA).
Sequence analysis:
General sequence analyses were done with the GCG package running on a Silicon Graphics workstation on the University of Cambridge Molecular Biology server. Sequence alignments were done using CLUSTAL W (version 1.74) from the EBI server (http://www2.ebi.ac.uk/clustalw/), and gene trees were built using the PHYLIP package (version 3.5c; ![]()
Rapid amplification of cDNA ends:
Drosophila cDNA libraries were the gift of N. Brown. Adenine nucleotide translocase cDNA ends were amplified with one primer homologous to the vector pNB40 (GGTGACACTATAGAATACAAG for 5'-end amplification, TTAATGCAGCTGGCTTATCG for 3'-end amplification) and another homologous to an internal sequence of the adenine nucleotide translocase cDNA. For the amplification of the 5' ends of sesB, a vector primer and primer Rb (complementary to the nucleotides 54425460) were used. The 3' ends of sesB were amplified with a vector primer and primer Ra (nucleotides 51915210), introducing a BamHI site just before the initiation codon ATG. For the amplification of the 3' ends of Ant2, primer 2.8A (described above) was used. For the amplification of the 5' end of Ant2, primers corresponding to nucleotides 73937413 and 74277444 were used.
Germline transformation:
The genomic transformation construct was made as follows: The 10.3-kb EcoRI-HindIII fragment (see Fig 2) was cloned into pP{CaSper-hs}. This plasmid, pP{Ant2+ sesB+10.3} (at 1 µg/µl), was coinjected with plasmid pHS
2-3 (at 0.5 µg/µl) in Spradling buffer into embryos from a y w strain.
|
|
General molecular methods:
General methods for handling nucleic acids were according to protocols in ![]()
![]()
Sequence data:
The genomic sequence is deposited in the EMBL Nucleic Acid Sequence Data Library under accession no. Y10618. The sequences across the breakpoints of Df(1)v64f and In(1)AB are deposited as EMBL:AJ236836 and EMBL:AJ236835, respectively. We also used the two existing cDNA sequences of sesB, those of ![]()
![]()
The expressed sequence tag (EST) sequence data of the Berkeley Drosophila Genome Project (BDGP) have been very useful. These partial cDNA clone sequences have been computationally clustered into "clots" on the basis of their sequence overlaps. These clots are available from http://www.fruitfly.org/EST/. The sequence of any one clot is not necessarily stable; it may change as new EST sequences are analyzed. Moreover, at the moment, there is not any stable way to refer to a particular clot sequence. We refer to them by the name of one of their constituent clones, and this will ensure that the latest version of any particular clot can be recovered by this clone name. We have also archived the clot sequences recovered from the Berkeley server for analysis on April 11, 1998, and these are available on request from M.A. For the ANT genes, there were three EST clots on this date. These are consensus sequence 1 (represented by clone GM13259.5', EMBL:AA803475), a 700-bp sequence of only one clone; consensus sequence 2 (represented by GM14781.5', EMBL:AA821173), a 550-bp consensus of four clones; and consensus sequence 3 (represented by LD14425.5', EMBL:AA439770), a 1500-bp consensus of 59 different EST clones.
| RESULTS |
|---|
This study began with the working hypothesis that the two mutations known to rescue the lethality of interspecific hybrids between D. melanogaster and its sibling species, Hmr and In(1)AB, were allelic (see ![]()
![]()
![]()
![]()
![]()
Hmr maps distal to the distal In(1)AB breakpoint:
![]()
![]()
![]()
sesB maps proximal to the distal breakpoint of In(1)AB and corresponds to l(1)9Ed:
There have been several screens for lethal mutations mapping to region 9-10 of the X chromosome in addition to several mutations recovered by Lefevre (![]()
![]()
![]()
![]()
![]()
![]()
|
Cytologically, the distal breakpoint of In(1)AB maps to 9E7-8. We place sesB at the same cytogenetic position, not only from the molecular mapping of this inversion breakpoint (![]()
![]()
The sesB phenotypes:
A total of 13 mutant alleles of sesB have been described (data from FlyBase), although we have been able to find only 7 now remaining in stock. Of the original 13, 11 were recovered as X-linked lethal mutations and 2 as viables with a stress-sensitive phenotype (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
We have examined eight sesB alleles. Three of these, sesB9Ed-2 (G16), sesB9Ed-4 (M27), and sesB9Ed-5 (Q10), were described by ![]()
![]()
sesB encodes an adenine nucleotide translocase:
The facts that the sesB locus maps proximal to the distal breakpoint of In(1)AB and that this breakpoint maps just distal to the 3' end of genes encoding an adenine nucleotide translocase (see below) led us to examine whether or not the sesB mutations mapped to the Ant translocase genes. This was done both by sequencing the gene from four mutant alleles and by transformation rescue of the mutant phenotypes.
