| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Corresponding author: Günther E. Roth, Institut für Genetik, Freie Universität Berlin, Arnimallee 7, 14195 Berlin, Germany., groth{at}genetik.biologie.fu-berlin.de (E-mail)
Communicating editor: S. HENIKOFF
| ABSTRACT |
|---|
The Drosophila melanogaster gene Sgs-1 belongs to the secretion protein genes, which are coordinately expressed in salivary glands of third instar larvae. Earlier analysis had implied that Sgs-1 is located at the 25B2-3 puff. We cloned Sgs-1 from a YAC covering 25B2-3. Despite using a variety of vectors and Escherichia coli strains, subcloning from the YAC led to deletions within the Sgs-1 coding region. Analysis of clonable and unclonable sequences revealed that Sgs-1 mainly consists of 48-bp tandem repeats encoding a threonine-rich protein. The Sgs-1 inserts from single
clones are heterogeneous in length, indicating that repeats are eliminated. By analyzing the expression of Sgs-1/lacZ fusions in transgenic flies, cis-regulatory elements of Sgs-1 were mapped to lie within 1 kb upstream of the transcriptional start site. Band shift assays revealed binding sites for the transcription factor fork head (FKH) and the factor secretion enhancer binding protein 3 (SEBP3) at positions that are functionally relevant. FKH and SEBP3 have been shown previously to be involved in the regulation of Sgs-3 and Sgs-4. Comparison of the levels of steady state RNA and of the transcription rates for Sgs-1 and Sgs-1/lacZ reporter genes indicates that Sgs-1 RNA is 100-fold more stable than Sgs-1/lacZ RNA. This has implications for the model of how Sgs transcripts accumulate in late third instar larvae.
IN Drosophila melanogaster the salivary glands of third instar larvae produce a sticky secretion by which the larvae attach themselves to a solid surface prior to puparium formation. The secretion consists of glycoproteins (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Sgs-3, -4, -5, -7, and -8 have been isolated from a salivary gland cDNA library, using as probes total poly(A) RNA isolated from salivary glands of different developmental stages (![]()
![]()
![]()
![]()
![]()
![]()
![]()
vectors. However, the gene can be maintained on a YAC. The cause for the instability in E. coli is unknown, but very likely it was the reason for the difficulties in cloning this gene.
Analysis of the transcriptional regulation of Sgs-1 by means of P-element transformations and mobility shift assays shows that Sgs-1 is a target gene of the transcription factor FKH, encoded by the fork head (fkh) gene, which previously has been shown to control the tissue-specific expression of Sgs-3 and Sgs-4 (![]()
![]()
![]()
![]()
| MATERIALS AND METHODS |
|---|
Drosophila strains:
D. melanogaster wild-type strains Hikone, Sevelen, Oregon-N, Falsterbo, Bakup, Karsnäs, Kochi-R, Canton-S, and the transformant line E5 (![]()
Protein analysis:
Secretion proteins were analyzed as described (![]()
DNA methods:
A cosmid library of strain E5 was constructed in pWE15 (Stratagene, La Jolla, CA). Overlapping fragments from Cos1 and Cos2 were sequenced by using the Sequenase 2.0 kit (Amersham, Buckinghamshire, UK). Both strands of the Sgs-1 upstream sequence up to nucleotide (nt) -1022 were sequenced. For details of the sequencing strategy see ![]()
Isolation of YAC E02-38:
The Saccharomyces cerevisiae strain containing YAC E02-38 was provided by D. Hartl (![]()
Cloning of Sgs-1 fragments in E. coli:
YAC DNA was digested by restriction enzymes and fractionated on agarose gels, and DNA was eluted from the appropriate region. Southern hybridization confirmed that the eluted DNA contained sequences homologous to cDNA-fr2 (see RESULTS). Restriction fragments, vectors, and E. coli strains used for subcloning are given in Table 1. In Experiments 13 (Table 1) 5000 transformants were screened using cDNA-fr2 as a probe. DNA from 20 clones was analyzed. Most inserts had the size expected; none of them hybridized to cDNA-fr2. Experiment 7 yielded pYS-38 (Fig 2). pLEX5R is a derivative of vectors described in ![]()
