help button home button Genetics AJP: Regulatory Phys
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kiger, A. A.
Right arrow Articles by Fuller, M. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kiger, A. A.
Right arrow Articles by Fuller, M. T.
Genetics, Vol. 153, 799-812, October 1999, Copyright © 1999

Developmental Genetics of the Essential Drosophila Nucleoporin nup154: Allelic Differences Due to an Outward-Directed Promoter in the P-Element 3' End

Amy A. Kigera, Silvia Gigliottic, and Margaret T. Fullera,b
a Department of Developmental Biology, Stanford University School of Medicine, Stanford, California 94305-5329
b Department of Genetics, Stanford University School of Medicine, Stanford, California 94305-5329
c Instituto Internazionale di Genetica e Biofisica, 80125 Napoli, Italy

Corresponding author: Margaret T. Fuller, Departments of Developmental Biology and Genetics, Beckman Center B300, 279 Campus Dr., Stanford University School of Medicine, Stanford, CA 94305-5329., fuller{at}cmgm.stanford.edu (E-mail)

Communicating editor: S. HENIKOFF


*  ABSTRACT
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Drosophila nup154 encodes a predicted nucleoporin homologous to yeast Nup170p, Nup157p, and vertebrate Nup155, all of which are major components of the nuclear pore complex (NPC). Unlike its yeast homologs, nup154 is essential for viability. Animals with strong loss-of-function nup154 mutations caused by P-element insertion in the 5'-UTR of the gene died as larvae with small discs, brains, and testes. nup154 mRNA expression appeared developmentally regulated in tissues of wild-type embryos, larvae, and adults, suggesting that new nup154 synthesis is required when assembly of new NPCs is required, as in proliferating or growing tissues. Two additional nup154 alleles also associated with different P-element inserts in the 5'-UTR were viable but had strong loss-of-function sterile phenotypes, including failure to maintain spermatogenic stem cells and failure to progress into vitellogenic stages of oogenesis. Lethality vs. viability correlated with orientation of the P-element inserts in the different alleles. Transcript analysis by 5'-RACE suggested a mechanism for allelic differences: an outward-directed promoter internal to the P-element 3' end able to drive sufficient expression of the nup154 transcript for viability but not for fertility.


NUCLEAR pore complexes (NPCs) are portals for highly regulated bidirectional transport of macromolecules between the cytoplasm and the nucleus (reviewed in DAVIS 1995 Down; DOYE and HURT 1997 Down; GORLICH 1997 Down; NAKIELNY and DREYFUSS 1997 Down). NPCs consist of four major structural elements: a spoke-ring complex (or central scaffold) anchored to the nuclear envelope, a central transporter that lies within the spoke-ring channel (spoke-ring and transporter together make up the NPC core), attached cytoplasmic filaments, and a nuclear basket (JARNIK and AEBI 1991 Down; GOLDBERG and ALLEN 1992 Down; HINSHAW et al. 1992 Down; AKEY and RADERMACHER 1993 Down). Comparisons between yeast and vertebrate NPCs suggest that the overall NPC structure is conserved among all eukaryotes (REICHELT et al. 1990 Down; YANG et al. 1998 Down).

Each NPC is composed of ~50 proteins, referred to as nucleoporins (reviewed in DOYE and HURT 1997 Down). Nucleoporins are classified into two groups based on presence or absence of the repeated amino acid motifs FG, FXFG, or GLFG. Repeat-containing nucleoporins have been implicated in both nuclear transport and/or NPC structural organization (reviewed in DOYE and HURT 1997 Down). In general, nonrepeat-containing nucleoporins appear to function primarily in NPC structural organization (AITCHISON et al. 1995 Down; KENNA et al. 1996 Down; NEHRBASS et al. 1996 Down; ZABEL et al. 1996 Down). Biochemical studies from yeast, frog, and rat have shown that many of the known nucleoporins are highly conserved in sequence, localization, protein interactions, and structural and/or transport roles in the NPC (AITCHISON et al. 1995 Down; HU et al. 1996 Down; GRANDI et al. 1997 Down; POWERS et al. 1997 Down). Genetic studies in Saccharomyces cerevisiae have elucidated functional requirements for many of the 30 yeast nucleoporins identified to date (reviewed in DOYE and HURT 1997 Down). However, until recently, the mutational analysis of metazoan nucleoporin genes has been limited to one case, a knockout of the CAN/Nup214 gene in mouse (VAN DEURSEN et al. 1996 Down).

Mutations have now been identified in a Drosophila gene, nup154, that encodes a homolog of the nonrepeat nucleoporins Nup155 of rat and Nup170p and Nup157p of S. cerevisiae (GIGLIOTTI et al. 1998 Down). Yeast Nup170p and Nup157p, together with the nonrepeat nucleoporins Nic96p, Nup188p, and Nup192p and the pore membrane protein Pom152p, are the major proteins comprising the yeast NPC structural core (AITCHISON et al. 1995 Down; DOYE and HURT 1997 Down). These proteins represent the most abundant proteins in yeast NPC preparations, accounting for one-quarter of the total isolated NPC mass (AITCHISON et al. 1995 Down). On the basis of their abundance, localization, and interaction with other major NPC constituents, these core nucleoporins are thought to hold fundamental positions in the organization of the NPC framework, responsible for both the stabilization of the NPC in the nuclear envelope (NE) and the tethering of peripheral nucleoporins involved in transport (KENNA et al. 1996 Down; NEHRBASS et al. 1996 Down; ZABEL et al. 1996 Down). Interestingly, the Drosophila Nup154 was found localized to both the nuclear perimeter and to an intranuclear position overlapping that of chromatin. Hypomorphic mutant alleles caused defects in both male and female gametogenesis (GIGLIOTTI et al. 1998 Down).

In this article, we report the phenotypic and molecular analyses of strong loss-of-function mutations in the conserved Drosophila nucleoporin, nup154. The phenotype of lethal nup154 alleles indicates that the gene is essential for viability and required for normal cell proliferation. The pattern of mRNA expression in embryonic development and postembryonic tissues suggests that new expression of nup154 occurs in tissues undergoing mitotic proliferation, consistent with a requirement for new protein for nuclear pore assembly. Analysis of the intron/exon structure of the nup154 transcription unit and molecular lesions associated with nup154 alleles revealed that four viable and three lethal independently derived transposable element-induced mutant lines carried P-element insertions clustered within 48 bp of each other in the nup154 5'-UTR. Lethality vs. viability correlated with the orientation of the P-element inserts of different alleles. Transcript analysis by 5'-RACE suggested a mechanism for the allelic differences: expression of the nup154 transcript from a promoter internal to the P-element insert sufficient for viability but not for fertility.


*  MATERIALS AND METHODS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Drosophila stocks and husbandry:
Flies were raised on standard cornmeal molasses agar medium at 25°. Visible markers, balancers, and deletions are as described in LINDSLEY and ZIMM 1992 Down, except for T(2;3)SM6a-TM6B, al2 Cy ltv cn2 sp2; ss- bx34e e Hu Tb, a translocation between the SM5 and TM6B balancers induced by X irradiation by C. González and J. Casal (Centro de Biologia Molecular, Madrid, Spain), which was used as balancer where nup154 mutant larvae were to be selected. Df is Df(2L)J39 {31C-31D; 32D-32E}, which failed to complement nup154 phenotypes and was used throughout this study. Two independent transgenic lines carrying a 3.9-kb genomic fragment with wild-type rpL9 were provided by Üllrich Schäfer (SCHMIDT et al. 1996 Down). Agametic flies were progeny of oskce4 homozygous females.