To avoid the introduction of errors during PCR reactions, multiple PCR products amplified with the high-fidelity polymerase Vent were cloned independently, and several clones were sequenced. Three EMS-induced alleles sequenced showed substitutions in sesB. For sesB1, all six sequenced clones (from three independent PCR reactions) showed a missense mutation in codon 289, CTT to TTT, which would result in a leucine-to-phenylalanine substitution in the putative sixth transmembrane domain of the protein. L289 is conserved in 30/35 available adenine nucleotide translocase sequences; the exceptional five are all from yeasts. The lethal allele sesB9Ed-1 has an alanine-to-threonine missense mutation in codon 144, GCT to ACT (seven clones from two independent PCR reactions were sequenced, and four of them showed the mutation; as the DNA amplified was from a balanced stock, this is expected). A144 is conserved in 34/35 available adenine nucleotide translocase sequences [curiously, the exception is the protein from another insect, Anopheles gambiae (![]()
![]()
The insertion site of the P element in the newly induced P-element allele, sesB6, was also sequenced (see MATERIALS AND METHODS). The P element is inserted in the first intron (between nucleotides 3917 and 3919) of sesB/Ant2, with the element in the opposite orientation to sesB/Ant2. In addition to the deletion of nucleotide 3918 of sesB, this insertion is associated with 47 bp of unidentified sequence between the sesB sequence and the 3' end of the P element, as well as 58 bp of unidentified sequence between sesB and the 5' end of the P element.
Transformation rescue:
A 10.3-kb EcoRI-HindIII genomic DNA fragment (cloned in pP{CaSper-hs}) that contains the entire adenine nucleotide translocase gene as well as its distal relative (Fig 2; see below) was transformed. Two independent insertions, P{Ant2+ sesB+10.3}42A and P{Ant2+ sesB+10.3}102E, were recovered. Both rescue the male lethality of lethal alleles of sesB (Table 2) and the stress-sensitive and hypoactive phenotypes of sesB1 and sesB9Ed-4.
|
Taken together, the sequencing and transformation rescue data unambiguously show that mutations in the adenine nucleotide translocase are responsible for both the behavioral and lethal sesB phenotypes.
Transformants for sesB do not affect interspecific hybrid viability:
![]()
![]()
|
A second adenine nucleotide translocase-like gene is contiguous to sesB:
Both ![]()
![]()
![]()
|
The relationship between Ant2 and sesB:
Despite their sequence similarity, sesB and Ant2 appear to be functionally distinct. The two genes cannot, of course, be fully functionally redundant; otherwise, the frequent recovery of lethal mutations by EMS in sesB would not be possible. We have sequenced Ant2 in four sesB alleles (sesB1, sesB9Ed-1, sesB9Ed-3, and sesB9Ed-5) and found no amino-acid substitutions in these.
Df(1)v64f ends within the 3'-untranslated region of sesB, removing the 5' untranslated exon of Ant2 but not affecting the Ant2-coding region. The viabilities of sesB alleles, when heterozygous with this deletion, are similar to those seen when they are heterozygous for the longer deletion Df(1)HC133, which removes both sesB and Ant2 in their entirety (Table 1).