|
|
|
RNA analysis:
Lithium-salt method:
Third instar larvae were dissected in ice-cold "Tübingen" Ringer (![]()
![]()
![]()
TRIzol reagent method:
TRIzol reagent (GIBCO BRL, Gaithersburg, MD) was used following the instructions of the manufacturer. Poly(A) RNA was purified from RNA isolated by the guanidine-salt method followed by centrifugation through cesiumtrifluoroacetate. By two cycles of oligo(dT) cellulose chromatography poly(A) RNA was enriched. For Northern blots total RNA was electrophoretically separated according to ![]()
RT-PCR:
Poly(A) RNA was reverse transcribed by M-MLV RT (GIBCO BRL) and the oligonucleotide bo17 (5' ATGAGTCGAGACTCCATAAGCGGCCGCTTTACG-d(T)17 3') as a 3' adapter primer. A d(A) anchor was added by terminal transferase as an annealing site for the bo17 primer-adapter in the second strand synthesis and amplification. RNA was digested with RNaseH, RNaseA, and RNaseT1. The amplification reaction started from 1/20,000th salivary gland template cDNA with 5 pmol bo17 and 100 pmol bo16 primer (5' ATGAGTCGAGACTCCATAAGCGGCCGCTTTACG 3'). PCR products were fractionated on low-melting-point agarose and reamplified.
Isolation of cDNA clones:
cDNA clone pZ321 was isolated from an oligo(dT)-primed cDNA library, constructed from salivary gland RNA of third instar larvae of strain Karsnäs. The 5' rapid amplification of cDNA ends (RACE) system (GIBCO BRL) was used to amplify the 5' end of Sgs-1 cDNA. RNA from salivary glands of strain Oregon-N was isolated by the lithium method. The Sgs-1-specific primer Sg-5 (5'-AGAGCATGTGCACTCCG-3', position 500-484) was chosen for the first strand synthesis, and the nested primer Sgn5 (5'-GGTAGTCCTCTTGGTGGC-3', position 407-390) for amplification. After gel purification of PCR products the 341-bp fragment was subcloned into EcoRV-restricted dT-tailed pBluescript to yield pFEG 4.2 (Fig 1).
Construction of transformation plasmids and P-element transformation:
The starter plasmid for all transformation constructs consisted of Sgs-1 sequences from the EcoRI site at nt -44 to the MseI site at nt +56, linked by a BamHI linker to a 3.4-kb BamHI-HindIII lacZ fragment from E. coli, derived from pPASL (![]()
![]()
|
|
|
LacZ expression assays:
Histochemical staining assays on dissected larvae were performed as described (![]()
![]()
Run-on analysis:
A total of 100 pairs of salivary glands was incubated in 40 µl of 35 mM Tris pH 8.0, 17 mM MgCl2, 270 mM KCl, 18 µl of 10% N-lauryl sarcosine, 210 µl of Ringer solution, 25 µl of
32P-UTP (6000 Ci/mmol), and 0.75 µl of each ATP, CTP, and GTP (100 mM) at 30° for 30 min. The mixture was incubated with 5 units of RNase-free DNase I for 10 min at 37°. After addition of 36 µl of 10% SDS, 50 mM EDTA, 100 mM Tris, pH 7.4, and incubation with Proteinase K (10 µl of 20 mg/ml) the mixture was extracted twice with phenol/chloroform, ethanol precipitated, resuspended in 100 µl TE, and spun through a Sephadex G50 column. The eluted RNA was added to 500 µl of 10 mM TES (Sigma, St. Louis), 1% SDS, 10 mM EDTA, 300 mM NaCl, 1x Denhardt's solution, 0.25% milk powder, 200 µg/ml E. coli RNA, and hybridized with filter-bound DNA at 65° for 18 hr. Filters were washed at room temperature in 2x SSC and incubated at 37° for 30 min with 10 mg/ml RNase A in 2x SSC. Filters were rinsed in 1x SSC/0.1% SDS, washed at 65° in 0.1x SSC/1% SDS, and exposed at -80°. Signals were analyzed densitometrically. A total of 1 µg of the following DNAs was dot blotted: 3.3-kb HindIII-BamHI fragment of pPASL (lacZ); 2.4-kb SalI fragment of paDm 2023 (Sgs-3); 2.0-kb EcoRI fragment of pOR6A (Sgs-4); 2.0-kb NotI-HindIII fragment of Cos1 (Sgs-1); linearized pBluescript.