Identification and isolation of nup154 alleles: The nup1541 mutant allele was generated during mobilization of an unlinked PlacW transposable P element (BIER et al. 1989 Down) by J. Hackstein in a screen for recessive male sterile mutations and was originally named zonder kloten (zk). The homozygous lethal nup1542 and nup1547 alleles were isolated in a screen for ethyl methanesulfonate (EMS)-induced mutations that failed to complement nup1541 for the male sterile phenotype. Isogenized b pr or cn bw males were mutagenized with a final concentration of 25 mM EMS for 24 hr, mated to w; Sco/CyO virgin females, and single b pr* (cn bw*)/CyO F1 males were crossed to nup1541 virgin females. For each of 542 b pr and 3455 cn bw EMS-treated lines, two b pr* (cn bw*)/nup1541 sons were tested by dissection for the nup1541 tiny testis phenotype. The tester second chromosomes used in the initial screen also carried other sterile mutations not relevant to this article. Positive lines were retested for failure to complement nup1541 and stocked. nup1543 and nup1544 are the PZ [ry+] P-element-induced mutations l(2)01501 and l(2)10432. nup1545 and nup1546 are the PlacW [w+] P-element-induced mutations l(2)k07701 and l(2)k08204 (SPRADLING et al. 1995 Down). The lethality of the nup1545 chromosome is not associated with the P-element insertion in the nup154 region, as nup1545/Df flies were viable but sterile. The P-element induced viable but sterile mutations tlp1 and tlp2 were described in GIGLIOTTI et al. 1998 Down.

To demonstrate that the nup1541 phenotype was due to the P-element insertion, nup1541/CyO flies were crossed to flies bearing the P{ry+t7.2 {Delta}2-3} (99B) transposase insertion to mobilize the P element and generate w- eye color revertants (ROBERTSON et al. 1988 Down). Four classes of w- revertants were isolated: true revertants (female and male fertile); female fertility revertants (female fertile, male sterile); nonrevertants (still male and female sterile); and lethal revertants. Genomic Southern blot analyses of nup1541 and w- revertant alleles using genomic probes spanning the region confirmed the presence or excision of the original nup1541 P element and/or flanking genomic DNA.

Characterization of nup154 mutant phenotypes:
Determination of the mutant nup154 lethal phase: The lethal phase of trans-heterozygous combinations of nup154 lethal alleles was determined by embryonic and larval hatch counts for all combinations of nup1542, nup1543, and nup1546, representing alleles derived from three different parental chromosomes. For embryonic hatch counts, embryos from appropriate nup154/OreR parental matings were collected on apple juice plates overnight and aged 24 hr. Percentage hatching was determined as the number of hatched larvae divided by the total number of embryos laid on the plate (hatched and unhatched, n = 1000/genotype). Percentage hatching from crosses involving two different nup154 mutant alleles was comparable to that of parallel control crosses with homozygous OreR parents. To assess viability through the larval stages, appropriate nup154/T(2;3) SM6a; TM6B,Tb parents were mated, and embryos collected on apple juice agar plates were supplied with yeast paste and aged for 2–5 days. The Tb marker carried on the T(2;3) balancer allowed identification of trans-heterozygous larvae, which were non-Tb. Larval stages were confirmed by mouth hook morphology. Similar experiments with homozygous nup154 lethal alleles indicated that viability to the late third instar was slightly reduced compared to the trans-heterozygotes, but those that survived exhibited a similar phenotype.

X-Gal staining: X-Gal staining was performed as described (GONCZY et al. 1992 Down). Enhancer trap line S3-46 was used to mark germline stem cells and primary spermatogonial cells, and enhancer trap line I-72 was used to mark somatic hub and cyst cells (GONCZY 1995 Down).

Examination of adult gonads: Adult ovaries were dissected from females fed on yeast paste for several days after eclosion. Gonads were examined with either phase contrast or Nomarski optics on a Zeiss Axioskop microscope.

Molecular analyses of nup154:
Determination of nup154 genomic region and P-element insertion sites: Genomic DNA (1.7 kb) flanking the nup1541 P-element insert was cloned by plasmid rescue after digestion with SacII and shown by in situ hybridization to map to polytene chromosome interval 32D (GONZALEZ and GLOVER 1994 Down), the same cytological position as the P-element insert in nup1541 (data not shown). A 1.3-kb HindIII fragment from the rescued flanking DNA was used to screen an EMBL3 {lambda} genomic phage library (provided by J. Tamkun), yielding 6 phage clones spanning 23.8 kb from the nup154 region. P-element insertion sites in alleles nup1541, nup1543, nup1544, nup1545, and nup1546 were determined by plasmid rescue and sequence analysis of the rescued fragments.

RNA isolation and Northern blot analysis: RNA for developmental Northern blots was purified from staged embryos, larvae, and adults using RNAzol and its accompanying protocol (Tel-Test, Inc.) or as described by CHOMCZYNSKI and SACCHI 1987 Down. Northern blots were probed with SalI genomic fragments flanking the nup1541 insertion site, and two transcripts were identified: a 0.8-kb transcript (rpL9) and an ~4.5-kb transcript (nup154; data not shown). Northern blots shown in RESULTS were probed with a partial nup154 cDNA.

Isolation of nup154 cDNAs: Sequence derived from the flanking DNA rescued from the nup1541 insert showed that the 0.8-kb transcript represented the previously reported ribosomal protein L9 (rpL9; SCHMIDT et al. 1996 Down), and the larger transcript represented nup154. Partial nup154 cDNA clones were isolated by screening a {lambda}-gt11 Canton, S 0- to 18-hr embryonic cDNA library (CLONTECH, Palo Alto, CA) with the 4.6- and 5.6-kb BamHI genomic fragments that span either side of the nup1541 insert. A partial cDNA clone representing the 5' portion of the predicted nup154 transcript was used to screen a 4- to 8-hr embryonic plasmid cDNA library (BROWN and KAFATOS 1988 Down), and multiple cDNA clones were recovered, including one apparently full-length nup154 cDNA clone with a 4.3-kb insert (cDNA 5A). 5'- and 3'-RACE from RNA from whole adult females was performed per instructions (GIBCO-BRL, Life Technologies, Gaithersburg, MD). All wild-type cDNAs and RACE products reported here hybridized to the nup154 region in Southern blot analyses. RT-PCR on reverse-transcribed RNA derived from homozygous nup1541, tlp1, or tlp2 adults was performed with a primer to nup154 sequences and one of four primers to sequences within the P-element 3' end (see Fig 8C). nup154 primer sequences were as follows: primer G1, GCTTGCGACTGTTATC; primer G2, GGAACCATATAGGAGACCAGT; primer G, CGCTTGCCAAACCAACTGGAC; and primer R, CGCCCATGCTGGCTAACG. P-element primer sequences were as follows: primer 1, GTCTCACTCAGACTCAATACGACACTC (92–117 bp from P-element 3' end); primer 2, CAATCATATCGCTGTCTCACTC (110–131 bp from P-element 3' end); primer 3, CACGGACATGCTAAGGGTTAATC (134–156 bp from P-element 3' end); and primer 4, GATGGAGTTGATGACGCCGAC (240–261 bp from PlacW P-element 3' end).



View larger version (16K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1. Structure of the nup154 Drosophila nucleoporin gene and transformation rescue of the mutant phenotypes. (A) Cloned genomic DNA flanking the insertion site of the nup1541 P element: B, BamHI; E, EcoRI; S, SalI. The rpL9 and nup154 transcripts encoded in the region are depicted just below the genomic DNA, with arrows indicating direction of transcription. A 7-kb fragment of genomic DNA containing the nup154 transcription unit (long bracket) rescued all phenotypes associated with the lethal nup1546 and sterile nup1541 alleles (+). A 3.9-kb fragment of genomic DNA containing rpL9 (short bracket) rescued rpL9 mutant phenotypes (SCHMIDT et al. 1996 Down) but failed to complement nup154 mutants (-). (B) Higher-resolution diagram showing the gene structures of rpL9 and nup154 based on comparison of genomic and cDNA sequences. The longest nup154 cDNA was arranged from 13 exons and contained a 116-bp 5'-UTR with stop codons in all three frames, a 4286-bp open reading frame encoding the predicted nup154 protein homolog of rat Nup155, and a 119-bp 3'-UTR followed by a poly(A) tail. (*) Intron encoding 16 additional amino acids in frame present in other partial cDNAs but not found in the most full-length cDNA sequenced. (nup154 cDNA and genomic sequences are available from GenBank accession nos. AF051397/8 and AF051396, respectively.)



