Origination of Ds Elements From Ac Elements in Maize: Evidence for Rare Repair Synthesis at the Site of Ac Excision

Corresponding author: Hugo K. Dooner, The Waksman Institute, Rutgers University, Piscataway, NJ 08855., dooner{at}waksman.rutgers.edu (E-mail)

Communicating editor: J. A. BIRCHLER

	ABSTRACT

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Although it has been known for some time that the maize transposon Ac can mutate to Ds by undergoing internal deletions, the mechanism by which these mutations arise has remained conjectural. To gain further insight into this mechanism in maize we have studied a series of Ds elements that originated de novo from Ac elements at known locations in the genome. We present evidence that new, internally deleted Ds elements can arise at the Ac donor site when Ac transposes to another site in the genome. However, internal deletions are rare relative to Ac excision footprints, the predominant products of Ac transposition. We have characterized the deletion junctions in five new Ds elements. Short direct repeats of variable length occur adjacent to the deletion junction in three of the five Ds derivatives. In the remaining two, extra sequences or filler DNA is inserted at the junction. The filler DNAs are identical to sequences found close to the junction in the Ac DNA, where they are flanked by the same sequences that flank the filler DNA in the deletion. These findings are explained most simply by a mechanism involving error-prone DNA replication as an occasional alternative to end-joining in the repair of Ac-generated double-strand breaks.

THE maize transposon Activator (Ac) was the first autonomous element described by MCCLINTOCK 1949 . Autonomous elements, such as Ac, Spm, and MuDR, can transpose on their own, whereas their counterpart nonautonomous elements (respectively, Ds, dSpm, and Mu1) cannot and require the presence of the autonomous element for transposition (MCCLINTOCK 1956A ; CHOMET et al. 1991 ). MCCLINTOCK 1956B , MCCLINTOCK 1962 , MCCLINTOCK 1963 reported several instances in which the Ac element at a locus appeared to mutate to Ds and referred to this change as the origination of a two-element system from a one-element system. Subsequent molecular characterization of three such Ds elements revealed that they had arisen by the deletion of internal sequences from Ac (reviewed in FEDOROFF 1989 ).

In other transposons, like the P element from Drosophila (OAHARE and RUBIN 1983 ; TAKASU-ISHIKAWA et al. 1992 ) and the MuDR element from maize (HSIA and SCHNABLE 1996 ), internal deletions tend to occur between short direct repeats of a few base pairs. These findings have led to the proposal that defective P and Mu elements arise by some type of repair synthesis of the double-strand break (DSB) generated upon transposon excision (ENGELS et al. 1990 ; NASSIF et al. 1994 ; LISCH et al. 1995 ; HSIA and SCHNABLE 1996 ). Somatic rearrangements of an Ac element in transgenic tobacco, isolated by PCR, also consisted mostly of internal deletions with breakpoints occurring at short repeats (RUBIN and LEVY 1997 ). Abortive gap repair was likewise postulated as the underlying mechanism for the origin of those rearrangements, as well as of new Ds elements. Yet, the deletion junctions in the two de novo arisen Ds elements that have been sequenced in maize, wx-m9(Ds) and bz-m2(DI) (POHLMAN et al. 1984 ; DOONER et al. 1986 ), provide little clue as to how new Ds elements may originate from Ac. There is no direct repeat adjacent to the deletion junction in the former, and in the latter the direct repeat is only 3 bp long. Ample additional evidence supports a role for repair synthesis of P-element-induced DSBs in Drosophila: the frequency of P-element excision is homology dependent and excision of the element promotes a form of efficient premeiotic gene conversion (ENGELS et al. 1990 ; GLOOR et al. 1991 ; LANKENAU et al. 1996 ). Ac, on the other hand, does not display either of these properties: the frequency of Ac excision at meiosis does not depend on the makeup of the homolog, and excision of Ac is repaired almost exclusively by end-joining (DOONER and MARTINEZ-FEREZ 1997 ). Furthermore, Ds deletion derivatives arise much more rarely than nonautonomous defective P elements. Therefore, based on the available evidence, it is not clear that the mechanism generally proposed for the origin of defective transposable elements, interrupted or abortive gap repair, also operates in the generation of new Ds elements from Ac.

To gain further insight into the possible mechanism of origin of Ds from Ac, we set up genetic screens to isolate new Ds derivatives from Ac elements located in two different loci in the maize genome. One of the screens enabled us to recover a new Ds element at the former Ac locus as one of the two products of an Ac transposition event, thereby confirming the long-held belief that Ds elements arise de novo in the genome as a consequence of Ac transpositions. These Ds derivatives are rare relative to Ac excision footprints. We have characterized the new Ds elements and confirm that, as expected, they have suffered internal deletions. We find not only that short direct repeats of variable length occur adjacent to the deletion junction in most, but also that extra sequences or filler DNA (ROTH and WILSON 1985 ; ROTH et al. 1989 ) can be inserted at the junction. The inserted nucleotides are identical to sequences found close to the junction in the Ac DNA. These findings support the role of repair synthesis in the generation of Ds elements after Ac excision. However, the low frequency with which new Ds elements arise relative to excision footprints suggests that repair synthesis makes a much more limited contribution than end-joining to the genetic diversity that is created from repair of the Ac-initiated DSBs.

	MATERIALS AND METHODS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Genetic stocks:
All the stocks used in this study shared the common genetic background of the inbred W22. The bronze alleles and the aleurone phenotypes of the various stocks are described below.

• Bz-McC (purple): the normal progenitor allele of the bz-m2(Ac) mutation.

• bz-m2(Ac) (purple spots on a bronze background): an allele that arose from the insertion of the 4.6-kb Activator (Ac) element at position 755-762 in the second exon of Bz-McC (MCCLINTOCK 1955 ; RALSTON et al. 1988 ).