Mobility shift DNA-binding assay:
Mobility shift assays were carried out as described (![]()
-32P]dCTP by a fill-in reaction. The anti-FKH antiserum was a gift from P. Carrera and H. Jäckle. Anti-FKH antibodies and antibodies from a normal serum were purified prior to use (![]()
![]()
![]()
|
|
|
| RESULTS |
|---|
YAC E02-38 contains sequences complementary to salivary gland cDNA:
By means of variants of the SGS-1 protein the Sgs-1 gene had been mapped to the second chromosome between 25A3 and 25D2 (![]()
![]()
![]()
YAC DNA fragments are not stable in E. coli:
We soon realized that subcloning of these fragments was not trivial. Different plasmid vectors and E. coli hosts were used without success (see MATERIALS AND METHODS and Table 1). When we used
Zap II to clone DNA from the 6.3-kb region of EcoRI-digested YAC DNA, positive plaques were obtained by screening with cDNA-fr2. Insert DNA from 12 clones was analyzed, both from plasmid DNA isolated by in vivo excision and infection of XL-1 cells, as well as from
DNA, isolated directly. Surprisingly, in all clones the size of the EcoRI insert was ~3.8 kb. The insert of one clone, pYS-38, was hybridized against restricted YAC DNA: it detects a 6.3-kb EcoRI fragment, a 4.6-kb HindIII fragment, and a 4.3-kb EcoRI-HindIII fragment (data not shown, but see Fig 1), as does the cDNA-fr2 probe. In addition, fragments of 2.1 kb and 1.9 kb appeared in the HindIII and the HindIII + EcoRI digest, respectively. Thus, in the course of the subcloning, 2.5 kb of the 6.3-kb EcoRI fragment was deleted (Fig 1).
YAC subclone pYS-38 contains Sgs-1 sequences:
The SGS-1 protein polymorphism was used to analyze whether pYS-38 contains Sgs-1 sequences. Nine D. melanogaster stocks were selected, showing either three SGS-1 protein bands (Hikone), two bands (E5, Karsnäs), one band (Samarkand, Oregon, Falsterbo, Kochi-R, Canton-S), or no band at all (Bakup) in the gel (Fig 2A). Third larval instar RNA and genomic DNA were hybridized with pYS-38 (Fig 2B and Fig C). The hybridization patterns of both Northern and Southern analyses are strikingly similar to the SGS-1 protein pattern of the different stocks. The patterns correspond to each other in six of the nine stocks (Hikone, H; E5, E; Karsnäs, K; Samarkand, S; Oregon, O; Canton-S, C). In the stocks Falsterbo (F) and Kochi-R (Ko), RNA and DNA analyses show a major band that in its mobility corresponds to that of the protein and an additional minor band. In the case of Falsterbo (F) it is very likely that this allele was underrepresented in those animals from which the secretion was prepared. In the case of Kochi-R (Ko) the band is detected only in the DNA analysis, running close to the major band, and possibly was unresolved by both protein and RNA analysis. Remarkably, the stock Bakup (B) that apparently produces no SGS-1 protein does show a band in the Northern analysis; it is the longest RNA (6.5 kb) of the stocks analyzed. Despite these inconsistencies, from the overall picture it is obvious that pYS-38 contains sequences of the Sgs-1 gene. The variation in the electrophoretic mobility of the proteins is caused by Sgs-1 alleles of different lengths, which is reflected by EcoRI fragments of different sizes.