View larger version (122K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2. nup154 lethal alleles showed defects in growth of optic lobes and imaginal discs. Low-magnification view of entire third instar larval brains at the time of the nup154 lethal phase from (A) homozygous nup1542 or (B) nup1542/T(2-3), age matched to mutant sibling. Note the smaller optic lobes (arrowheads) and lack of recognizable imaginal discs (*) associated with the brain from the nup1542 homozygotes compared to normal animals.



View larger version (47K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3. nup154 mRNA was detected throughout development with peaks of expression in ovaries, early embryos, and adults. Northern blot analysis with nup154 sequences detected an ~4.5-kb transcript. (1) Ovaries; (2) 0- to 2-hr embryos; (3) 2- to 4-hr embryos; (4) 4- to 6-hr embryos; (5) 6- to 8-hr embryos; (6) 14- to 16-hr embryos; (7) 16- to 18-hr embryos; (8) first instar larvae; (9) second instar larvae; (10) third instar larvae; (11) pupae; (12) wild-type males; (13) agametic males; (14) wild-type females; (15) agametic females. Top: nup154 probe. Bottom: rp92 (left) and rp49 (right) control probes.



View larger version (145K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 4. Expression of nup154 mRNA in wild-type embryos. In situ hybridization with digoxigenin-labeled nup154 antisense RNA probes to wild-type embryos. Anterior to left, dorsal to top. (A) Syncytial embryo from 0- to 2-hr collection. (B) Embryo at cellular blastoderm stage from 2- to 4-hr collection; note staining is restricted to region just below the pole cells. (C) Embryo undergoing germband elongation from 2- to 4-hr collection. (D) Embryo at germband elongation from 4- to 6-hr collection. (E) Dorsal view of CNS formation and germband retraction in embryo from 7- to 9-hr collection. (F) Embryo undergoing dorsal closure from 9- to 11-hr collection. (G) Late stage embryo from 15- to 17-hr collection (dorsal-lateral view). (H) Higher magnification view of G. Most prominent staining in late embryos was in the coalesced gonad (single arrows), lymph gland (split arrows), and several cells in the brain (arrowheads).



View larger version (83K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 5. Expression of nup154 mRNA in postembryonic tissues. In situ hybridization of digoxigenin-labeled nup154 antisense (A, C, E, G, I, J) or control sense (B, D, F, H) RNA probes to wild-type postembryonic tissues. (A and B) Third instar larval brains and associated imaginal discs. (C and D) Third instar larval testes (note the surrounding fat body shows background staining). (E and F) Adult testes. (G and H) Adult ovaries. (I) Enlargement of germarium region from G; note tip did not stain under these conditions. (J) Apical tip of lightly stained testis showing increased staining of germ cells undergoing either mitosis or premeiotic S.



View larger version (151K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 6. Strong loss-of-function male sterile nup154 alleles cause loss of male germline stem cells. (A and B) Phase contrast images taken at the same magnification. (A) Wild-type adult testis. The whole testis is too large to show at this magnification. White arrow: bundles of elongating spermatids occupy most of the coiled part of the testis, the remainder of which is outside the panel. (B) Testis from nup1541 homozygous adult. Split arrow, the entire length of the tiny mutant testis. No germ cells are apparent in the testis. (C) Germline stem cells (arrow) at the apical tip of a normal testis from S3-46; +/+ adult (approximately one-fourth the entire length of testis shown). Expression of the S3-46 enhancer trap detected by X-Gal stain. (D) Entire mutant testis from S3-46; nup1541/nup1541 adult stained with X-Gal. Germline stem cells were not detected at the apical tip (arrow) or throughout testis. Images in C and D viewed by DIC. (E and F) Phase-contrast images of third instar larval testes. (E) Wild-type larval testis. Note the size gradient of growing primary spermatocytes across the testis from apical (*, left) to basal (right). (F) Testis from nup1541 homozygous larva shown at the same magnification as (E). nup1541 testes are mostly devoid of germ cells but occasionally contain a few spermatocytes (arrowhead), often not in normal cysts of 16. (G and H) Stage 14 embryos stained with anti-Vasa to detect germ cells (white arrowheads) and anti-ß-galactosidase to reveal stripes expressed from wg-lacZ, an enhancer trap insert on the balancer chromosome. (G) nup1541/Cy wg-lacZ embryo. (H) nup1541/nup1541 sibling embryo. Germline pole cells migrate to the gonad and appear to coalesce normally.



View larger version (75K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 7. Strong loss-of-function female sterile nup154 alleles cause arrest at mid-oogenesis. (A) Part of a normal nup1541/CyO adult ovary stained with DAPI. (B) Entire DAPI-stained ovary from nup1541/nup1541 adult shown at same magnification as A. Note lack of vitellogenic stage chambers, which normally have enlarged oocytes and highly polyploid nurse cell nuclei. Arrow, egg chamber with abnormally high number of nurse cell nuclei. (C) Nomarski image of infrequent vitellogenic nup1541/nup1541 egg chamber stained for ß-galactosidase activity to reveal expression of the enhancer trap insertion associated with the nup1541 allele. Note the abnormal organization of the egg chamber, with an oocyte at each end and greater than normal nurse cell number. (D–F) In situ hybridization to osk mRNA. (D) Apical portion of a wild-type ovariole showing accumulation of osk mRNA in a single oocyte located at the posterior of each early egg chamber. (E) nup1541/nup1541 ovariole showing single-oocyte egg chambers similar to wild type. (F) Double-oocyte nup1541/nup1541 egg chamber with bipolar osk localization. Arrowheads, oocytes.



View larger version (34K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 8. Expression of chimeric nup154 transcripts from a promoter in the P-element 3' end in viable but sterile nup154 alleles. (A) Fifty base pairs of genomic DNA near or within the nup154 5'-UTR contained lesions in all the P-element-induced nup154 mutants examined. Direction of nup154 transcription left to right. Open triangles: P-element inserts in the viable alleles nup1541, nup1545, tlp1, and tlp2. In all viable alleles, the P elements were inserted so that the ends (5' to 3') were in the same orientation as nup154 transcription (arrows). Solid triangles: P-element inserts in the lethal alleles nup1543, nup1544, and nup1546. Note that these P elements are inserted in an opposite orientation (arrows) to the viable insertions. Thick bent arrow: Putative nup154 transcription start site based on the 5'-RACE product from wild-type females. Thin bent arrow: 5' end of the embryonic cDNA sequenced (Fig 1). SalI site shown is the same as in B. (B) Detail of nup154 lesions and transcripts associated with the nup1541 P-element allele and related eye color revertant alleles. Top: schematic of the nup1541 PlacW insert (abbreviated in middle for scale), flanked by genomic DNA. Tall bent arrow: Putative nup154 transcription start site. Short bent arrow: Predicted start of the nup154 open reading frame. Small right bar: Sequenced 5'-RACE product chimeric for nup154 sequences (black 3' end of product) and 3' P-element sequences (gray 5' end of product) obtained from homozygous nup1541 and tlp2 adult flies. Short arrows: P-element primer (gray) and nup154 primer (black) used to obtain chimeric RT-PCR product from homozygous nup1541 and tlp2 adult flies. Right gray bar: Region deleted in two lethal nup154 alleles generated by imprecise excision of the insert in nup1541. Left gray bar: Region deleted in 10 viable but sterile nup154 eye color revertants. Dotted regions indicate uncertainty or variability between different alleles analyzed. E, EcoRI; C, SacII; B, BamHI; H, HindIII; S, SalI. (C) Detailed view of P-element 3' end in viable nup154 insertion alleles and related chimeric nup154 transcripts. Top bar: 3' end of P-element insert in viable nup154 alleles. White portion contains the 3' end sequences conserved between the PlacW and PZ P elements. Two TCACTC and one TCAATA consensus transcription initiator elements and one GACG consensus downstream promoter element are indicated by the four black boxes in the P-element 3' end. Single asterisk: End sequence of 5'-RACE products from nup1541. Three asterisks: End sequence of 5'-RACE product from tlp2. Adjacent HindIII site is deleted in the lethal eye color revertants. Numbered arrows: Different P-element primers used with a nup154 primer for RT-PCR of chimeric transcripts from nup1541, tlp1, or tlp2 homozygotes (for sequences and nucleotide locations, see MATERIALS AND METHODS). Primers 1–3 are complementary to conserved P-element sequences and successfully yielded RT-dependent products; primer 4 is complementary to PlacW-specific sequences and was unable to generate any RT-dependent product. (D) Sequence of conserved 3' end of PlacW and PZ P-element. Zero position is the 3' end of the P elements. Boldface boxed sequences: Three possible initiator elements that match the consensus TCA G/TT T/C at 71–76 bp, 100–105 bp, and 110–115 bp from the 3' end and one possible downstream promoter element that matches the consensus G A/TCG at 27–30 bp from the 3' end. Asterisks and arrows: Same as in C. (E) Northern blot analysis revealed that nup154 mRNA levels are drastically reduced in ovaries from the viable but sterile tlp1 allele. Total RNA from ovaries of (1) wild type; (2) tlp1/CyO; and (3) tlp1/tlp1. (Top) nup154; (bottom) rp92.