• bz-m2(DI) (bronze in the absence of Ac; spotted, in its presence): the first derivative from bz-m2(Ac), harboring a 3.3-kb internally deleted Dissociation (Ds) element at the same position as Ac in bz-m2(Ac) (MCCLINTOCK 1962 ; DOONER et al. 1986 ).

• bz-m2(DII) (bronze in the absence of Ac; spotted, in its presence): the second derivative from bz-m2(Ac), harboring a 3.6-kb internally deleted Dissociation (Ds) element at the same position as Ac in bz-m2(Ac) (MCCLINTOCK 1962 ; SCHIEFELBEIN et al. 1985 ).

• Bz Ac2094 (purple): a derivative of bz-m2(Ac) harboring a trAc (transposed Ac element) 0.05 cM proximal to bz (DOONER and BELACHEW 1989 ). The Ac element at that location, which has been cloned, is referred to as Ac2094 and the insertion site as tac2094 (RALSTON et al. 1989 ).

• bz-R (bronze): the bz reference allele, associated with a 340-bp deletion that extends from within the single intron to the second exon of bz and includes the Ac insertion site in bz-m2 (RHOADES 1952 ; RALSTON et al. 1987 , RALSTON et al. 1989 ).

Selection and analysis of new Ds derivatives:
The mutations sh (shrunken endosperm) and wx (waxy endosperm) were used as markers flanking bz. They map, respectively, ~2–3 cM distal and 25 cM proximal to bz in 9S. The sh-wx region exhibits high chiasma interference (DOONER 1986 ), so double crossovers in the region are rare.

Ds derivatives of the Ac elements at bz and tac2094 were recovered in separate screens as described below. Figure 1 summarizes diagrammatically the outcome of the screens and identifies the genetic makeup of the immediate Ac progenitors.

View larger version (14K): In this window In a new window Download PPT slide   Figure 1. Origin and analysis of new Ds derivatives. Two series of derivatives from the Ac element in the progenitor allele bz-m2(Ac) were studied. (Left) Series of bz-m2(Ds) derivatives resulting from internal deletions of the Ac element at position 755-762 in bz-m2(Ac). (Right) Series of bz-m(Ac) derivatives produced by reinsertion of Ac into bz. The Ac element in bz-m2(Ac) transposed to the nearby tac2094 locus to give Ac2094 Bz. Subsequently, Ac reinserted at position 1461-1468 of the bz locus to produce bz-m41 and bz-m43. These derivatives carry an internally deleted Ds2094 at the tac2094 locus. The boxes labeled tac2094 and bronze represent unique sequences in the maize genome into which Ac has transposed.

New Ds derivatives at the bz locus were identified as follows. Stable bronze derivatives having the Sh and Wx flanking markers of the bz-m2(Ac) chromosome (Figure 1) were selected as single-kernel events from crosses of Sh bz-m2(Ac) Wx/sh bz-R wx heterozygotes to sh bz-R wx pollen parents. The derivatives were crossed to a Ds reporter stock, sh bz-m2(DI) wx, to score for the presence of Ac and to an Ac stock, sh bz-R wx-m9(Ac), to determine whether a new Ds element had originated at the bz locus. The recovery of ~50% spotted seeds constitutes a positive outcome in either test. Leaf DNA was made from all individuals and analyzed by Southern blots for the presence of the diagnostic 2.6-kb PvuII fragment of Ac (FEDOROFF et al. 1983 ). The DNA of individuals lacking Ac, including those individuals that carried new Ds elements by the above genetic criteria, was then analyzed to determine the size of the fragment hybridizing to a bz probe (RALSTON et al. 1988 ) and, thus, the size of the insertion. Three new Ds derivatives [ Figure 1: bz-m2(D3), bz-m2(D4), and bz-m2(D5)] were identified and sequenced to characterize the deletion junctions.

Ds derivatives at tac2094 were obtained as follows. Numbered Bz Ac2094/bz-R + plants (Figure 1) were crossed as male and female parents to a sh bz-R wx stock and new unstable bz-m alleles were selected as rare spotted seeds from ears segregating purple and bronze seeds. The resulting plants were selfed to test for heritability of the spotted kernel phenotype. Leaf DNA was made from all selections and the sizes of the insertions at tac2094, the Ac donor locus, and bz, the putative target locus, were determined by genomic Southern blots. Two bz-m derivatives of interest were identified (Figure 1: bz-m41 and bz-m43) and subsequently sequenced to determine the location and makeup of the insertions at bz and tac2094.

DNA extraction, Southern blotting, PCR amplification, and sequencing:
Leaf DNA was isolated by the urea extraction procedure of GREENE et al. 1994 . Restriction enzyme digestion and genomic blotting were carried out as described (DOONER et al. 1985 ). Genomic DNA was amplified in the presence of 10% DMSO by the polymerase chain reaction (SAIKI 1990 ) in a GeneAmp System [Perkin-Elmer (Norwalk, CT) model 2400] using a variety of primers based on the sequences of Bz-W22 (RALSTON et al. 1988 ), tac2094 (RALSTON et al. 1989 ; Z. ZHENG and H. K. DOONER, unpublished results), and Ac (MULLER-NEUMANN et al. 1984 ; POHLMAN et al. 1984 ; ENGLISH et al. 1987 ).

The PCR amplification essentially followed the instructions of the PE GeneAmp XL PCR kit, which includes the 40 and 60 µl of the lower and upper layer mixture, respectively, and holds the genomic DNA at 95° for 4 min. The DNA corresponding to the different Ds and Ac elements was amplified with 20 cycles of 20-sec denaturation at 95° and 5 min of combined annealing-extension at 65°, followed by 15 cycles under the same conditions, but with a 15-sec auto-increment time per cycle in the anneal-extend steps. The PCR reactions were terminated with a 12-min incubation at 72° and held at 4°.