The distal breakpoint of In(1)AB was also mapped by Southern blot hybridization; it is in the distal part of the 1.8-kb XbaI-PstI fragment (see Fig 2). The breakpoint was sequenced by inverse PCR and was found to be 314 bp 3' to the end of the Ant2 transcript (at position 9288 on EMBL:Y10618). In(1)AB is fully viable when heterozygous with deletions of this chromosome region or when homozygous. The synthetic deletion Df(1)AC2LABR, which extends distally from the In(1)AB distal breakpoint, is completely viable when heterozygous with lethal alleles of sesB (Table 1). The distal breakpoint of Df(1)v64f was also determined by inverse PCR; it is at position 7033 on the sequence EMBL:Y10618, i.e., in the short "intergenic" region between sesB and Ant2.
The structure of the two ANT genes and their expression:
Comparison of cDNA and genomic sequences show that sesB has two alternative transcription starts, and that each transcript is interrupted by an intron in its 5' UTR (Fig 2). The coding region of sesB is interrupted by small introns within codons 99 and 142. The genomic structure of the coding region of Ant2 is similar to that of sesB, with two introns interrupting at positions identical to those within the coding sequence of sesB. The cDNAs previously sequenced by ![]()
![]()
![]()
![]()
No cDNA of Ant2 was recovered in our screens of cDNA libraries. The BDGP EST collection, however, includes a partial 5' cDNA of this gene, GM13259.5' (the fact that there was only one cDNA of Ant2 vs. 63 for sesB gives some clue as to the relative abundance of Ant2 and sesB transcripts). Bases 76700 of GM13259.5' match the corresponding region of the predicted Ant2 cDNA sequence with only five base mismatches. We were puzzled to find that the first 75 bp of the GM13259.5' sequence matched no sequence in the 1.1-kb sesB-Ant2 intergenic region, where the Ant2 promoter might reasonably be expected to be found. Remarkably, a sequence with 100% identity to these first 75 bp is found in the 5' untranslated exon sequence of the distal sesB transcript (see Fig 2). We conclude that sesB and Ant2 are transcribed from the same promoter and share a common 5' untranslated exon. The dicistronic structure of the 5' end of this transcript was confirmed by PCR amplification of the predicted sequence from an imaginal disc cDNA library (see MATERIALS AND METHODS and legend to Fig 2).
Using a 4.4-kb genomic EcoRI fragment containing Ant2 and the 3' end of sesB, two major transcripts of 1.6 and 1.2 kb are seen in the Northern blots (see also ![]()
![]()
![]()
|
The two transcripts seen by the Northern blot analysis result, at least in part, from the alternative 3' ends of sesB, as shown by RACE analysis of sesB cDNAs. Only a single 450-bp product was found from the amplification of the 5' end of sesB cDNA, but two products of 1.1 and 1.6 kb were found from amplification of the 3' end (Fig 5). All three RACE bands were sequenced, producing the expected results. When used as a probe to a Northern blot, the 1.6-kb RACE product only hybridizes to the 1.6-kb transcript.
|
| DISCUSSION |
|---|
The relationship between adenine nucleotide translocase and interspecific hybrid lethality rescue:
This study began with the working hypothesis (![]()
ANT genes in D. melanogaster:
We show that there are two genes in D. melanogaster encoding proteins very similar in sequence to the adenine nucleotide translocases of other metazoa. These genes are in a tandem array, and the terminator codon of sesB and the initiator ATG codon of Ant2 are separated by only 1104 bp. They show similarities not only in sequence, but also in intron/exon structure, suggesting that they arose from a single gene by an event such as unequal exchange. There is no evidence, e.g., from Southern blot hybridization or in situ hybridization to polytene chromosomes, of any more genes similar in sequence in the genome of D. melanogaster (see ![]()
![]()
In the majority of examples of tandemly duplicated genes, each gene is transcribed independently. This is not the case for Adh and Adhr, which are transcribed as a functional dicistronic mRNA, with internal translation initiation required for the synthesis of the ADHR protein (![]()
![]()
![]()