Sequencing nup154 cDNAs and genomic region: cDNA inserts were subcloned into pBluescriptII-KS- (Stratagene, La Jolla, CA) for mapping and sequencing. The full-length cDNA was sequenced on both strands by the ABI PRISM dye terminator cycle method (Perkin-Elmer, Norwalk, CT) using vector primers for end runs (on full-length and drop-out cDNA clones) and internally directed synthetic oligonucleotide primers (Beckman Center PAN-Facility). Sequences from partial cDNAs were identical to corresponding regions of the full-length cDNA sequence, with the exception that intron 3 was not found in two partial cDNAs (Fig 1B, asterisk). The cDNAs without intron 3 maintained the same reading frame, encoding 16 additional amino acids near amino acid position 200. A total of 6.7 kb of genomic sequence, including 740 bp upstream and 960 bp downstream of the nup154 transcription unit, was obtained from three genomic fragments subcloned from phage into pBluescript. Sequence from both strands of the genomic DNA and the cDNA was determined, with two- to six-fold coverage across any given region. Sequence contigs and alignments were assembled using SEQMAN and MEGALIGN (DNASTAR, Madison, WI). Sequence comparison searches and alignments were performed using NCBI BLAST (ALTSCHUL et al. 1990 Down), and COILS was used to identify predicted coiled-coil domains. nup154 cDNA and genomic sequences are available from GenBank accession nos. AF051397/8 and AF051396, respectively. Sequence of 5'-RACE products derived from nup1541 or tlp2 homozygotes was done using either nested primers to nup154 sequences (above) or using a primer internal to the P-element 3' end (primer 3Pin1, ATGAAATAACATAAGGTGGTCCCG, and primer 3Pin2, GGCAAGAGACATCCACTTAACG).

Construction of P[nup154+] and P[nup154{Delta}] transgenic strains: A nup154 genomic rescue fragment spanning the entire nucleoporin transcription unit plus 857 bp of DNA upstream and 648 bp of DNA downstream was constructed as follows. A 3-kb XhoI-NotI fragment from a plasmid carrying a 3-kb XhoI-XmaI 3'-genomic fragment of the gene subcloned into pBluescript (pBS-XX) was subcloned into the pCaSpeR-4 transformation vector (THUMMEL et al. 1988 Down) already carrying a 4-kb PstI-XhoI 5'-genomic fragment of the gene (pC4-PX) for the final 6.97-kb total genomic insert. A mutant nup154 genomic construct was made in an identical manner as the wild-type construct, with the exception that the 4-kb PstI-XhoI genomic fragment contained two in-frame stop codons in the nup154 open reading frame. Quick-change site-directed mutagenesis (Stratagene) was used to convert 3 bases within nucleotides 562–567 (#5A cDNA 5' end at 0) from ATTCGG to ACTAGT, which generated two in-frame stop codons that also contributed to the formation of a novel SpeI restriction site. Constructs were injected into yw embryos using a 5:1 mix of genomic construct to {Delta}2-3 helper plasmid for P-element-mediated germline transformation (RUBIN and SPRADLING 1982 Down) by standard methods. Three independent lines of both P[nup154+] and P[nup154{Delta}] were generated and tested for complementation of the nup154 mutant phenotypes.

In situ hybridization to mRNAs:
RNA probes were labeled with digoxigenin during in vitro transcription according to Genius System protocols (Boehringer-Mannheim, Indianapolis), treated 30–60 min to alkaline hydrolysis, and used for hybridizations at 1:100 (TAUTZ and PFEIFLE 1989 Down). The nup154 RNA probe was synthesized from a partial cDNA (5.2) representing the 5' region of the nup154 transcript. osk RNA probe was made from pNB-osk7 (provided by R. Lehmann). Whole-mount embryo in situ hybridizations were carried out on 2-hr collections of staged OreR embryos (TAUTZ and PFEIFLE 1989 Down). In situ hybridization to OreR third instar larval tissues was performed as described in JOHNSON et al. 1995 Down, except that the hybridization was done at 65° in hybridization buffer at pH 4.5. In situ hybridization was performed on adult testes as in WHITE-COOPER et al. 1998 Down. In situ hybridization to ovaries was as for testes, except ovaries were subjected to 30° in 0.75 M KCl at 37° and then washed with 1x PBS prior to fixation.

Immunohistochemistry:
Primary antibodies used were rabbit anti-Vasa (1:2000; provided by A. Williamson and R. Lehmann) and rabbit anti-ß-galactosidase (1:10,000; Cappel). Secondary antibody used was biotinylated goat anti-rabbit (1:500; Vector Labs, Burlingame, CA). To assess the presence of pole cells in embryonic gonads, 13- to 20-hr-old progeny from nup1541/CyO wg-lacZ parents were double labeled for the germline antigen Vasa and the balancer-derived ß-galactosidase marker and detected by immunohistochemical methods as described (GOLDSTEIN and FYRBERG 1994 Down). Immunohistochemical experiments were imaged by Nomarski optics on a Zeiss Axioskop microscope.


*  RESULTS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

The nup154 Drosophila nucleoporin homolog is essential for viability:
Four new P-element- and two new EMS-induced mutant alleles of the Drosophila nup154 gene were identified. The viable but male and female sterile allele nup1541 was shown to contain a P-element insert in polytene interval 32D by in situ hybridization (data not shown). The male and female sterility of nup1541 homozygotes was due to the P-element insert, as both phenotypes reverted upon excision of the P element after exposure to transposase (MATERIALS AND METHODS). Three additional P-element-induced mutations with insertions that mapped to the region and two EMS-induced mutations isolated from a screen for nup154 alleles all failed to complement the nup1541 male sterile phenotype (MATERIALS AND METHODS and Table 1). In addition, the nup1541 allele was used to obtain small deletions in the gene by imprecise excision (MATERIALS AND METHODS).