The amplified PCR product was purified on a 0.8% agarose gel, and treated with 2 units of AmpliTaq DNA polymerase (Perkin-Elmer) and 1 µl of a 10 mM dATP solution in a 50-µl reaction at 72° for 20 min. The PCR product was then purified on a Sephadex G-50 column (Pharmacia Biotech, Piscataway, NJ), cloned into a pGEM-T vector (Promega, Madison, WI), and sequenced on an ALF automatic DNA sequencing system (Pharmacia Biotech) using the labeled universal and reverse primers. New fragments were subcloned and sequenced if the deletion junction could not be located in the first sequencing attempt.

The four bz primers used in this study were the following: bzC, CTCAACACGTTCCCAGGC; bz599, CGAATGGCTGTTGCATTTCCATCG; bzF, CGACAGACTATCTCCACGA; and bz863r, ACGGGACGCAGTTGGGCAGGAT. The two tac2094 primers were tac2094#3, TCGGCGGTGCGGAGGAT; and tac2094#4; AGGAAGGCACGTAGGAGGACC. The four Ac primers were Ac 132r, TCTACCGTTTCCGTTTCCGTTTAC; Ac1297, GCACATCACCATCATCATCAACAG; Ac4372, ACCGAACAAAAATACCGGTTCCCG; and Ac4552R, GTCGGTAACGGTCGGTAAAATACC.

	RESULTS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Selection and analysis of new Ds derivatives at the bz locus:
New Ds elements were isolated from the Ac element at bz-m2(Ac) using the strategy detailed in MATERIALS AND METHODS. Individuals with the flanking markers of the bz-m2(Ac) allele but which had lost the mutable (i.e., spotted) phenotype specified by that allele were selected as single plump, nonwaxy, bronze seeds from testcross ears of Sh bz-m2(Ac) Wx/sh bz-R wx heterozygotes. Most of them were expected to carry a stable bz-s allele with a transposon footprint at position 755-762 of the bz second exon as a consequence of Ac excision from that location (MCCLINTOCK 1956A , MCCLINTOCK 1956B ; DOONER and BELACHEW 1989 ; DOONER and MARTINEZ-FEREZ 1997 ). By appropriate crosses, the selections were sorted out into different genetic classes, as summarized in Table 1. Crosses to a Ds reporter reveal that ~40% of them also carry a trAc element somewhere in the genome (DOONER and BELACHEW 1989 ). To identify bz-s individuals with new Ds elements, the selections were crossed to the Ac source sh bz-R wx-m9(Ac). Two of the selections produced ~50% spotted kernels in the cross, indicating that they carried a new Ds element. MCCLINTOCK 1956A had earlier identified two Ds derivatives of bz-m2(Ac), which she termed bz-m2(DI) and bz-m2(DII) for derivatives I and II of bz-m2. Following her lead, but simplifying the Roman numerals to Arabic numerals, we have designated the two new derivatives bz-m2(D3) and bz-m2(D4) (Figure 1). Southern blots established that the Ds elements in these derivatives were ~2.2 and 4 kb, respectively (data not shown).

Though the above scheme fails to detect Ds derivatives that might retain Ac in the genome (they would still produce a spotted kernel phenotype), it is clear from Table 1 that new Ds elements represent just a minor fraction (2/37) of those derivatives lacking Ac. Because of the small number of Ds derivatives recovered and the bias just mentioned, it is not possible to obtain an accurate estimate of the mutation of Ac to Ds. Nevertheless, the observed frequency of bz-m2(Ds) derivatives in this experiment (2/3867 gametes) is remarkably similar to the frequency with which MCCLINTOCK 1963 recovered Ds derivatives from wx-m9(Ac) in a comparable experiment (2/4613 gametes).

A fifth derivative of bz-m2(Ac) was recovered in the self-progeny of a homozygous plant. Seven plants in this family segregated about equal numbers of spotted and bronze seeds in crosses to bz-R. Upon subsequent testing, all turned out to carry a Ds element of roughly the same size (>4 kb) at the bz locus. Sequencing of the deletion junction in two of them (see below) confirmed that they carried the same Ds element, which we have designated bz-m2(D5) (Figure 1). Unlike bz-m2(D3) and bz-m2(D4), which most likely have a meiotic origin, bz-m2(D5) clearly originated in a mitotic division preceding sporogenesis.

Sequence of Ds insertions at bz:
The Ds insertions in the new derivatives bz-m2(D3), bz-m2(D4), and bz-m2(D5) are 2.2 kb, 4.0 kb, and 4.2 kb, respectively. The Ds insertions in bz-m2(D1) and bz-m2(D2), the two derivatives isolated by MCCLINTOCK 1956B , are 3.3 kb and 3.7 kb, respectively (SCHIEFELBEIN et al. 1985 ; DOONER et al. 1986 ). Thus, an Ac element at a particular location can undergo deletions of various sizes when it mutates to Ds. To determine if, as with other transposons, deletions occurred preferentially between short direct repeats, the deletion junctions in a series of bz-m2(Ds) derivatives were sequenced. The series included the new derivatives described in this article and bz-m2(D2), which had been characterized previously by restriction digests only. The location of the deletions relative to the sequence of the Ac progenitor is shown in Figure 2 and the sequences of all the deletion junctions are presented in Figure 3.

View larger version (15K): In this window In a new window Download PPT slide   Figure 2. Structure of five Ds elements produced from the Ac element at bz-m2(Ac) by internal deletions. The deletions are represented as the loss of various restriction sites in the Ac progenitor. B, BamHI; M, MluI; Bs, BstXI; P, PvuII; H, HindIII; N, NarI; E, EcoRI; Bc, BclI; X, XhoI.