There are two genes known in Caenorhabditis elegans with an organization similar to that of sesB and Ant2. One is the unc-60 locus, which encodes two actin-binding proteins that are 38% identical in amino-acid sequence. Both genes, unc-60A and unc-60B, share a common 5' untranslated exon, and the former gene is entirely contained within the first intron of the latter (![]()
![]()
![]()
![]()
![]()
![]()
Fig 6 is an alignment of the Drosophila ANT proteins with those sequenced from a variety of animals (those of algae and plants are very clearly related, but they form a distinct sequence subfamily). Many other organisms, such as D. melanogaster, have two (or more) ANT genes. A gene tree of these, constructed by DRAWTREE, is shown in Fig 7. In mammals, there are usually three different functional ANT genes encoding proteins with 8889% amino-acid sequence identity. These show differential tissue expression (![]()
![]()
|
|
Adenine nucleotide translocases are members of a larger family of mitochondrial carrier proteins that are located in the inner mitochondrial membrane (![]()
![]()
![]()
-helical transmembrane regions (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Adenine nucleotide translocase is the most abundant integral protein of the inner mitochondrial membrane (![]()
![]()
![]()
The sesB phenotypes and ANT:
Stress- or bang-sensitive phenotypes are quite common in D. melanogaster, since they are easily recovered in screens, especially if X-linked; at least 21 loci with alleles showing this phenotype have been described (![]()
![]()
![]()
![]()
Four other bang-sensitive mutants have already been identified molecularly, tko, eas, stn, and Atp
. technical knockout (tko) encodes a protein homologous to the prokaryotic ribosome protein S12; this is presumably a mitochondrial ribosomal protein in Drosophila (![]()
![]()
![]()
![]()
![]()
![]()
) have a bang-sensitive phenotype (![]()
It is interesting that two genes with bang-sensitive mutant phenotypes, tko and sesB, encode mitochondrial proteins. The bang-sensitive alleles show other similarities, e.g., delayed development, but they differ behaviorally, e.g., tko25t, but not sesB1, shows hyperexcitability during recovery from stress-induced paralysis. For both of these genes and for stn (originally recovered as sesC), viable bang-sensitive mutations are relatively rare, and most alleles are lethal.
| FOOTNOTES |
|---|
1 Present address: Department of Biology, University of Utah, 257 South 1400 East, Salt Lake City, UT 84112. ![]()
2 Present address: Webster University, Science Department, 470 E. Lockwood Ave., St. Louis, MO 63119-3185. ![]()
| ACKNOWLEDGMENTS |
|---|
We thank Pierre Hutter for his encouragement to start this work and for clones. We also thank Igor Zhimulev, Norbert Perrimon, and Kathy Matthews of the Bloomington Drosophila Stock Center for stocks. We thank Carol McKimmie for making the transformants, and our colleagues Darin Coulson, Tim Fergestad, Glynnis Johnson, Terri Morley, Esther Betran, Simon Collier, Siegrun Herrmann, and Steve Russell for both practical help and discussion. We are most grateful to Suzanna Lewis of the Berkeley Drosophila Genome Project for her help, as well as Howy Jacobs and Julie Ahringer for stimulating discussions. This work was supported by a Biotechnology and Biological Science Research Council Project Grant to M.A. S.B. was also supported by grants from the European Union, D.A.B. was supported by a National Science Foundation/Sloan Foundation Fellowship and Y.Q.Z. by a grant to M.A., D. M. Glover, and R. D. C. Saunders from the Medical Research Council. D.N. was supported by the National Science and Engineering Research Council (Canada, grant no. A3269).
Manuscript received March 31, 1999; Accepted for publication July 2, 1999.
| LITERATURE CITED |
|---|
AHRINGER, J., 1995 Embryonic tissue differentiation in Caenorhabditis elegans requires dif-1, a gene homologous to mitochondrial solute carriers. EMBO J. 14:2307-2316[Medline].
ALFONSO, A., K. GRUNDAHL, J. R. MCMANUS, J. M. ASBURY, and J. B. RAND, 1994 Alternative splicing leads to two cholinergic proteins in Caenorhabditis elegans.. J. Mol. Biol. 241:627-630[Medline].
ANDERSSON, S. G. E., A. ZOMORODIPOUR, J. O. ANDERSSON, T. SICHERITZ-PONTEN, and U. C. M. ALSMARK et al., 1998 The genome sequence of Rickettsia prowazekii and the origin of mitochondria. Nature 396:133-140[Medline].