 
View this table:
[in this window]
[in a new window]

 
Table 1. Summary of nup154 alleles and phenotypes

Five P-element- or EMS-induced alleles were lethal when in trans to a deficiency or with each other, indicating that nup154 is an essential gene (MATERIALS AND METHODS; Table 1B and Table 1C). Two viable but male and female sterile P-element-induced alleles, nup1541 and nup1545, when heterozygous with the deficiency had tiny testes and small ovaries similar to flies homozygous for nup1541, suggesting they are strong loss-of-function alleles with respect to the sterility phenotypes (MS, FS in Table 1A). Three of the lethal alleles were also viable with similar male and female sterile phenotypes when heterozygous with the viable insertion alleles (MS, FS in Table 1B). These gametogenesis defects were stronger than those reported for P-element-induced tlp1 or tlp2 alleles, which were viable but sterile with extensive germline differentiation in both sexes (GIGLIOTTI et al. 1998 Down). Although also sterile, the lethal nup1543 (previously reported as l(2)01501 in GIGLIOTTI et al. 1998) and nup1544 alleles trans-heterozygous with the viable alleles had intermediate levels of male germline differentiation (MS* in Table 1B and Table 1C). Certain alleles and allelic combinations demonstrated that the nup154 male and female sterility phenotypes were genetically separable. Male sterile but female fertile flies were recovered both from nup1544 trans-heterozygotes and as a class of w- eye color revertants of the nup1541 P element (MS, FF in Table 1C and Table 1D).

The lethal and sterile phenotypes were due to mutations in the gene encoding the nup154 homolog. The structure of the nup154 gene was deduced from comparison of the sequence of genomic DNA in the region with the sequence of a full-length cDNA isolated from a 4- to 8-hr embryonic library (MATERIALS AND METHODS and Fig 1B). A 7-kb genomic fragment spanning the nup154 coding region rescued all mutant phenotypes (lethality, male sterility, and female sterility) associated with the nup1541 and nup1546 mutations when introduced by P-element-mediated germline transformation (Fig 1A), while the same 7-kb genomic fragment carrying two in-frame stop codons at codons 109 and 110 of Nup154 did not rescue any of the nup154 mutant phenotypes. Two independent transgenic lines of a 3.9-kb construct (Fig 1A) previously shown to rescue mutants of the neighboring ribosomal protein L9 gene (SCHMIDT et al. 1996 Down) failed to complement any nup154 mutant phenotypes. The rescue results constitute formal proof that the lethality and sterility phenotypes are due to lesions in the gene encoding the Drosophila nup154 nucleoporin homolog.

Lethal nup154 mutant alleles exhibit defects in mitotically proliferating tissues:
Phenotypes associated with strong loss-of-function nup154 mutations indicated that zygotic function of nup154 is required for growth of mitotically proliferating tissues in larvae and adults. Animals trans-heterozygous for nup154 lethal alleles died throughout the early larval stages, with survivors found until only just after the third instar larval molt. Until the end of second instar, the mutant larvae appeared morphologically similar to their heterozygous siblings in body and tissue size. After the third instar molt, the lethal mutant trans-heterozygotes failed to grow and exhibited a "classic mitotic mutant" phenotype (GONZALEZ and GLOVER 1994 Down), including reduced overall body size and reduced size of larval organs that normally contain proliferating cells. Brains from larvae homozygous, hemizygous, or trans-heterozygous for lethal nup154 alleles were smaller than brains from their age-matched siblings at the third instar. Although the neuropil was relatively normal in size, the optic lobes, which normally contain many dividing neuroblasts, were greatly reduced in the mutant (Fig 2A, arrowheads). Imaginal discs were tiny and difficult if not impossible to locate [compare lack of associated discs (*) in Fig 2A vs. in Fig 2B]. Third instar larval lymph glands were also reduced in size compared to lymph glands from normal, age-matched larvae. Homozygous nup1542 second instar mutant larvae had a normal number of circulating hemocytes (blood cells) in their hemolymph. However, by the third instar, the mutant animals showed a drastic reduction in hemocyte number compared to their age-matched nup1542/+ siblings. Testes from nup1542 third instar larvae were also abnormally small and contained only a few germ cells resembling primary spermatocytes, similar to defects observed in larval testes of males homo- or hemizygous for the viable nup1541 allele (see below and Fig 6).

Expression of nup154 mRNA is developmentally regulated:
Consistent with an essential requirement for the protein, a 4.5-kb transcript corresponding to the nup154 product was detected in all developmental stages examined (embryo, larvae, and adult) by Northern blot analysis (Fig 3). High expression levels were observed in ovaries and early embryos. Levels of mRNA were reproducibly lower in 2- to 4-hr embryos, rose to a peak in 4- to 8-hr embryos, were low in late embryos, larval, and pupal stages, and rose again by adulthood.

In situ hybridization revealed that expression of nup154 mRNA was restricted to specific tissues during certain stages of embryogenesis (Fig 4), consistent with the fluctuations in mRNA levels observed by Northern blot analysis. The nup154 transcript, presumably maternally contributed, was distributed throughout 0- to 2-hr embryos (Fig 4A). By stage 5, nup154 mRNA was detected only at the posterior end of the embryo, just under the pole cells (Fig 4B). Localization of nup154 mRNA to the region under the germ cells continued during germband elongation (Fig 4C). In addition, nup154 mRNA was detected throughout the developing mesoderm (Fig 4C and Fig D), presumably due to zygotic transcription of nup154 in this tissue. At the onset of stage 11, nup154 mRNA was most prominent in the central nervous system (CNS) and gut (Fig 4E and Fig F), and by stage 14, it was also detected in the brain and dorsal vessel. Near the end of embryogenesis, nup154 mRNA was primarily restricted to three distinct tissues: the lymph glands (hematopoietic organ), gonadal germline, and several cells, likely mushroom body neuroblasts, in the brain (Fig 4G and Fig H). All regions where nup154 mRNA was detected in late embryos contained tissues that are mitotically active after the completion of embryogenesis. The nup154 mRNA expression pattern throughout embryogenesis was similar to that described for a set of genes expressed coincident with the onset of S phase (DURONIO and O'FARRELL 1994 Down).

In larvae, although the overall level of nup154 mRNA was low (Fig 3), elevated levels were detected in tissues containing dividing cells. In situ hybridization revealed nup154 mRNA in imaginal discs and certain regions of the brain (Fig 5A). In larval and adult testes, nup154 mRNA was present in all male germline cells up through the meiotic stages (Fig 5C and Fig E). In adult testes, late primary spermatocytes and cells in the meiotic divisions were usually the most darkly stained (Fig 5E). However, lightly stained preparations of adult testes revealed a noticeably darker stripe near the apical tip of the testes (Fig 5J). We were unable to resolve whether this band of increased staining was associated with germ cells in mitosis or in premeiotic S phase. nup154 mRNA was not detected in agametic testes from adult sons of osk mothers, indicating that expression of nup154 mRNA in testes was germline dependent (data not shown). nup154 mRNA was clearly detected in wild-type ovaries in germarium region 2 and throughout later stages of oogenesis, with darker staining after stage 8 (Fig 5G and Fig I).

nup154 function is required for survival of male germline stem cells and progression of oogenesis into the vitellogenic stages:
The expression pattern of nup154 mRNA in testes and ovaries and the defects in proliferating tissues caused by the lethal nup154 alleles led us to reexamine the effects of nup154 mutations on male and female gametogenesis. The nup1541 and nup1545 alleles, which behaved as strong loss-of-function mutations with respect to their effects on male and female gametogenesis, caused stronger defects in gametogenesis than the hypomorphic tlp1 and tlp2 alleles described in GIGLIOTTI et al. 1998 Down.

The male sterile phenotype of nup1541 and nup1545 indicated that function of nup154 is required for survival of male germline stem cells. Testes from homozygous nup1541, trans-heterozygous nup1541/nup1545, nup1541/Df(2L)J39, or nup1545/Df(2L)J39 mutant adults were consistently tiny and appeared to contain no germ cells (Fig 6B), much like testes from agametic flies. ß-Galactosidase activity from enhancer trap lacZ markers expressed in male germline stem cells and their immediate daughters in wild type (Fig 6C) was not detected in testes from homozygous nup1541 adults (Fig 6D). Immunofluorescence stains with the pan germ-cell marker anti-Vasa confirmed that no germline cells were present in testes from homozygous nup1541 adults (data not shown). Enhancer trap markers for the somatically derived hub and cyst cells were expressed in testes from both wild-type and homozygous nup1541 mutants (data not shown), indicating that these somatic cell types were still present in mutant testes.