View larger version (57K): In this window In a new window Download PPT slide   Figure 3. Sequence of the deletion junctions in the Ds elements at bz and tac2094. The sequence of the 5' and 3' ends of the deletion and the corresponding sequence in Ac are shown for each Ds element. The sequence of the deletion junction in Ds2(D1) is from DOONER et al. 1986 ; the other four sequences are from this work. The deletion junctions in all five Ds elements occur adjacent to short direct repeats of 2–5 bp in the Ac progenitor (shown in boldface type). The filler DNAs at the deletion junctions of bz-m2(D5) and Ds2094 are shown in lowercase letters and the nearby homologous sequences in the Ac parental DNA are underlined. The Ac sequence is shown in the same orientation as its transposase transcript and the numbered carats refer to positions in that sequence (1–4565). The Ds sequences are in the same orientation as Ac and the numbers refer to the corresponding positions in the shorter Ds sequences.

It is clear from Figure 2 and Figure 3 that deletions can arise at multiple locations within Ac and that there is no sequence preference for deletion formation. The deletion junctions in all five Ds elements occur adjacent to short direct repeats of 2–5 bp. Interestingly, five extra nucleotides of filler DNA, shown in lowercase letters in Figure 3, were inserted at the Ds2(D5) junction. The pentanucleotide sequence TTTTA also occurs very close to the deletion junction in the Ac progenitor, 23 bp downstream relative to the direction of transcription of the Ac transposase (KUNZE et al. 1987 ), where it is flanked by the same sequences (TCT and AGTG) that flank the filler DNA in the deletion. Filler DNA has been found at the junction of other genetic rearrangements in animals, plants, and fungi (ROTH and WILSON 1985 ; ROTH et al. 1989 ; SAINSARD-CHANET and BEGEL 1990 ; WESSLER et al. 1990 ), including P and Mu1 element excision sites (OAHARE and RUBIN 1983 ; DOSEFF et al. 1991 ; TAKASU-ISHIKAWA et al. 1992 ). Its homology to nearby sequences and, particularly, the homology of the sequences flanking both the filler DNA and the deletion junction have led to models that explain its origin in terms of slipped mispairing during DNA synthesis (ROTH and WILSON 1985 ; WESSLER et al. 1990 ).

Recovery of both elements in the generation of a two-element system:
McClintock described four instances of change from an Ac or one-element system of mutability to an Ac-Ds or two-element system: two at the bz locus (MCCLINTOCK 1955 , MCCLINTOCK 1962 ) and two at the wx locus (MCCLINTOCK 1963 ). In all four cases, Ac was lost from the genome initially and it was only the subsequent crossing of the stable bz and wx derivatives to an Ac source that revealed the presence of Ds at bz and wx. Similarly, the scheme we used to isolate new Ds derivatives at bz precludes the recovery of a potential trAc.

To show that, in fact, new Ds elements arise following Ac transposition one would have to recover both elements from the same transposition event. One can take advantage of the strong tendency of Ac to transpose to closely linked sites (VAN SCHAIK and BRINK 1959 ; GREENBLATT 1984 ; DOONER and BELACHEW 1989 ) to perform a different type of selection. Instead of selecting for changes of Ac to Ds by the loss of mutability of bz-m2(Ac), and consequently against a possible trAc, one could first select Ac transpositions into Bz from a closely linked donor site and then examine the donor locus for potential changes of Ac to Ds. Ac2094 is a trAc from bz-m2(Ac) that maps only 0.05 cM proximal to bz (DOONER and BELACHEW 1989 ). Its site of insertion, identified as tac2094, has been cloned and sequenced and shown to be unique DNA (RALSTON et al. 1989 ). Hence, tac2094 constitutes a suitable donor site from which to select for Ac transpositions into the bz locus that might have resulted in the generation of Ds at the donor locus.

Ac transpositions from tac2094 into Bz were selected as spotted kernels in testcrosses of Bz Ac2094 /bz-R + heterozygotes to sh bz-R wx. Twenty-one new bz-m alleles were recovered and confirmed by Southern blots and DNA sequencing to carry Ac reinsertions in the bz locus. Two of them, bz-m41 and bz-m43, are uniquely interesting and will be discussed here. These two bz-m derivatives arose in the progeny of a single Bz Ac2094/bz-R + plant crossed as male to the sh bz-R wx tester (Figure 1). By Southern blots (data not shown) it was established that several of the new bz-m alleles retained an Ac-sized insertion at the tac2094 locus, but that bz-m41 and bz-m43 appeared to carry smaller insertions at that locus, suggesting a possible change of Ac to Ds at the donor locus following transposition.

Sequence of Ac and Ds in bz-m41 and bz-m43:
Sequence analysis of the Ac-bz junctions in bz-m41 and bz-m43 revealed that Ac was inserted in the same location within bz (1461-1468) and in the same orientation (data summarized in Figure 1). These observations, coupled to the fact that the two mutants occurred in the progeny of a single plant, strongly indicate that they originated from a common premeiotic transposition event. Analysis of the genetic make-up of the tac2094 locus confirmed this. The bz-m41 and bz-m43 derivatives have the same tac2094-transposon junctions as the Ac2094 progenitor, but they carry a smaller (2.7-kb) insertion at the tac2094 locus. This suggests that the Ac element at tac2094 did not move but suffered an internal deletion to become a Ds element. To confirm this, the 2.7-kb insertions in bz-m41 and bz-m43 were sequenced and found to be the same; hence this Ds insertion has been designated Ds2094. Like Ds2(D5), Ds2094 has filler DNA at the deletion junction (Figure 3). The filler in Ds2094 is a 13-bp-long sequence with the same properties as the filler in Ds2(D5). The identical sequence also occurs close to the deletion junction in the Ac progenitor, 61 bp upstream, and is flanked at this location by the same sequences (GTT and T) that flank the filler DNA in the deletion junction, suggesting that both Ds2(D5) and Ds2094 may have arisen by the same mechanism.