ANDREWS, J., M. SMITH, J. MERAKOVSKY, M. COULSON, and F. HANNAN et al., 1996 The stoned locus of Drosophila melanogaster produces a dicistronic transcript and encodes two distinct polypeptides. Genetics 143:1699-1711[Abstract].
ASHBURNER, M., 1989 Drosophila. A Laboratory Handbook. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
BEARD, C. B., A. E. CREWS-OYEN, V. K. KUMAR, and F. H. COLLINS, 1994 A cDNA encoding an ADP/ATP carrier from the mosquito Anopheles gambiae.. Insect Mol. Biol. 3:35-40[Medline].
BAILLEUL, B., I. AKERBLOM, and A. D. STROSBERG, 1997 The leptin receptor promoter controls expression of a second distinct protein. Nucleic Acids Res. 25:2752-2758
BENZER, S., 1971 From the gene to behavior. J. Am. Med. Assoc. 218:1015-1022
BERRARD, S., H. VAROQUI, R. CERVINI, M. ISRAËL, and J. MALLET et al., 1995 Coregulation of two embedded gene products, choline acetyltransferase and the vesicular acetylcholine transporter. J. Neurochem. 65:939-942[Medline].
BLUMENTHAL, T., 1998 Gene clusters and polycistronic transcription in eukaryotes. Bioessays 20:480-487[Medline].
BROGNA, S. and M. ASHBURNER, 1997 The Adh-related gene of Drosophila melanogaster is expressed as a functional dicistronic messenger RNA: multigenic transcription in higher organisms. EMBO J. 16:2023-2031[Medline].
CHAN, H. Y. E., Y. ZHANG, J. D. HOHEISEL, and C. J. O'KANE, 1998 Identification and characterisation of the gene for Drosophila L3 ribosomal protein. Gene 212:119-125[Medline].
DIMAURO, S., E. BONILLA, C. P. LEE, D. L. SCHOTLAND, and A. SCARPA et al., 1976 Luft's disease: further biochemical and ultrastructural studies of skeletal muscle in the second case. J. Neurol. Sci. 27:217-232[Medline].
ERICKSON, J. D., H. VAROQUI, M. K.-H. SCHÄFER, W. MODI, and M.-F. DIEBLER et al., 1994 Functional identification of a vesicular acetylcholine transporter and its expression from a "cholinergic" gene locus. J. Biol. Chem. 269:21929-21932
FELSENSTEIN, J., 1988 Phylogenies from molecular sequences: inference and reliability. Annu. Rev. Genet. 22:521-565[Medline].
FLYBASE, 1999 http://flybase.bio.indiana.edu/
GANETZKY, B. and C. F. WU, 1982 Indirect suppression involving behavioral mutants with altered nerve excitability in Drosophila melanogaster.. Genetics 100:597-614
GRAHAM, B. H., K. G. WAYMIRE, B. COTTRELL, I. A. TROUNCE, and G. R. MACGREGOR et al., 1997 The mouse model for mitochondrial myopathy and cardiomyopathy resulting from a deficiency in the heart/muscle isoform of the adenine nucleotide translocator. Nat. Genet. 16:226-234[Medline].
HARTENSTEIN, K., P. SINHA, A. MISHRA, H. SCHENKEL, and I. TOROK et al., 1997 The congested-like tracheae gene of Drosophila melanogaster encodes a member of the mitochondrial carrier family required for gas-filling of the tracheal system and expansion of the wings after eclosion. Genetics 147:1755-1768[Abstract].
HOMYK, T., JR., 1977 Behavioral mutations of Drosophila melanogaster. II. Behavioral analysis and focus mapping. Genetics 87:105-128
HOMYK, T., JR. and D. E. SHEPPARD, 1977 Behavioral mutations of Drosophila melanogaster. I. Isolation and mapping of mutations which decrease flight ability. Genetics 87:95-104
HOMYK, T., JR., J. SZIDONYA, and D. T. SUZUKI, 1980 Behavioral mutants of Drosophila melanogaster. III. Isolation and mapping of mutations by direct visual observations of behavioral phenotypes. Mol. Gen. Genet. 177:553-565[Medline].
HUTTER, P., 1997 Genetics of hybrid inviability in Drosophila.. Adv. Genet. 36:157-185[Medline].