To determine when mutations in nup154 first affect the male germline, we examined gonads from earlier stages in development. Phase-contrast microscopy revealed that some germ cells were occasionally present in nup1541 larval gonads, unlike the completely empty adult testes. However, very few germ cells per testis were seen (usually 0–10 cells), and the germ cells present were spermatocytes not organized into normal germline cysts (Fig 6F). Small cells present at the apical tip in wild type (Fig 6E) were absent in the mutant, suggesting absence of renewing germline during the late larval stages. The similar phenotype seen in the lethal alleles is consistent with nup1541 being a strong loss-of-function allele with respect to the germline but not the somatic phenotype. The loss of early germ cells in nup1541 homozygotes appeared to occur after formation of the embryonic gonad, probably around the time of the first spermatogenic stem cell divisions. Staining of late embryos with antibodies against the germ-cell marker Vasa indicated that germ cells populate the gonad in both sexes of homozygous nup1541 embryos (Fig 6G), as in heterozygous sibling controls (Fig 6H).

Less severe male sterile allelic combinations (for example, nup1543/nup1541 or nup1544/nup1545 trans-heterozygotes; Table 1, MS*) exhibited a range of variable phenotypes indicative of post-stem cell defects, including tiny testes with no germ cells, small testes filled with apparently degenerating germ cells, or small testes with fewer than normal spermatocytes per cyst and a reduced number of cysts per testis. The semilethal allelic combinations nup1543/nup154RV5 or nup1544/nup154RV5 occasionally exhibited a meiotic arrest phenotype similar to that described for the tlp1 and tlp2 alleles (GIGLIOTTI et al. 1998 Down).

The viable nup1541 allele also caused a strong loss-of-function phenotype in female gametogenesis. Ovaries from well-fed adult females homozygous for nup1541 were tiny and almost completely lacked egg chambers beyond oogenic stage 7 (Fig 7B; compare to wild type, Fig 7A). Most early, previtellogenic egg chambers had nurse cells and a single oocyte able to localize oocyte-specific transcripts based on accumulation of both osk and grk mRNAs in only one germ cell located at the posterior of the chamber (Fig 7E). Egg chambers in which the oocyte had begun to take up yolk were observed but were rare. Occasional nup1541 egg chambers contained two oocytes, which were always located at nearly opposite poles of the egg chamber, based on uptake of yolk (Fig 7C) or osk or grk localization (Fig 7F). Occasionally, approximately once per ovary, a nup1541 egg chamber had twice the normal number of nuclei (Fig 7B, arrow). Staining with DAPI or for ß-galactosidase activity to detect expression of the lacZ enhancer trap associated with the nup1541 allele showed double oocyte egg chambers containing more than the normal 15 nurse cells (Fig 7C), suggesting origin of bipolar egg chambers by failure to separate neighboring egg chambers rather than misspecification of additional oocytes. Older egg chambers in nup1541 ovarioles appeared to degenerate, based on the abnormal appearance of DAPI staining.

Most trans-heterozygous combinations of nup1541 or nup1545 with either Df(2L)J39 or other nup154 alleles in this study (except nup1544) exhibited a block at mid-oogenesis, or "string-of-pearls" phenotype, similar to that of nup1541 homozygotes (Table 1). The strong string-of-pearls phenotype was in contrast to the phenotypes of females homozygous for the previously described hypomorphic tlp1 or tlp2 alleles, which produce some viable eggs (GIGLIOTTI et al. 1998 Down). However, nup1544/nup1541 and nup1544/nup1545 were female fertile, indicating that nup1544 disrupts a molecular aspect of nup154 required for viability but not for female fertility.

Despite the strong loss-of-function effects of nup1541 on gametogenesis, export of mRNAs from the nucleus appeared to occur in mutant early egg chambers, based on the accumulation of osk and grk mRNAs in the oocyte (Fig 7E) and staining of the cytoplasm by in situ hybridization with probe generated from bulk poly(A)+ mRNA (data not shown). In addition, import of some proteins from the cytoplasm to the nucleus appeared to occur in the mutant early egg chambers, based on nuclear localization of the NLS-containing ß-galactosidase protein expressed from the enhancer trap associated with the nup1541 P-element insert (Fig 7C).

Molecular nature of nup154 alleles:
To explore the molecular basis for the striking phenotypic differences among nup154 alleles, we precisely mapped the P-element insertion sites in seven different nup154 alleles. Plasmid rescue and sequencing of the DNA flanking each of the nup154 P elements revealed that all seven inserts mapped within 48 nucleotides of one another (Fig 8A), ~100 bp upstream from the start of the predicted nup154 open reading frame (Fig 8B). The P element appeared to be inserted within the nup154 5'-UTR based on results of 5'-RACE using RNA from wild-type adult females. The 5' end of the 5'-RACE product (Fig 8A, thick bent arrow) obtained from several independent experiments was located 146 bp upstream of the start of the predicted nup154 open reading frame, a position 15 bp upstream of the site of the P-element insertion in nup1541. The close clustering of the P-element inserts raised the question of why some alleles were lethal while others were viable. In addition, the strong effects of the nup1541 and nup1545 alleles on gametogenesis raised the question of how some alleles of an essential gene might have little effect on viability but behave as strong loss-of-function mutations with respect to germline differentiation.

Whether the P-element-induced nup154 alleles were lethal or viable but sterile appeared to correspond with the orientation of the P-element insert. The three lethal P-element-induced alleles nup1543, nup1544, and nup1546 contained inserts in a 3' to 5' orientation with respect to the P-element repeats (Fig 8A, black inserts with arrows), opposite to the direction of nup154 transcription. Conversely, in the viable but sterile alleles nup1541, nup1545, tlp1, and tlp2, the inserts were oriented in the same 5' to 3' orientation as the direction of nup154 transcription (Fig 8A, white inserts with arrows). In the lethal allele nup1543 and the viable allele tlp2, the P elements were inserted at the same nucleotide but in opposite orientations. Lethality vs. viability did not correlate with either the orientation of the lacZ or eye color marker genes or the type of P-element vector (e.g., the viable alleles nup1541 and nup1545 contain PlacW inserts, whereas the viable alleles tlp1 and tlp2 contain PZ inserts).

Initiation of nup154 transcription from an ectopic site within the P-element insert in nup154 viable but sterile alleles:
If the genomic DNA corresponding to the end of the 5'-RACE product obtained from wild-type adult females encodes the start site for transcription of nup154 in all tissues, then the nup154 P-element inserts would be localized within the 5'-UTR and would be predicted to disrupt normal nup154 transcription. The correlation between P-element orientation and viability of certain nup154 insertion alleles suggested a hypothesis: the 3' end of the P elements might provide a promoter for transcription of the adjacent nup154 gene that rescues the lethal phenotype expected if the inserts disrupt the normal transcript. The P-element vectors PlacW and PZ are identical in sequence for 239 bp at their 3' ends. As both PlacW and PZ inserts gave viable alleles only when inserted in a 5' to 3' orientation, this common 3' end would be the most likely site of sequences capable of initiating transcription.