	DISCUSSION

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

McClintock recognized that Ac could undergo various types of modifications, one of which was mutation to Ds. She described four such cases, two at the bz locus (MCCLINTOCK 1956B , MCCLINTOCK 1962 ) and two at the wx locus (MCCLINTOCK 1963 ) as examples of the "origin of a two-element system of control of gene action from an apparently one-element system." Though subsequent work has established that three of these Ds derivatives are internal deletions (FEDOROFF et al. 1983 ; SCHIEFELBEIN et al. 1985 ; DOONER et al. 1986 ), the mechanism by which these deletions arise has remained conjectural. It has been generally believed that changes of Ac to Ds are transposase mediated, but that is difficult to prove and other mechanisms, including recombination between elements at different chromosomal locations, have been considered (FEDOROFF 1983 ). In somatic tissues of transgenic tobacco, internal deletions were found to occur within Ac, but not within an almost-identical Ds element, arguing that they are excision, rather than sequence, dependent (RUBIN and LEVY 1997 ). In this work we present evidence that a Ds element can arise at a locus where Ac resided as a consequence of an Ac transposition event and, based on the sequence of the deletion junctions of several new Ds elements, we propose a mechanism for this change.

Using genetic screens designed to identify mutations of Ac to Ds, we isolated three new Ds elements at bz and one at the tightly linked tac2094 locus (DOONER and BELACHEW 1989 ; RALSTON et al. 1989 ), all of which turned out to carry internal deletions. The deletion junctions in these four Ds elements and in a fifth one that had been previously characterized as a deletion (SCHIEFELBEIN et al. 1985 ) were located and sequenced. As shown in Figure 2 and Figure 3, there is no obvious site or sequence preference for deletion formation in Ac [though it should be pointed out that the 3' deletion end points in Ds2(D4) and Ds2(D5) are only 1 bp apart].

The deletion junctions have two interesting features: they occur adjacent to short direct repeats of a few base pairs in most cases, and in two cases, Ds2(D5) and Ds2094, they contain filler DNA. Filler DNA refers to the extra nucleotides that are frequently found at the junction of genetic rearrangements in animals, plants, and fungi (ROTH and WILSON 1985 ; ROTH et al. 1989 ; SAINSARD-CHANET and BEGEL 1990 ; WESSLER et al. 1990 ; DOSEFF et al. 1991 ). In maize, it often occurs at the junction of spontaneous deletions, i.e., of deletions of unknown origin that have been collected by geneticists throughout the years (WESSLER et al. 1990 ). Filler DNA can vary in size and composition from one to a few base pairs of random sequence to a short oligonucleotide of as many as 20 bp that is homologous to a sequence found close to the deletion junction in the parental DNA. In Ds2(D5) and Ds2094, the filler DNAs are 5 bp and 13 bp long, respectively, and in both cases the extra sequences are found close to the deletion junction in the Ac DNA, where they are flanked by the same sequences that flank the filler DNA in the deletion (Fig-ure 3).

These structural features of filler DNA have been explained by mechanisms that involve slipped mispairing of repeat sequences during DNA synthesis (ROTH and WILSON 1985 ; ROTH et al. 1989 ; WESSLER et al. 1990 ). We propose a mechanism for the origin of internal deletions from Ac (Figure 4) similar to the one proposed by WESSLER et al. 1990 for the origin of spontaneous deletions in maize. We have modified it to incorporate the production of a DSB by Ac excision as the event that triggers repair DNA synthesis. As in the earlier models, slipped mispairing between nearby repeats during DNA replication would result in a deletion of the sequences between the repeats and of one repeat (Figure 4, left). The more common type of Ds deletions—Ds2(D1), Ds2(D2), Ds2(D3), and Ds2(D4)—would be produced that way. A second slip mispairing during replication is required to explain the origin of the filler DNA in Ds2(D5) and Ds2094 (Figure 4, right). An alternative model for the origin of the simple Ds deletions is interrupted or abortive gap repair by a synthesis-dependent strand annealing (SDSA) pathway (NASSIF et al. 1994 ; RUBIN and LEVY 1997 ), but this model would still have to be modified to include slip mispairing to account for the presence of filler DNA at a deletion junction. Besides, intrachromosomal deletions between direct repeats in yeast, thought to occur by the mechanistically related single strand annealing (SSA) mechanism, require a minimum of 60–90 bp of homology (SUGAWARA and HABER 1992 ), whereas the deletions that we observe are flanked by direct repeats of only a few base pairs. In either case, the DNA replication process would appear to be error prone. The possibility that the DNA replication process involved in the repair of transposition-generated DSBs may be more prone to error than normal chromosome replication was originally suggested by OAHARE and RUBIN 1983 to explain the unusual structure of deletion end points within the P element of Drosophila. Other Ds elements of undetermined origin that carry sequences unrelated to Ac have been described in the maize genome (e.g., MERCKELBACH et al. 1986 ; KLEIN et al. 1988 ; VARAGONA and WESSLER 1990 ). In one instance, the nonAc sequence is also found within 1 kb of the Ds element (KLEIN et al. 1988 ). Because the origin of these elements is not known, it is conceivable that they arose in multiple steps. However, whether these elements arose in one or multiple steps, ectopic sequence capture can be readily accommodated by models that postulate repair synthesis at the site of a DSB.

View larger version (30K): In this window In a new window Download PPT slide   Figure 4. Model for the origin of Ds internal deletion derivatives from Ac (adapted from ROTH and WILSON 1985 and WESSLER et al. 1990 ). Two sister chromatids are shown after Ac has excised from the lower one, generating a transient DSB. For illustration purposes, only the left terminal inverted repeat of Ac is shown (arrow). Repair of the DSB is initiated by strand invasion and DNA synthesis using the Ac element in the upper chromatid as template. Slip-mispairing occurs between direct repeats (black boxes) in the newly synthesized strand and in the Ac template, after which DNA synthesis continues. Completion of DNA synthesis (left) results in a Ds element deleted for the sequence (diagonal bars) between the direct repeats and for one copy of the repeat. A second slip-mispairing between different direct repeats (hatched boxes) followed by completion of DNA synthesis results in an internally deleted Ds element with filler DNA (vertical bars) in place of the deleted sequence (diagonal bars).