HUTTER, P. and M. ASHBURNER, 1987 Genetic rescue of inviable hybrids between Drosophila melanogaster and its sibling species. Nature 327:331-333[Medline].
HUTTER, P. and F. KARCH, 1994 Molecular analysis of a candidate gene for the reproductive isolation between sibling species of Drosophila.. Experientia 50:749-762[Medline].
HUTTER, P., J. ROOTE, and M. ASHBURNER, 1990 A genetic basis for the inviability of hybrids between sibling species of Drosophila.. Genetics 124:909-920[Abstract].
JANCA, F. C., E. P. WOLOSHYN, and D. NASH, 1986 Heterogeneity of lethals in a "simple" lethal complementation group. Genetics 112:43-64
KITAMOTO, T., W. WANG, and P. M. SALVATERRA, 1998 Structure and organization of the Drosophila cholinergic locus. J. Biol. Chem. 273:2706-2713
KLINGENBERG, M., 1985 The ADP/ATP carrier in mitochondrial membranes, The Enzymes of Biological Membranes, Chap. 60, Vol. 4, Ed. 2, edited by A. N. MARTONOSI. Plenum Press, New York.
KUAN, J. and M. H. SAIER, 1993 The mitochondrial carrier family of transport proteins: structural, functional, and evolutionary relationships. Crit. Rev. Biochem. Mol. Biol. 28:209-233[Medline].
LEFEVRE, G., 1971 Salivary chromosome bands and the frequency of crossing over in Drosophila melanogaster.. Genetics 67:497-513
LEFEVRE, G., 1976 A photographic representation and interpretation of the polytene chromosomes of Drosophila melanogaster salivary glands, pp. 3166 in The Genetics and Biology of Drosophila, Vol. 1A, edited by M. ASHBURNER and E. NOVITSKI. Academic Press, London.
LEFEVRE, G., 1981 The distribution of randomly recovered X-ray induced sex-linked genetic effects in Drosophila melanogaster.. Genetics 99:461-480
LEFEVRE, G. and W. S. WATKINS, 1986 The question of the total gene number in Drosophila melanogaster.. Genetics 113:869-895
LINDSLEY, D. L., and G. G. ZIMM, 1992 The Genome of Drosophila melanogaster. Academic Press, San Diego.
LOUVI, A. and S. G. TSITILOU, 1992 A cDNA clone encoding the adenine nucleotide translocase of Drosophila melanogaster shows a high degree of similarity with the mammalian adenine nucleotide translocase. J. Mol. Evol. 35:44-50[Medline].
MADUEÑO, E., G. PAPAGIANNAKIS, G. RIMMINGTON, R. D. C. SAUNDERS, and C. SAVAKIS et al., 1995 A physical map of the X chromosome of Drosophila melanogaster: cosmid contigs and sequence tagged sites. Genetics 139:1631-1647[Abstract].
MCKIM, K. S., C. MATHESON, M. A. MARRA, M. F. WAKARCHUK, and D. L. BAILLIE, 1994 The Caenorhabditis elegans unc-60 gene encodes proteins homologous to a family of actin-binding proteins. Mol. Gen. Genet. 242:346-357[Medline].
MOTTUS, R. C., I. P. WHITEHEAD, M. O'GRADY, R. E. SOBEL, and R. H. L. BURR et al., 1997 Unique gene organization: alternative splicing in Drosophila produces two structurally unrelated proteins. Gene 198:229-236[Medline].
NASH, D. and F. C. JANCA, 1983 Hypomorphic lethal mutations and their implications for the interpretation of lethal complementation studies in Drosophila.. Genetics 105:957-968
PAVLIDIS, P., M. RAMASWANI, and M. A. TANOUYE, 1994 The Drosophila easily shocked gene: a mutation in a phospholipid synthetic pathway causes seizure, neuronal failure, and paralysis. Cell 79:23-33[Medline].
PAVLIDIS, P. and M. A. TANOUYE, 1995 Seizures and failures in the giant pathway of Drosophila bang-sensitive paralytic mutants. J. Neurosci. 15:5810-5819[Abstract].