Genomic organization and partial sequence of Sgs-1:
By the use of subfragments of pYS-38 and of Cos1 and Cos2 as probes in Southern analyses of genomic and YAC DNA and in Northern experiments we found that Sgs-1 coding sequences are all represented in the left-hand 1.8-kb EcoRI-HindIII fragment of pYS-38. This fragment derives from a 4.3-kb EcoRI-HindIII fragment of the YAC, parts of which were deleted during the cloning of pYS-38 (Fig 1). Screening of a salivary gland cDNA library with pYS-38 resulted in the isolation of cDNA clone pZ321. The sequence of pZ321 positions the 3' end of Sgs-1, as shown in Fig 1. Since we had not obtained clones longer than pZ321 we selected gene-specific primers from the 3.4-kb EcoRI fragment of Cos1 and amplified the 5' terminal region of the Sgs-1 RNA by means of a 5'-RACE system. This led to cDNA clone pFEG 4.2 (Fig 1). Sequence analysis of cosmid and cDNA clones revealed the structure of Sgs-1: the start site of transcription lies within the 139-bp EcoRI fragment. The transcript contains an untranslated leader sequence of 32 bp followed by the first coding region of 30 bp and an intron of 66 bp. Reading 5' to 3', the deduced amino acid sequence of the second exon shows an increasing frequency of threonine residues. The terminal sequences of both Cos1 and Cos2 and also the cDNA clone pZ321 contain a series of a 48-bp repetitive unit that codes for 16 amino acids with a threonine content of 56%. The amino acid sequence of the repetitive units is not strictly conserved. A representative example has the following sequence: T S T S R P T T T T P R S T T T. The array of repeats ends about 450 bp 5' to the stop codon. A total of 23 repeats have been found by sequence analysis.
Between the different D. melanogaster strains the transcript size varies from 4 kb to 6.5 kb (Fig 2). It is very likely that this variation is caused by different numbers of repeats. This assumption is supported by the observation that the size difference of the alleles lies within the EcoRI-EcoRV fragment (Fig 1) that contains the repeats (data not shown).
In situ hybridization to polytene chromosomes using pYS-38 as a probe shows that Sgs-1 is located at 25B1-3, the site which shows puffing during the secretion synthesis phase. Sequence comparison of the transcribed region of Sgs-1 with that of the other secretion genes reveals a relationship to Sgs-3, -7, and -8 but not to Sgs-4 (see DISCUSSION).
The uncloned sequences consist of repetitive elements similar to the 48-bp repeats:
Sequence analysis of pYS-38 and of Cos1 DNA had shown that most of the 48-bp repeat units contain Sau3A cleavage sites. By using the size of the EcoRI-EcoRV fragment of pYS-38, and the Sau3A restriction pattern as well as the pattern of hybridization when using a 96-bp dimer fragment as a probe, we determined the number of 48-bp repeats in pYS-38 to be eight (data not shown). This was used as a measure to estimate the number of repeats in YAC DNA. YAC and pYS-38 DNA were digested by EcoRI + EcoRV and hybridized with the 96-bp dimer fragment. The amount of loaded DNAs was normalized by means of the 1.5-kb EcoRI-XbaI fragment of pYS-38 as a probe. Densitometric analysis showed that the 3.6-kb EcoRI-EcoRV fragment of the YAC contains about 10 times more sequences hybridizing to the 96-bp fragment than pYS-38 (data not shown), which is equivalent to 3840 bp (48 x 8 x 10). This obviously is an overestimation; however, the result supports the hypothesis that the uncloned sequences consist of elements similar to the 48-bp repeat unit.
This interpretation is supported by a second independent observation. To analyze more
clones containing YAC DNA, we repeated the experiments that had led to the isolation of pYS-38 and analyzed seven new
clones. The size of the EcoRI-EcoRV fragment that carries the 48-bp repeats was determined directly from
lysates without subcloning. Fig 3 shows that the insert DNA of all clones is heterogeneous in length, appearing as a ladder on an agarose gel. The difference in size between the bands of the ladder equals the length of one repeat unit (48 bp). This strongly suggests that the process that leads to the elimination of DNA acts on the Sgs-1 repeat unit.
Sgs-1 RNA is detected only in the secretion cells of salivary glands of third instar larvae:
The Sgs-1 gene is expressed exclusively in salivary glands of third instar larvae. In Northern analysis of total RNA isolated from various developmental stages and from adult flies, using pYS-38 as a probe, a strong signal is obtained only with RNA from third instar larvae and a weak signal is detectable in white prepupae (Fig 4A). The signal is restricted to salivary glands; it is not detectable in RNA from larvae after removal of the glands (Fig 4B). This result is confirmed by in situ hybridization with tissues of third instar larvae. Sgs-1 expression is found only in the posteriornot in the anteriorcells of the salivary gland (data not shown).