How frequently are the DSBs produced by Ac excision repaired by DNA repair synthesis? Available evidence indicates that the homologous chromosome rarely, if ever, serves as DNA repair template at meiosis and that Ac-generated DSBs are most frequently repaired by end-joining, i.e., by direct fusion of the broken ends (DOONER and MARTINEZ-FEREZ 1997 ). The findings reported here would support some role of repair synthesis using the sister chromatid as template, but this type of repair may not be very common. One could argue that repair synthesis using the sister chromatid as template is frequent and is simply not detected because it results in the synthesis of a complete Ac element at the Ac excision site. However, the study of pericarp sectors in ears carrying the Ac-mutable allele P-vv would suggest that that is not so. If it were, the frequency of untwinned light-variegated pericarp sectors would be higher than the frequency of untwinned red sectors, and it is not (GREENBLATT 1974 ; FEDOROFF 1983 ; CHEN et al. 1992 ). Therefore, Ac-induced DSBs would appear to be only rarely repaired by repair synthesis. Consequently, the end-joining events that result in excision footprints contribute the bulk of the genetic diversity that is generated by Ac movement in maize (SUTTON et al. 1984 ; MORENO et al. 1992 ; SCOTT et al. 1996 ; DOONER and MARTINEZ-FEREZ 1997 ). Still, the apparently error-prone DNA replication mechanism that occasionally repairs the DSBs produced by Ac excision may account for the observation that mutation of Ac to Ds (Table 1 and MCCLINTOCK 1963 ) is two orders of magnitude higher than the spontaneous mutation frequency in maize. Of the eight Ds derivatives from Ac that have been described to date, two—Ds2(D5) and Ds2094—clearly had a premeiotic origin. Peculiarly, these are the two Ds derivatives with filler DNA at the deletion junction. Because of the small number of cases studied, this finding may not be significant. Alternatively, it could suggest that the DNA repair mechanism is more error prone at mitosis than meiosis.

	ACKNOWLEDGMENTS

We thank Zhenwei Zheng for unpublished observations and Joachim Messing and David Norris for comments on the manuscript. The project was supported in part by a grant from the National Science Foundation (No. MCB 9630358) to H.K.D.

Manuscript received March 15, 1999; Accepted for publication April 26, 1999.

	LITERATURE CITED

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

CHEN, J., I. M. GREENBLATT, and S. L. DELLAPORTA, 1992  Molecular analysis of Ac transposition and DNA replication. Genetics 130:665-676[Abstract].

CHOMET, P., D. LISCH, K. J. HARDEMAN, V. L. CHANDLER, and M. FREELING, 1991  Identification of a regulatory transposon that controls the Mutator transposable element system in maize. Genetics 129:261-270[Abstract].

DOONER, H. K., 1986  Genetic fine structure of the bronze locus in maize. Genetics 113:1021-1036[Abstract/Free Full Text].

DOONER, H. K. and A. BELACHEW, 1989  Transposition pattern of the maize element Ac from the bz-m2(Ac) allele. Genetics 122:447-457[Abstract/Free Full Text].

DOONER, H. K. and I. M. MARTINEZ-FEREZ, 1997  Germinal excisions of the maize transposable element Activator do not stimulate meiotic recombination or homology-dependent repair at the bz locus. Genetics 147:1923-1932[Abstract].

DOONER, H. K., E. WECK, S. ADAMS, E. RALSTON, and M. FAVREAU et al., 1985  A molecular genetic analysis of insertion mutations in the bronze locus in maize. Mol. Gen. Genet. 200:240-246.

DOONER, H. K., J. ENGLISH, E. RALSTON, and E. WECK, 1986  A single genetic unit specifies two transposition functions in the maize element Activator.. Science 234:210-211[Abstract/Free Full Text].

DOSEFF, A., R. MARTIENSSEN, and V. SUNDARESAN, 1991  Somatic excision of the Mu1 transposable element of maize. Nucleic Acids Res. 19:579-584[Abstract/Free Full Text].

ENGELS, W. R., D. M. JOHNSON-SCHLITZ, W. B. EGGLESTON, and J. SVED, 1990  High-frequency P element loss in Drosophila is homolog dependent. Cell 62:515-525[Medline].

ENGLISH, J., E. RALSTON, and H. K. DOONER, 1987  Corrections in the nucleotide sequence of Activator.. Maize Genet. Coop. Newslet. 61:81.

FEDOROFF, N., 1983 Controlling elements in maize, pp. 1–63 in Mobile Genetic Elements, edited by J. A. SHAPIRO. Academic Press, New York.

FEDOROFF, N., 1989 Maize transposable elements, pp. 377–411 in Mobile DNA, edited by D. E. BERG and M. M. HOWE. American Society for Microbiology, Washington, DC.

FEDOROFF, N. V., S. WESSLER, and M. SHURE, 1983  Isolation of the transposable maize controlling elements Ac and Ds.. Cell 35:235-242[Medline].

GLOOR, G. B., N. A. NASSIF, D. M. JOHNSON-SCHLITZ, C. R. PRESTON, and W. R. ENGELS, 1991  Targeted gene replacement in Drosophila via P element-induced gap repair. Science 253:1110-1117[Abstract/Free Full Text].

GREENBLATT, I. M., 1974  Movement of Modulator in maize: a test of an hypothesis. Genetics 77:671-678[Abstract/Free Full Text].

GREENBLATT, I. M., 1984  A chromosome replication pattern deduced from pericarp phenotypes resulting from movement of the transposable element Modulator in maize. Genetics 108:471-485[Abstract/Free Full Text].

GREENE, B., R. WALKO, and S. HAKE, 1994  Mutator insertions in an intron of the maize knotted1 gene result in dominant suppressible mutations. Genetics 138:1275-1285[Abstract].

HSIA, A. P. and P. S. SCHNABLE, 1996  DNA sequence analyses support the role of interrupted gap repair in the origin of internal deletions of the maize transposon, MuDR. Genetics 142:603-618[Abstract].