Analysis of P-element sequences deleted in lethal vs. viable w- eye color revertants generated by mobilization of the nup1541 insert (MATERIALS AND METHODS) supported the hypothesis that the viability of the nup1541 allele was due to action of an internal promoter in the P-element 3' end. Two lethal eye color revertants both had small deletions that removed sequences from the 3' end of the P-element insert (including the first HindIII and BamHI sites up through the SacII and EcoRI sites at the w+ gene junction) and some DNA between the genomic SalI site 19 bp downstream, but retained 5' P-element sequences and flanking genomic DNA (Fig 8B, right gray bar). In contrast, all 10 independent viable but sterile eye color revertants of nup1541 characterized had deletions of the 5' portion of the P element and varying extents of 5'-flanking genomic DNA, but never deleted the 3' P end of the P element (0/10 lost the 3' HindIII and BamHI sites, and only 5/10 altered the internal SacII and EcoRI sites) or 3'-flanking genomic DNA (Fig 8B, left gray bar). Some of the viable but sterile revertants had deletions that removed flanking genomic DNA corresponding to the putative nup154 transcription start site based on the sequence of the wild-type 5'-RACE product (Fig 8B, thick bent arrow), consistent with the proposed expression of nup154 from an ectopic promoter within the 3' end of the P-element insert.

To further test the hypothesis of an ectopic promoter in the P element, we performed 5'-RACE on RNA derived from whole adult flies homozygous for either nup1541 (a PlacW insert) or tlp2 (a PZ insert) using gene-specific primers to the nup154 cDNA (Fig 8B). In all cases, production of the RACE product was dependent on addition of reverse transcriptase to the initial reaction. The size of the major 5'-RACE product was consistent with transcription starting within the 239 bp of the conserved P-element 3' end, assuming no introns. As predicted, sequence analysis revealed that the major 5'-RACE products from both nup1541 and tlp2 were chimeric, containing nup154 sequences attached to the 3' part of the P element (Fig 8, B–D). After crossing the boundary into the P-element 3' end, sequence from primers in nup154 became unreadable, perhaps due to secondary structure of P-element sequences. However, using primers within the P-element 3' end, we were able to sequence the 5' end of the RACE products from both nup1541 and tlp2 homozygotes.

In two independent experiments from nup1541 homozygotes, the 5' ends of the RACE products were located 74 bp from the P-element 3' end (Fig 8C and Fig D, single asterisk). Inspection of the P-element sequences at this site revealed a TCACTC element at 71–76 bp from the P-element 3' end that resembled the transcription initiator element TCA G/TT T/C (CHERBAS and CHERBAS 1993 Down). In addition, a well-conserved GACG element was found 44 nucleotides downstream of this initiator site, which resembled the G A/TCG downstream promoter element commonly found ~30–40 nucleotides downstream from initiator elements at TATA-less promoters (BURKE and KADONAGA 1996 Down; Fig 8C and Fig D). No TATA-box element was found in the upstream sequences. Similar sequence analysis of 5'-RACE products from tlp2 homozygotes in one case placed the 5' end at 103–105 nucleotides from the P-element 3' end (Fig 8C and Fig D, triple asterisks). This site lies within a potential initiator-like element, TCAATA at 100–105 nucleotides, and is just downstream of another potential initiator element, TCACTC at 110–115 nucleotides from the P-element 3' end (Fig 8C and Fig D). In other cases, the 5'-RACE product was either shorter or extended further into the P-element 3' end.

Consistent with occasional initiation of transcription from upstream of the consensus initiator elements, we were able to obtain RT-PCR products of the expected sizes from nup1541, tlp1, and tlp2 homozygotes using a primer to nup154 cDNA sequences and one of several different primers corresponding to sequences more 5' within the conserved P-element 3' end (Fig 8C and Fig D, arrows 1–3). Generation of the PCR products was always dependent on addition of reverse transcriptase in the cDNA synthesis reaction. Use of a primer directed against sequences specific to PlacW never yielded RT-dependent products, although the same primer was able to amplify nup1541 genomic DNA in control experiments (Fig 8C, arrow 4).

We propose that zygotic expression of an altered nup154 transcript starting in the 3' end of the P element may be sufficient to rescue lethality in the viable P-element-induced nup154 alleles, but not sufficient to satisfy the requirement for nup154 function in gametogenesis. The male and female sterility associated with the viable P-element insertions may be due to ineffective operation of the P-element 3' end internal promoter(s) in the germline. Indeed, Northern blot analysis revealed a drastic reduction in nup154 mRNA levels in ovaries from tlp1 homozygous females compared to wild type (Fig 8E).


*  DISCUSSION
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Drosophila nup154 is an essential, conserved nucleoporin:
nup154 encodes a nucleoporin based on both homology to yeast and vertebrate nucleoporins and localization of Nup154 to the nuclear pores (GIGLIOTTI et al. 1998 Down). This study showed by rescue with a wild-type nup154 transgene that mutations in lethal and sterile nup154 alleles are in the nucleoporin gene. Analysis of animals homo- or hemizygous for strong loss-of-function alleles indicated that nup154 has essential roles in growing tissues. As nup154 is essential for viability, the functional requirements for nup154 in Drosophila may be more stringent than those for its S. cerevisiae homologs NUP170 and NUP157, which are not essential. One explanation for this difference is that Drosophila might have only one Nup154-related gene while yeast has two that are functionally redundant. The high sequence homology between yeast Nup170p and Nup157p suggests at least some functional redundancy. Consistent with this hypothesis, mutations in NUP170 and NUP157 are synthetically lethal in double mutant strains (AITCHISON et al. 1995 Down; KENNA et al. 1996 Down). Biochemical analysis of the most abundant proteins in purified yeast and rat NPCs further supports the hypothesis that metazoan NPCs have only one homolog of the two yeast nucleoporins Nup170p and Nup157p. Purified yeast NPCs have relatively equal amounts of Nup170p and Nup157p, while rat NPCs lack a similarly abundant homolog of Nup155 (AITCHISON et al. 1995 Down; RADU et al. 1995 Down). Thus, if additional metazoan homologs of Nup170p and Nup157p exist, they do not appear to be stoichiometric components of the NPC core in rat liver, the tissue studied.

nup154 function is required in proliferating tissues:
The lethal phenotype of the strong loss-of-function nup154 alleles resembled the phenotypes of mutants that affect mitosis (GONZALEZ and GLOVER 1994 Down), including a larval-lethal phase with underproliferation of both imaginal tissues and the optic lobes. The number of NPCs per nucleus roughly doubles from G1 to anaphase of the yeast cell cycle (WINEY et al. 1997 Down), implicating the direct need for new NPC assembly during mitosis. The sensitivity of mitotically active or growing tissues to mutations in nup154 is in agreement with results from two different studies in yeast that suggest that the stoichiometry of Nup170p is important for proper NPC assembly. First, alterations in NUP170 expression levels in a pom152 null background modified the density of NPCs on the nuclear envelope in proportion to NUP170 dosage (AITCHISON et al. 1995 Down). Second, nup170 null alleles caused defects in NPC assembly, including partial mislocalization of the repeat nucleoporins Nup1p and Nup2p and, conversely, stabilization at the NPC of another unidentified repeat nucleoporin (KENNA et al. 1996 Down).

Expression of nup154 mRNA appeared to be developmentally regulated, both in overall levels (Fig 3) and specific tissue distribution (Fig 4 and Fig 5). However, Nup154 protein was present in all cells and stages examined (data not shown). We postulate that Nup154 protein perdures once incorporated into stable assembled NPCs. Thus nup154 mRNA synthesis may be required only in cells where there is a need for new NPC assembly, such as growing or dividing cells. The correlation between the expression pattern of nup154 mRNA in proliferating tissues and the phenotypic effects of the strong loss-of-function alleles is consistent with a requirement for newly synthesized nup154 in dividing cells for assembly of new NPCs.

We did not detect global defects in nucleocytoplasmic export or import in the female germline of strong loss-of-function alleles. This could be because of residual nup154 function due to stability of the protein, as mentioned above, or because nup154 mutations might impair transport of only certain mRNAs or proteins rather than completely disrupting NPC transport per se. Fourteen nuclear transport receptors with distinct classes of substrates and nucleoporin binding capabilities have been identified to date (GORLICH 1997 Down; PENNISI 1998 Down). Recently, Nup170p has been shown to be in a complex with two other nucleoporins that specifically binds the nuclear transport factor Kap121p (MARELLI et al. 1998 Down). Furthermore, in mammals, there are at least three subfamilies of karyopherin-{alpha} subunits that show differential, tissue-specific expression (TSUJI et al. 1997 Down). Thus, the range of nup154 mutant phenotypes could be due to the disruption of particular receptors that act or depend upon proper nup154 function in only certain tissues or stages of development. Alternatively, the range of nup154 mutant phenotypes could be due to differential expression of nup154 from an ectopic promoter associated with particular P-element inserts (see below).

Defects in cell proliferation in nup154 mutants may be due in part to indirect effects on the ability of nuclear transport receptors to translocate specific proteins required in mitotically active cells. In yeast, loss of NUP170 function had a reported decrease in growth rate (AITCHISON et al. 1995 Down), and temperature-sensitive mutations in the srp1 karyopherin-{alpha} transporter resulted in G2/M arrest at the restrictive temperature (LOEB et al. 1995 Down). Because Nup1p and Nup2p are thought to function in separate, redundant pathways for karyopherin-mediated transport (BELANGER et al. 1994 Down), the mislocalization of Nup1p and Nup2p away from the NPC in nup170 mutants could adversely affect nuclear transport, thus compromising mitotic cell cycle progression. We noted that the mRNA for Drosophila karyopherin-{alpha} (oho31) shares an overlapping expression pattern with nup154 mRNA, being localized to just below the pole cells in the early embryo and expressed in the embryonic and postembryonic CNS (TOROK et al. 1995 Down).

Molecular basis for different nup154 alleles:
The phenotypes observed in nup154 alleles did not fall into a simple allelic series reflecting quantitative differences. Even for the same allele, nup154 mutants caused strikingly different effects in different tissues. Our results support the possibility that this variability might result from molecular features particular to specific P-element insert alleles that could cause different levels of nup154 expression depending on the insertion site and insert orientation. Specifically, flies with a P element inserted in the nup154 5'-UTR in the same 5' to 3' orientation as the endogenous gene may be viable due to expression of a nup154 transcript in somatic cells from ectopic promoter(s) contained within the P-element 3' end (Fig 8). The different degree of defects in early stages of germ-cell differentiation in males vs. females for a given allele may be due to differential effectiveness of the P-element internal promoter in male vs. female germ cells. Similarly, in females, the P-element internal promoter may function more effectively in early egg chambers than in later germ cells.

Consistent with the hypothesis that an outward-directed P-element-promoter(s) can drive expression of neighboring genes, we identified chimeric nup154 transcripts with 5' ends originating from sites within the P-element 3' end. Although there appeared to be multiple transcription start sites, in several cases the ends of the 5'-RACE products were located at or near consensus promoter elements in the P-element 3' end in both PlacW- and PZ-induced insertion alleles. The TCACTC initiator elements located at 71–76 and 110–115 nucleotides in from the P-element 3' end are identical to the functional transcription initiation element demonstrated for the adenovirus major late promoter. The TCAATA element at 100–105 nucleotides is identical to sequences at the transcription initiation sites of at least six different arthropod genes (CHERBAS and CHERBAS 1993 Down). As the consensus initiator elements in the P-element 3' end are upstream of the conserved 31-nucleotide P-element inverted repeats found at both ends of P element, the region containing the transcription start sites in the P-element 3' end is not repeated in the 5' end. The presence of functional outward-directed transcription start sites in the 3' end but not the 5' end of P element may explain why viability vs. lethality correlated with the orientation of the P-element insert with respect to the direction of nup154 transcription.

A cryptic promoter within the P-element 3' end has also been implicated in the expression of a neighboring chromosomal gene in the case of the E-32 PZ insert in the out-at-first locus (BERGSTROM et al. 1995 Down). The E-32 insert is located in the out-at-first 5'-UTR in the same orientation as endogenous transcription, and deletion analysis indicated that the viability of the E-32 insert line is dependent on sequences in the P-element 3' end. The ability for transcription initiated from P-element sequences to drive expression of neighboring chromosomal genes is reminiscent of the promoter insertion mechanism associated with some retroviral-induced oncogenesis. Proviral insertions of partially deleted avian leukosis virus (ALV) into the 5'-UTR of the c-myc gene are associated with lymphomas due to transcription of chimeric c-myc RNA initiated from the right viral long terminal repeat (HAYWARD et al. 1981 Down).

Our results indicate that ectopic expression from promoter(s) within the P element can explain the generation of alleles with weak phenotypes by some P-element insertions, especially viable but sterile alleles of essential loci. This mechanism may account for some cases among the extensive collection of P-element-induced mutations in which phenotypic differences are observed between different P-element inserts in the same or nearby locations.


*  ACKNOWLEDGMENTS

We thank J. Hackstein for the nup1541 allele, C. Wood for recombination mapping nup1541, M. Fogarty for generating w- revertants of nup1541, and C. Tong for assistance with molecular aspects of this project. We are grateful to Ü. Schäfer for providing rpL9 deficiencies and rescue constructs, S. DiNardo for testis lacZ enhancer trap marker lines, and R. Lehmann for anti-Vasa antibody and cDNAs for making oskar RNA probes. The Stanford PAN facility generated oligonucleotides and helped with DNA sequencing. A.A.K. is grateful to M. Rexach, D. Traver, and the Fuller lab members for their helpful discussions and reviews of the manuscript. A.A.K. was supported by a Howard Hughes Medical Institute Predoctoral Fellowship. This work was supported by seed money from the Stanford Office of Technology and Licensing and by National Institutes of Health grants ROI-GM56500 (to M.T.F.) and POI-DK53074 (Irving Weissman, P.I.).

Manuscript received April 22, 1999; Accepted for publication June 21, 1999.


*  LITERATURE CITED
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

AITCHISON, J., M. ROUT, M. MARELLI, G. BLOBEL, and R. W. WOZNIAK, 1995  Two novel related yeast nucleoporins Nup170p and Nup157p: complementation with the vertebrate homologue Nup155p and functional interactions with the yeast nuclear pore-membrane protein Pom152p. J. Cell Biol. 131:1133-1148[Abstract/Free Full Text].

AKEY, C. W. and M. RADERMACHER, 1993  Architecture of the Xenopus nuclear pore complex revealed by three-dimensional cryo-electron microscopy. J. Cell Biol. 121:1-19[Abstract/Free Full Text].

ALTSCHUL, S. F., W. GISH, W. MILLER, E. W. MYERS, and D. J. LIPMAN, 1990  Basic local alignment search tool. J. Mol. Biol. 215:403-410[Medline].

BELANGER, K. D., M. A. KENNA, S. WEI, and L. I. DAVIS, 1994  Genetic and physical interactions between Srp1p and nuclear pore complex proteins Nup1p and Nup2p. J. Cell Biol. 126:619-630[Abstract/Free Full Text].

BERGSTROM, D. E., C. A. MERLI, J. A. CYGAN, R. SHELBY, and R. K. BLACKMAN, 1995  Regulatory autonomy and molecular characterization of the Drosophila out at first gene. Genetics 139:1331-1346[Abstract].

BIER, E., H. VAESSIN, S. SHEPARD, K. LEE, and K. MCCALL et al., 1989  Searching for pattern and mutation in the Drosophila genome with a P-lacZ vector. Genes Dev. 3:1273-1287[Abstract/Free Full Text].

BROWN, N. H. and F. C. KAFATOS, 1988  Functional cDNA libraries from Drosophila embryos. J. Mol. Biol. 203:425-437[Medline].

BURKE, T. W. and J. T. KADONAGA, 1996  Drosophila TFIID binds to a conserved downstream basal promoter element that is present in many TATA-box-deficient promoters. Genes Dev. 10:711-724[Abstract/Free Full Text].

CHERBAS, L. and P. CHERBAS, 1993  The arthropod initiator: the capsite consensus plays an important role in transcription. Insect Biochem. Mol. Biol. 23:8