A total of 1 kb of Sgs-1 upstream sequence is sufficient for proper expression of a reporter gene:
To localize cis-regulatory sequences of Sgs-1, upstream fragments were fused with the E. coli ß-galactosidase gene and stably transformed into D. melanogaster (Fig 5). Gene expression in transformants was analyzed by ß-galactosidase staining of third instar larvae and by measuring ß-galactosidase activity (Table 2). Besides construct C-44, which does not show any staining or measurable enzyme activity, all constructs lead to correct expression, i.e., staining exclusively in salivary glands of third instar larvae. Table 2 shows that there are considerable differences in Sgs-1 expression between lines transformed with the same construct. This is likely due to position effects. Comparing the ß-galactosidase activity of the lines carrying shortened upstream sequences, three groups with clearly differing activities are observed: (i) lines that carry C-1806 and C-1021 show the highest activity. The expression of C-1806 with the longest upstream fragment was taken as 100%. (ii) Shortening of the upstream sequences to nt -623, nt -369, and nt -271 leads to a 4- to 10-fold reduction of expression. (iii) Shortening to nt -182 leads to a further 10-fold decrease; only a few salivary gland cells are stained in these lines.
|
By comparing the Sgs-1 upstream sequence with that of the other Sgs genes, we detected a region similar to the distal promoter region of Sgs-3 (Fig 6). Deletion or replacement of those sequences led to a 95% reduction of Sgs-3 expression (![]()
![]()
Taken together, the data indicate that several sequence elements required for full expression are distributed within 1 kb of upstream sequence. Elements sufficient for weak but specific expression are still contained in the construct C-182.
Compared to Sgs-1 RNA the Sgs-1-lacZ fusion RNA is transcribed at "normal" rates, but is unstable:
The enzyme activity of the Sgs-1-lacZ fusion containing 1.8 kb of Sgs-1 upstream sequences was taken as 100% (C-1806, Fig 5). To compare the transcriptional activity of these transgenes with that of the endogenous Sgs-1 gene we analyzed the levels of steady state mRNAs transcribed from both genes in line C-1806-25B (Table 2). Surprisingly, in dot blot analyses on total salivary gland RNA we found that lacZ RNA is about 100-fold less abundant than Sgs-1 RNA. Northern analyses of poly(A)+ RNA confirm this ratio and, in addition, indicate that lacZ RNA is polyadenylated as expected (see MATERIALS AND METHODS). To measure promoter strength more directly we performed run-on analyses. In two independent assays we found that nascent lacZ RNA is only ~2-fold less than nascent Sgs-1 RNA (Fig 7). Considering position effects we conclude that 1.8 kb of upstream sequences are sufficient for full expression of the Sgs-1 gene. The comparison of the results of the two types of experiments indicates that the endogenous Sgs-1 RNA is considerably more stable than the Sgs-1-lacZ fusion RNA.
The Sgs-1 regulatory region contains binding sites for known regulators of Sgs gene expression:
To test if the transcription factor FKH, which has previously been shown to control the tissue-specific expression of Sgs-3 and -4 (![]()
![]()
![]()
![]()
| DISCUSSION |
|---|
The genes Sgs-3, -4, -5, -7, and -8 have been isolated from the same library of cDNAs, synthesized from poly(A) RNA obtained from larval salivary glands of the intermolt puff stage, and inserted into the plasmid vector pSC105 (![]()
The complete Sgs-1 gene can be maintained on a YAC in yeast cells. However, all our approaches to subclone Sgs-1 gene fragments from the YAC, or directly from genomic DNA, onto plasmid or
vectors in E. coli led to deletions of DNA sequences, despite using low-copy-number vectors and E. coli host strains that lack homologous recombination (XL-1) or, in addition, are defective in DNA repair systems (Sure). The latter strain has been reported to allow cloning of inverted repeats (![]()
dash II, which should not produce fusion proteins.