KLEIN, A. S., M. CLANCY, L. PAJE-MANALO, D. B. FURTEK, and L. C. HANNAH et al., 1988  The mutation bronze-mutable 4 derivative 6856 in maize is caused by the insertion of a novel 6.7-kilobase pair transposon in the untranslated leader region of the bronze-1 gene. Genetics 120:779-790[Abstract/Free Full Text].

KUNZE, R., U. STOCHAJ, J. LAUFS, and P. STARLINGER, 1987  Transcription of transposable element Activator (Ac) of Zea mays L. EMBO J. 6:1555-1563[Medline].

LANKENAU, D. H., V. G. CORCES, and W. R. ENGELS, 1996  Comparison of targeted-gene replacement frequencies in Drosophila melanogaster at the forked and white loci. Mol. Cell. Biol. 16:3535-3544[Abstract].

LISCH, D., P. CHOMET, and M. FREELING, 1995  Genetic characterization of the Mutator system in maize: behavior and regulation of Mu transposons in a minimal line. Genetics 139:1777-1796[Abstract].

MCCLINTOCK, B., 1949  Mutable loci in maize. Carnegie Inst. Wash. Yearbook 48:142-154.

MCCLINTOCK, B., 1955  Controlled mutation in maize. Carnegie Inst. Wash. Yearbook 54:245-255.

MCCLINTOCK, B., 1956a  Controlling elements and the gene. Cold Spring Harbor Symp. Quant. Biol. 21:197-216.

MCCLINTOCK, B., 1956b  Mutation in maize. Carnegie Inst. Wash. Yearbook 55:323-332.

MCCLINTOCK, B., 1962  Topographical relations between elements of control systems in maize. Carnegie Inst. Wash. Yearbook 61:448-461.

MCCLINTOCK, B., 1963  Further studies of gene control systems in maize. Carnegie Inst. Wash. Yearbook 62:486-493.

MERCKELBACH, A., H. P. DOERING, and P. STARLINGER, 1986  The aberrant Ds element in the adh1::Ds2 allele. Maydica 31:109-122.

MORENO, M., J. CHEN, I. GREENBLATT, and S. L. DELLAPORTA, 1992  Reconstitutional mutagenesis of the maize P gene by short-range Ac transpositions. Genetics 131:939-956[Abstract].

MULLER-NEUMANN, M., J. YODER, and P. STARLINGER, 1984  The DNA sequence of the transposable element Ac of Zea mays L. Mol. Gen. Genet. 198:19-24.

NASSIF, N., J. PENNEY, S. PAL, W. R. ENGELS, and G. B. GLOOR, 1994  Efficient copying of nonhomologous sequences from ectopic sites via P-element-induced gap repair. Mol. Cell. Biol. 14:1613-1625[Abstract/Free Full Text].

O'HARE, K. and G. M. RUBIN, 1983  Structures of P transposable elements and their sites of insertion and excision in the Drosophila melanogaster genome. Cell 34:25-35[Medline].

POHLMAN, R., N. FEDOROFF, and J. MESSING, 1984  The nucleotide sequence of the maize controlling element Activator.. Cell 37:635-644[Medline].

RALSTON, E. J., J. ENGLISH, and H. K. DOONER, 1987  Stability of deletion, insertion and point mutations at the bronze locus in maize. Theor. Appl. Genet. 74:471-475.

RALSTON, E. J., J. ENGLISH, and H. K. DOONER, 1988  Sequence of three bronze alleles of maize and correlation with the genetic fine structure. Genetics 119:185-197[Abstract/Free Full Text].

RALSTON, E. J., J. ENGLISH, and H. K. DOONER, 1989  Chromosome-breaking structure in maize involving a fractured Ac element. Proc. Natl. Acad. Sci. USA 86:9451-9455[Abstract/Free Full Text].

RHOADES, M. M., 1952  The effect of the bronze locus on anthocyanin formation in maize. Am. Nat. 86:105-108.

ROTH, D. B. and J. H. WILSON, 1985  Relative rates of homologous and nonhomologous recombination in transfected DNA. Proc. Natl. Acad. Sci. USA 82:3355-3359[Abstract/Free Full Text].

ROTH, D. B., X. B. CHANG, and J. H. WILSON, 1989  Comparison of filler DNA at immune, nonimmune, and oncogenic rearrangements suggests multiple mechanisms of formation. Mol. Cell. Biol. 9:3049-3057[Abstract/Free Full Text].

RUBIN, E. and A. A. LEVY, 1997  Abortive gap repair: underlying mechanism for Ds element formation. Mol. Cell. Biol. 17:6294-6302[Abstract].

SAIKI, R. K., 1990 Amplification of genomic DNA, pp. 13–20 in PCR Protocols: A Guide to Methods and Applications, edited by M. A. INNIS, D. H. GELFAND, J. J. SNINSKY and T. J. WHITE. Academic Press, San Diego.

SAINSARD-CHANET, A. and O. BEGEL, 1990  Insertion of an LrDNA gene fragment and of filler DNA at a mitochondrial exon-intron junction in Podospora.. Nucleic Acids Res. 18:779-783[Abstract/Free Full Text].

SCHIEFELBEIN, J., D. FURTEK, V. RABOY, J. BANKS, N. FEDOROFF et al., 1985 Exploiting maize transposable elements to study the expression of a maize gene, pp. 445–460 in Plant Genetics, edited by M. FREELING. A. R. Liss, New York.

SCOTT, L., D. LAFOE, and C. F. WEIL, 1996  Adjacent sequences influence DNA repair accompanying transposon excision in maize. Genetics 142:237-246[Abstract].

SUGAWARA, N. and J. E. HABER, 1992  Characterization of double-strand break-induced recombination: homology requirements and single-stranded DNA formation. Mol. Cell. Biol. 12:563-575[Abstract/Free Full Text].