PLANO, G. V. and H. H. WINKLER, 1991 Identification and initial topological analysis of the Rickettsia prowazekii ATP/ADP translocase. J. Bacteriol. 173:3389-3396
POWELL, S. J., S. M. MEDD, M. J. RUNSWICK, and J. E. WALKER, 1989 Two bovine genes for mitochondrial adenine nucleotide translocase expressed differently in various tissues. Biochemistry 28:866-873[Medline].
REHM, E. J., 1998 Inverse PCR and cycle sequencing protocols for recovery of sequences flanking PZ, PlacW and PEP elements. http://www.fruitfly.org/methods/
ROYDEN, C. S., V. PIRROTTA, and L. Y. JAN, 1987 The tko locus, site of a behavioral mutation in D. melanogaster, codes for a protein homologous to prokaryotic ribosomal protein S12. Cell 51:165-173[Medline].
RUNSWICK, M. J., A. PHILIPPIDES, G. LAURA, and J. E. WALKER, 1994 Extension of the mitochondrial transporter super-family: sequences of five members from the nematode worm, Caenorhabditis elegans.. DNA Seq. 4:281-291[Medline].
SAMBROOK, J., E. F. FRITSCH and T. MANIATIS, 1989 Molecular Cloning: A Laboratory Manual, Ed. 2. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
SARASTE, M. and J. E. WALKER, 1982 Internal sequence repeats and the path of polypeptide in mitochondrial ATP/ADP translocase. FEBS Lett. 144:250-254[Medline].
SAWAMURA, K., T. K. WATANABE, and M. T. YAMAMOTO, 1993 Hybrid lethal systems in the Drosophila melanogaster species complex. Genetica 388:175-185.
SCHUBIGER, M., Y. FENG, D. M. FAMBOROUGH, and J. PALKA, 1994 A mutation of the Drosophila sodium pump
subunit gene results in bang-sensitive paralysis. Neuron 12:373-381[Medline].
SHAH, Z. H., K. M. C. O'DELL, S. C. M. MILLER, X. AN, and H. T. JACOBS, 1997 Metazoan nuclear genes for motoribosomal protein S12. Gene 204:55-62[Medline].
SHEPPARD, D. E., 1974 A selective procedure for the separation of flightless adults from normal flies. Dros. Inf. Serv. 51:150.
STEPIEN, G., A. TORRONI, A. B. CHUNG, J. A. HODGE, and D. C. WALLACE, 1992 Differential expression of adenine nucleotide translocator isoforms in mammalian tissues and during muscle cell differentiation. J. Biol. Chem. 267:14592-14597
TSCHIERSCH, B., A. HOFMANN, V. KRAUSS, R. DORN, and G. KORGE et al., 1994 The protein encoded by the Drosophila position-effect variegation suppressor gene Su(var)3-9 combines domains of antagonistic regulators of homeotic gene complexes. EMBO J. 13:3822-3831[Medline].
WALKER, J. E., 1992 The mitochondrial transporter family. Curr. Biol. 2:519-526.
WALKER, J. E. and M. J. RUNSWICK, 1993 The mitochondrial transport protein superfamily. J. Bioenergy Biomem. 25:435-446.
WINKLER, H. H., 1976 Rickettsial permeability: an ATP/ADP transport system. J. Biol. Chem. 251:389-396
YEAST PROTEOME, 1998 Yeast Proteome Database, http://www.proteome.com/
ZHIMULEV, I. F., G. V. POKHOLKOVA, A. B. BGATOV, G. H. UMBETOVA, and I. V. SOLOVJEVA et al., 1987 Fine cytogenetical analysis of the band 10A1-2 and the adjoining regions in the Drosophila melanogaster X chromosome. V. Genetic characteristics of the loci in the 9E-10B region. Biol. Zentbl. 106:699-720.