It seems that those sequences that we cannot subclone from the YAC are related to the repeats that can be cloned, as they cross-hybridize with each other and consist, at least in part, of repeats with 48 bp in length (Fig 3). The clonable sequences do not contain inverted repeats, yet it is possible that the unclonable repeats contain such sequences. A mechanism known to lead to the elimination of direct repeats is "replication slippage." In an in vitro system it has been shown that DNA polymerase holoenzyme III of E. coli can slip between repeats, provided that a hairpin structure can form between the repeats (![]()
The structure of the SGS-1 protein is similar to that of the majority of the other secretion proteins, including those of D. virilis, LGP-1 and LGP-3 (![]()
![]()
![]()
![]()
![]()
For two reasons it seems that Sgs-1, -3, -7, and -8 of D. melanogaster and Lgp-1 and Lgp-3 of D. virilis belong to a family of homologous genes. First, all these genes contain a single intron of ~60 bp at identical positions, following the first nucleotide of the 10th codon. Second, a comparison of their amino acid sequences using Clustal-W (![]()
![]()
![]()
![]()
![]()
Most surprising to us is the observation that the steady-state level of Sgs-1-lacZ RNA is about 100-fold less than that of the endogenous Sgs-1 RNA, whereas their rates of transcription are similar. Steady-state levels were determined by Northern and dot hybridizations, transcription rates by run-on analyses. Both transcripts are polyadenylated and there is no indication for inefficient polyadenylation of Sgs-1-lacZ RNA as we detected only faint signals in the flow through obtained by the fractionation of RNA (data not shown). We therefore conclude that the Sgs-1 enhancer is contained within 1.0 kb of upstream sequence and that the difference in the amount of steady-state RNA is due to a difference in the stability of the two types of poly(A) RNA. One plausible explanation for this is that Sgs-1-lacZ RNA is unstable as it contains E. coli sequences. An alternative view is that Sgs-1 transcripts are specifically stabilized. This is supported by the observation that a rosy+ transgene controlled by the Sgs-4 enhancer forms strong puffs and produces xanthine dehydrogenase in salivary glands, but leads to only very low levels of steady-state rosy+ RNA (G. E. ROTH and A. KRUMM, unpublished results). In the extreme consequence this could mean that the dramatic increase in Sgs RNA between early and late third instar (![]()
![]()
![]()
![]()
| FOOTNOTES |
|---|
1 These authors contributed equally to this work. ![]()
2 Present address: Lexicon Genetics Incorporated, The Woodlands, Texas 77381. ![]()
| ACKNOWLEDGMENTS |
|---|
We thank Ruth Brockmann and Madeleine Brünner for technical assistance and Anton Krumm for advice with the run-on experiments. We also thank D. Hartl for providing YAC E02-38, W. Messer for various plasmids, and P. Carrera, H. Jäckle, D. King, and F. Kafatos for antibodies. This work has been supported by the Freie Universität Berlin through an FPS grant to G.E.R., by the Graduiertenförderung through a grant to S.W., and by the Deutsche Forschungsgemeinschaft (SFB 344) through a grant to G.K.
Manuscript received February 8, 1999; Accepted for publication June 4, 1999.
| LITERATURE CITED |
|---|
AJIOKA, J. W., D. A. SMOLLER, R. W. JONES, J. P. CARULLI, and A. E. VELLEK et al., 1991 Drosophila genome project: one-hit coverage in yeast artificial chromosomes. Chromosoma 100:495-509[Medline].
ASHBURNER, M., 1972 Puffing patterns in Drosophila melanogaster and related species, pp. 101151 in Developmental Studies on Giant Chromosomes, edited by W. BEERMANN. Springer-Verlag, Berlin.
ASHBURNER, M., 1989 Drosophila: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
BARNETT, S. W., K. FLYNN, M. K. WEBSTER, and S. K. BECKENDORF, 1990 Noncoordinate expression of Drosophila glue genes: Sgs-4 is expressed at many stages and in two different tissues. Dev. Biol. 140:362-373[Medline].
BECKENDORF, S. K. and F. C. KAFATOS, 1976 Differentiation in the salivary glands of Drosophila melanogaster: characterization of the glue proteins and their developmental appearance. Cell 9:365-373[Medline].
BECKER, H. J., 1959 Die Puffs der Speicheldrüsenchromosomen von Drosophila melanogaster.. Chromosoma 10:654-678.