SUTTON, W. D., W. L. GERLACH, D. SCHWARTZ, and W. J. PEACOCK, 1984  Molecular analysis of Ds controlling element mutations at the Adh1 locus in maize. Science 223:1265-1268[Abstract/Free Full Text].

TAKASU-ISHIKAWA, E., M. YOSHIHARA, and Y. HOTTA, 1992  Extra sequences found at P element excision sites in Drosophila melanogaster. Mol. Gen. Genet. 232:17-23[Medline].

VAN SCHAIK, N. and R. A. BRINK, 1959  Transposition of Modulator, a component of the variegated pericarp in maize. Genetics 44:725-738[Free Full Text].

VARAGONA, M. and S. R. WESSLER, 1990  Implications for the cis-requirements for Ds transposition based on the sequence of the wxB4 Ds element. Mol. Gen. Genet. 220:414-418[Medline].

WESSLER, S., A. TARPLEY, M. PURUGGANAN, M. SPELL, and R. OKAGAKI, 1990  Filler DNA is associated with spontaneous deletions in maize. Proc. Natl. Acad. Sci. USA 87:8731-8735[Abstract/Free Full Text].

This article has been cited by other articles:

				H. Guermonprez, C. Loot, and J. M. Casacuberta Different Strategies to Persist: The pogo-Like Lemi1 Transposon Produces Miniature Inverted-Repeat Transposable Elements or Typical Defective Elements in Different Plant Genomes Genetics, September 1, 2008; 180(1): 83 - 92. [Abstract] [Full Text] [PDF]

				J. T. Huang and H. K. Dooner Macrotransposition and Other Complex Chromosomal Restructuring in Maize by Closely Linked Transposons in Direct Orientation PLANT CELL, August 1, 2008; 20(8): 2019 - 2032. [Abstract] [Full Text] [PDF]

				L. J. Conrad, L. Bai, K. Ahern, K. Dusinberre, D. P. Kane, and T. P. Brutnell State II Dissociation Element Formation Following Activator Excision in Maize Genetics, October 1, 2007; 177(2): 737 - 747. [Abstract] [Full Text] [PDF]

				L. J. Conrad and T. P. Brutnell Ac-Immobilized, a Stable Source of Activator Transposase That Mediates Sporophytic and Gametophytic Excision of Dissociation Elements in Maize Genetics, December 1, 2005; 171(4): 1999 - 2012. [Abstract] [Full Text] [PDF]

				Z. Xu and H. K. Dooner Mx-rMx, a Family of Interacting Transposons in the Growing hAT Superfamily of Maize PLANT CELL, February 1, 2005; 17(2): 375 - 388. [Abstract] [Full Text] [PDF]

				C. Feschotte Merlin, a New Superfamily of DNA Transposons Identified in Diverse Animal Genomes and Related to Bacterial IS1016 Insertion Sequences Mol. Biol. Evol., September 1, 2004; 21(9): 1769 - 1780. [Abstract] [Full Text] [PDF]

				S. Kawasaki and E. Nitasaka Characterization of Tpn1 Family in the Japanese Morning Glory: En/Spm-related Transposable Elements Capturing Host Genes Plant Cell Physiol., July 15, 2004; 45(7): 933 - 944. [Abstract] [Full Text] [PDF]

				M. McVey, M. Adams, E. Staeva-Vieira, and J. J. Sekelsky Evidence for Multiple Cycles of Strand Invasion During Repair of Double-Strand Gaps in Drosophila Genetics, June 1, 2004; 167(2): 699 - 705. [Abstract] [Full Text] [PDF]

				J. Yu, K. Marshall, M. Yamaguchi, J. E. Haber, and C. F. Weil Microhomology-Dependent End Joining and Repair of Transposon-Induced DNA Hairpins by Host Factors in Saccharomyces cerevisiae Mol. Cell. Biol., February 1, 2004; 24(3): 1351 - 1364. [Abstract] [Full Text] [PDF]

				P. Windels, S. De Buck, E. Van Bockstaele, M. De Loose, and A. Depicker T-DNA Integration in Arabidopsis Chromosomes. Presence and Origin of Filler DNA Sequences Plant Physiology, December 1, 2003; 133(4): 2061 - 2068. [Abstract] [Full Text]

				W. Ramakrishna, J. Emberton, M. Ogden, P. SanMiguel, and J. L. Bennetzen Structural Analysis of the Maize Rp1 Complex Reveals Numerous Sites and Unexpected Mechanisms of Local Rearrangement PLANT CELL, December 1, 2002; 14(12): 3213 - 3223. [Abstract] [Full Text] [PDF]

				H. K. Dooner Extensive Interallelic Polymorphisms Drive Meiotic Recombination into a Crossover Pathway PLANT CELL, May 1, 2002; 14(5): 1173 - 1183. [Abstract] [Full Text] [PDF]

				M. N. Raizada, G.-L. Nan, and V. Walbot Somatic and Germinal Mobility of the RescueMu Transposon in Transgenic Maize PLANT CELL, July 1, 2001; 13(7): 1587 - 1608. [Abstract] [Full Text] [PDF]

				Y.-L. Xiao, X. Li, and T. Peterson Ac Insertion Site Affects the Frequency of Transposon-Induced Homologous Recombination at the Maize p1 Locus Genetics, December 1, 2000; 156(4): 2007 - 2017. [Abstract] [Full Text]

				B. Shen, Z. Zheng, and H. K. Dooner A maize sesquiterpene cyclase gene induced by insect herbivory and volicitin: Characterization of wild-type and mutant alleles PNAS, November 29, 2000; (2000) 240284097. [Abstract] [Full Text]

				B. Shen, Z. Zheng, and H. K. Dooner A maize sesquiterpene cyclase gene induced by insect herbivory and volicitin: Characterization of wild-type and mutant alleles PNAS, December 19, 2000; 97(26): 14807 - 14812. [Abstract] [Full Text] [PDF]