This article has been cited by other articles:
![]() |
S. Aruna, H. A. Flores, and D. A. Barbash Reduced Fertility of Drosophila melanogaster Hybrid male rescue (Hmr) Mutant Females Is Partially Complemented by Hmr Orthologs From Sibling Species Genetics, April 1, 2009; 181(4): 1437 - 1450. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Fergestad, L. Olson, K. P. Patel, R. Miller, M. J. Palladino, and B. Ganetzky Neuropathology in Drosophila Mutants With Increased Seizure Susceptibility Genetics, February 1, 2008; 178(2): 947 - 956. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Chen, X. Shi, R. Padmanabhan, Q. Wang, Z. Wu, S. C. Stevenson, M. Hild, D. Garza, and H. Li Identification of novel modulators of mitochondrial function by a genome-wide RNAi screen in Drosophila melanogaster Genome Res., January 1, 2008; 18(1): 123 - 136. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Matsuba, J. U. Palo, S. L. Kuzmin, and J. Merila Evidence for Multiple Retroposition Events and Gene Evolution in the ADP/ATP Translocase Gene Family in Ranid Frogs J. Hered., July 19, 2007; (2007) esm038v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. S. Kim, M. J. Shin, D. J. Yang, M. Yamaguchi, S. Y. Park, and M. A. Yoo Transcriptional regulation of the Drosophila ANT gene by the DRE/DREF system Genes Cells, May 1, 2007; 12(5): 569 - 579. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Fergestad, B. Bostwick, and B. Ganetzky Metabolic Disruption in Drosophila Bang-Sensitive Seizure Mutants Genetics, July 1, 2006; 173(3): 1357 - 1364. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Celotto, A. C. Frank, S. W. McGrath, T. Fergestad, W. A. Van Voorhies, K. F. Buttle, C. A. Mannella, and M. J. Palladino Mitochondrial Encephalomyopathy in Drosophila J. Neurosci., January 18, 2006; 26(3): 810 - 820. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. J. Chen Sal1p, a Calcium-Dependent Carrier Protein That Suppresses an Essential Cellular Function Associated With the Aac2 Isoform of ADP/ATP Translocase in Saccharomyces cerevisiae Genetics, June 1, 2004; 167(2): 607 - 617. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Rikhy, M. Ramaswami, and K. S. Krishnan A Temperature-Sensitive Allele of Drosophila sesB Reveals Acute Functions for the Mitochondrial Adenine Nucleotide Translocase in Synaptic Transmission and Dynamin Regulation Genetics, November 1, 2003; 165(3): 1243 - 1253. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Szuplewski and R. Terracol The cyclope Gene of Drosophila Encodes a Cytochrome c Oxidase Subunit VIc Homolog Genetics, August 1, 2001; 158(4): 1629 - 1643. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Ranz, F. Casals, and A. Ruiz How Malleable is the Eukaryotic Genome? Extreme Rate of Chromosomal Rearrangement in the Genus Drosophila Genome Res., February 1, 2001; 11(2): 230 - 239. [Abstract] [Full Text] |
||||
![]() |
M. V. Frolov, E. V. Benevolenskaya, and J. A. Birchler The oxen Gene of Drosophila Encodes a Homolog of Subunit 9 of Yeast Ubiquinol-Cytochrome c Oxidoreductase Complex: Evidence for Modulation of Gene Expression in Response to Mitochondrial Activity Genetics, December 1, 2000; 156(4): 1727 - 1736. [Abstract] [Full Text] |
||||
![]() |
V. Krauss and G. Reuter Two Genes Become One: The Genes Encoding Heterochromatin Protein SU(VAR)3-9 and Translation Initiation Factor Subunit eIF-2{gamma} Are Joined to a Dicistronic Unit in Holometabolic Insects Genetics, November 1, 2000; 156(3): 1157 - 1167. [Abstract] [Full Text] |
||||
![]() |
H. A. Orr and S. Irving Genetic Analysis of the Hybrid male rescue Locus of Drosophila Genetics, May 1, 2000; 155(1): 225 - 231. [Abstract] [Full Text] |
||||
![]() |
D. A. Barbash, J. Roote, and M. Ashburner The Drosophila melanogaster Hybrid male rescue Gene Causes Inviability in Male and Female Species Hybrids Genetics, April 1, 2000; 154(4): 1747 - 1771. [Abstract] [Full Text] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Zhang, Y. Q.
- Articles by Ashburner, M.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Zhang, Y. Q.
- Articles by Ashburner, M.