BORNSCHEIN, H., 1994 Klonierung und Charakterisierung des Pre-intermolt-Gens Pig-2 und PCR-Amplifikation einer cDNA-Fraktion zur Klonierung des intermolt-Gens Sgs-1 von Drosophila melanogaster. Thesis, Fachbereich Biologie. Freie Universität Berlin, Berlin.
CANCEILL, D. and S. D. EHRLICH, 1996 Copy-choice recombination mediated by DNA polymerase III holoenzyme from Escherichia coli.. Proc. Natl. Acad. Sci. USA 93:6647-6652
CHOMCZYNSKI, P. and N. SACCHI, 1987 Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162:156-159[Medline].
CROWLEY, T. E., M. W. BOND, and E. M. MEYEROWITZ, 1983 The structural genes for three Drosophila glue proteins reside at a single polytene chromosome puff locus. Mol. Cell. Biol. 3:623-634
DIEDERICH, L., A. ROTH, and W. MESSER, 1994 A versatile plasmid vector system for the regulated expression of genes in Escherichia coli.. Biotechniques 16:916-923[Medline].
FOURNEY, M. A., I. MIYAKOWSK, R. S. DAY and M. C. PATERSON, 1988 Northern blotting: efficient RNA staining and transfer, pp. 57 in Focus, Vol. 10, edited by N. SASAVAGE. Life Technologies Inc., Gaithersburg, MD.
GEORGEL, P., P. RAMAIN, A. GIANGRANDE, G. DRETZEN, and G. RICHARDS et al., 1991 Sgs-3 chromatin structure and trans-activators: developmental and ecdysone induction of a glue enhancer-binding factor, GEBF-I, in Drosophila larvae. Mol. Cell. Biol. 11:523-532
GEORGEL, P., G. DRETZEN, K. JAGLA, F. BELLARD, and E. DUBROVSKY et al., 1993 GEBF-I activates the Drosophila Sgs-3 gene enhancer by altering a positioned nucleosomal core particle. J. Mol. Biol. 234:319-330[Medline].
GREENER, A., 1990 E. coli SURE TM strain: clone unclonable DNA, pp. 56 in Strategies in Molecular Biology, Vol. 3, edited by A. POLLARD. Stratagene, La Jolla, CA.
GUILD, G. M., 1984 Molecular analysis of a developmentally regulated gene which is expressed in the larval salivary gland of Drosophila.. Dev. Biol. 102:462-470[Medline].
HOFMANN, A. and M. LEHMANN, 1998 The transcriptional switch between the Drosophila genes Pig-1 and Sgs-4 depends on a SEBP1 binding site within a shared enhancer region. Mol. Gen. Genet. 259:656-663[Medline].
HOFMANN, A., A. KEINHORST, A. KRUMM, and G. KORGE, 1987 Regulatory sequences of the Sgs-4 gene of Drosophila melanogaster analysed by P element-mediated transformation. Chromosoma 96:8-17[Medline].
HOFMANN, A., M. D. GARFINKEL, and E. M. MEYEROWITZ, 1991 Cis-acting sequences required for expression of the divergently transcribed Drosophila melanogaster Sgs-7 and Sgs-8 glue protein genes. Mol. Cell. Biol. 11:2971-2979
KAUFMANN, E., M. HOCH, and H. JÄCKLE, 1994 The interaction of DNA with the DNA-binding domain encoded by the Drosophila gene fork head. Eur. J. Biochem. 223:329-337[Medline].
KORGE, G., 1975 Chromosome puff activity and protein synthesis in larval salivary glands of Drosophila melanogaster.. Proc. Natl. Acad. Sci. USA 72:4550-4554
KORGE, G., 1977 Larval saliva in Drosophila melanogaster: production, composition, and relationship to chromosome puffs. Dev. Biol. 58:339-355[Medline].
KORGE, G., 1980 Gene activities in larval salivary glands of insects. Verh. Dtsch. Zool. Ges., 94110.
KORGE, G., 1981 Genetic analysis of the larval secretion gene Sgs-4 and its regulatory chromosome sites in Drosophila melanogaster.. Chromosoma 84:373-390[Medline].
KRUMM, A., G. E. ROTH, and G. KORGE, 1985 Transformation of salivary gland secretion protein gene Sgs-4 in Drosophila: stage- and tissue-specific regulation, dosage compensation, and position effect. Proc. Natl. Acad. Sci. USA 82:5055-5059
LANIO, W., U. SWIDA, and H. KRESS, 1994 Molecular cloning of the Drosophila virilis larval glue protein gene Lgp-3 and its comparative analysis with other Drosophila glue protein genes. Biochim. Biophys. Acta 1219:576-580[Medline].
LEHMANN, M., 1996 Drosophila Sgs genes: stage and tissue specificity of hormone responsiveness. Bioessays 18:47-54[Medline].
LEHMANN, M. and G. KORGE, 1995 Ecdysone regulation of the Drosophila Sgs-4 gene is mediated by the synergistic action of ecdysone receptor and SEBP 3. EMBO J. 14:716-726[Medline].
LEHMANN, M. and G. KORGE, 1996 The fork head product directly specifies the tissue-specific hormone responsiveness of the Drosophila Sgs-4 gene. EMBO J. 15:4825-4834[Medline].
LEHMANN, M., F. WATTLER, and G. KORGE, 1997 Two new regulatory elements controlling the Drosophila Sgs-3 gene are potential ecdysone receptor and fork head binding sites. Mech. Dev. 62:15-27[Medline].
MACH, V., K. OHNO, H. KOKUBO, and Y. SUZUKI, 1996 The Drosophila fork head factor directly controls larval salivary gland-specific expression of the glue protein gene Sgs-3.. Nucleic Acids Res. 24:2387-2394
MEYEROWITZ, E. M. and D. S. HOGNESS, 1982 Molecular organization of a Drosophila puff site that responds to ecdysone. Cell 28:165-176[Medline].
MUSKAVITCH, M. A. and D. S. HOGNESS, 1980 Molecular analysis of a gene in a developmentally regulated puff of Drosophila melanogaster.. Proc. Natl. Acad. Sci. USA 77:7362-7366
RAGHAVAN, K. V., M. A. CROSBY, P. H. MATHERS, and E. M. MEYEROWITZ, 1986 Sequences sufficient for correct regulation of Sgs-3 lie close to or within the gene. EMBO J. 5:3321-3326[Medline].
THOMPSON, J. D., D. G. HIGGINS, and T. J. GIBSON, 1994 CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673-4680
TODO, T., M. ROARK, K. V. RAGHAVAN, C. MAYEDA, and E. MEYEROWITZ, 1990 Fine-structure mutational analysis of a stage- and tissue-specific promoter element of the Drosophila glue gene Sgs-3.. Mol. Cell. Biol. 10:5991-6002
VELISSARIOU, V. and M. ASHBURNER, 1980 The secretory proteins of the larval salivary gland of Drosophila melanogaster: cytogenetic correlation of a protein and a puff. Chromosoma 77:13-27[Medline].
WALTERS, M. C., S. FIERING, J. EIDEMILLER, W. MAGIS, and M. GROUDINE et al., 1995 Enhancers increase the probability but not the level of gene expression. Proc. Natl. Acad. Sci. USA 92:7125-7129
WALTERS, M. C., W. MAGIS, S. FIERING, J. EIDEMILLER, and D. SCALZO et al., 1996 Transcriptional enhancers act in cis to suppress position-effect variegation. Genes Dev. 10:185-195
WATTLER, S., 1995 Isolierung des larvalen Sekretproteingens Sgs-1 von Drosophila melanogaster und Analyse der Regulation seiner Expression. Thesis, Fachbereich Biologie. Freie Universität Berlin, Berlin.
WEINTRAUB, H., 1988 Formation of stable transcription complexes as assayed by analysis of individual templates. Proc. Natl. Acad. Sci. USA 85:5819-5823
WOLFNER, M. F., 1980 Ecdysone-responsive genes of the salivary glands of Drosophila melanogaster. Ph.D. Thesis, Stanford University, Stanford, CA.
This article has been cited by other articles:
![]() |
C. Cao, Y. Liu, and M. Lehmann Fork head controls the timing and tissue selectivity of steroid-induced developmental cell death J. Cell Biol., March 12, 2007; 176(6): 843 - 852. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME |