Genetics, Vol. 152, 1573-1584, August 1999, Copyright © 1999

Homologs of the Caenorhabditis elegans Masculinizing Gene her-1 in C. briggsae and the Filarial Parasite Brugia malayi

Adrian Streit1,a, Weiqing Lia, Barbara Robertsona, Jacquie Scheinb, Ibrahim H. Kamal2,c, Marco Marrab, and William B. Wooda
a Department of Molecular, Cellular and Developmental Biology, University of Colorado, Boulder, Colorado 80309-0347,
b Genome Sequencing Center, Washington University School of Medicine, St. Louis, Missouri 63108
c Filarial Genome Project Resource Center, Clark Science Center, Smith College, Northampton, Massachusetts 01063

Corresponding author: William B. Wood, Department of MCD Biology, Porter Biosciences Room 058, University of Colorado, Boulder, CO 80309-0347., wood{at}stripe.colorado.edu (E-mail)

Communicating editor: R. K. HERMAN


*  ABSTRACT
*TOP
 *ABSTRACT
*MATERIALS AND METHODS
 *RESULTS
 *DISCUSSION
 *LITERATURE CITED

The masculinizing gene her-1 in Caenorhabditis elegans (Ce-her-1) encodes a novel protein, HER-1A, which is required for male development. To identify conserved elements in her-1 we have cloned and characterized two homologous nematode genes: one by synteny from the closely related free-living species C. briggsae (Cb-her-1) and the other, starting with a fortuitously identified expressed sequence tag, from the distantly related parasite Brugia malayi (Bm-her-1). The overall sequence identities of the predicted gene products with Ce-HER-1A are only 57% for Cb-HER-1, which is considerably lower than has been found for most homologous briggsae genes, and 35% for Bm-HER-1. However, conserved residues are found throughout both proteins, and like Ce-HER-1A, both have putative N-terminal signal sequences. Ce-her-1 produces a larger masculinizing transcript (her-1a) and a smaller transcript of unknown function (her-1b); both are present essentially only in males. By contrast, Cb-her-1 appears to produce only one transcript, corresponding to her-1a; it is enriched in males but present also in hermaphrodites. Injection of dsRNA transcribed from Cb-her-1 into C. briggsae hermaphrodites (RNA interference) caused XO animals to develop into partially fertile hermaphrodites. Introducing a Cb-her-1 construct as a transgene under control of the C. elegans unc-54 myosin heavy chain promoter caused strong masculinization of both C. briggsae and C. elegans hermaphrodites. Introduction of a similar Bm-her-1 construct into C. elegans caused only very weak, if any, masculinization. We conclude that in spite of considerable divergence the Cb gene is likely to be a functional ortholog of Ce-her-1, while the function of the distantly related Bm gene remains uncertain.

SEX determination is an almost universal feature of animal development. However, in contrast to the genes that control other basic developmental processes like pattern formation, which often are highly conserved among taxa as divergent as mammals, flies, and nematodes (MANAK and SCOTT 1994 Down), the sex-determining mechanisms that have been investigated by molecular genetics exhibit little similarity (HODGKIN 1992 Down; RYNER and SWAIN 1995 Down; MARIN and BAKER 1998 Down). Even within groups of animals that employ homologous sex-determining systems, the genes involved are often more divergent than those encoding components of other regulatory pathways, for reasons that are not understood (OANEIL and BELOTE 1992 Down; TUCKER and LUNDRIGAN 1993 Down; WHITFIELD et al. 1993 Down; DE BONO and HODGKIN 1996 Down; KUWABARA 1996 Down).

In the nematode C. elegans, determination of the two sexes, hermaphrodites and males, has been extensively studied (for reviews, see CLINE and MEYER 1996 Down; MEYER 1997 Down). The primary signal is the ratio of X chromosomes to autosomes in the embryo. Normally, XX embryos develop into hermaphrodites and XO embryos into males. Hermaphrodites are somatically female, but produce and store sperm during the fourth larval stage before switching to oogenesis as adults. Their self-progeny are all hermaphrodites except for males that arise by spontaneous X nondisjunction at a frequency of ~0.2%. Hermaphrodites mated with males produce 50% male cross-progeny.

In sex determination, the primary signal acts as a switch to regulate a cascade of interacting genes that control X-chromosome dosage compensation as well as sex determination (Figure 1). The masculinizing gene her-1, required for male development, is the first in the sex-determining branch of the pathway. her-1 loss-of-function (lf) mutations have no effect on XX animals but cause XO animals to develop as normal-appearing fertile hermaphrodites (HODGKIN 1980 Down). The her-1 locus encodes two transcripts of 1.2 and 0.8 kb, both regulated sex specifically at the level of transcription (TRENT et al. 1991 Down; PERRY et al. 1993 Down; LI et al. 1999 Down). The smaller transcript has no known function; the larger is necessary and sufficient for all known functions of her-1 and encodes a predicted protein of 175 amino acids (HER-1A), which has no significant similarity to other proteins in the current data bases (except Bm-HER-1; see below). Analysis of genetic mosaics showed that her-1 acts cell nonautonomously (HUNTER and WOOD 1992 Down), and HER-1A has a predicted N-terminal secretion signal that is required for function (PERRY et al. 1993 Down). These findings support the view that HER-1A is secreted as the inhibitory ligand for a receptor encoded by tra-2 (HUNTER and WOOD 1992 Down; KUWABARA et al. 1992 Down).



View larger version (12K):
In this window
In a new window
Download PPT slide
  		Figure 1. Position of her-1 in the signaling pathway controlling somatic sex determination in C. elegans. Blunt-ended arrows ({dashv}) indicate negative regulation. Indicated below the pathway is the predicted state of each gene's function in wild-type XX and XO animals. Three of these genes, tra-2, fem-2, and tra-1, have previously been shown to have homologs in C. briggsae. Adapted from PERRY et al. 1993 Down.

Mutations that impair her-1 function are distributed throughout the gene, providing little insight into the relative functional importance of different domains (PERRY et al. 1994 Down). In an attempt to identify candidates for functionally important domains based on evolutionary conservation, we have undertaken a comparison of the her-1 genes from C. elegans (Ce-her-1) and two other nematodes: the closely related free-living species C. briggsae (FITCH et al. 1995 Down) and the distantly related parasitic species Brugia malayi (BLAXTER et al. 1998 Down). We have designated these homologs as Cb-her-1 and Bm-her-1, respectively. In C. briggsae, as in C. elegans, the two sexes are hermaphrodites and males, and three of the sex-determining genes downstream of her-1 (Figure 1) are similar, although poorly conserved, between the two species (tra-2, KUWABARA 1996 Down; fem-2, HANSEN and PILGRIM 1998 Down; and tra-1, DE BONO and HODGKIN 1996 Down). B. malayi is a filarial parasite responsible for the Southeast Asian form of the lymphatic disorder elephantiasis (BLAXTER and BIRD 1997 Down). The two sexes are females and males, but little is known about the sex-determining mechanism. We show here that although the her-1 genes in the two comparison species have diverged substantially from Ce-her-1, residues known to be functionally important in C. elegans have been well conserved. The Cb-her-1 gene exhibits masculinizing activity in both C. elegans and C. briggsae and, therefore, is likely to be a functional ortholog. Although we could not demonstrate a clear masculinizing activity for Bm-her-1 in these species, the conservation of key residues in its predicted protein product suggests that it may share biochemical functions with Ce-her-1.


*  MATERIALS AND METHODS
*TOP
 *ABSTRACT
 *MATERIALS AND METHODS
*RESULTS
 *DISCUSSION
 *LITERATURE CITED

Nematode strains and culture:
All C. elegans strains were derivatives of the wild-type Bristol strain N2. The C. elegans alleles used were him-8(e1489) IV (HODGKIN et al. 1979 Down) and her-1(y101hv1) V (TRENT et al. 1991 Down; PERRY et al. 1994 Down). The strain PA43, of genotype him-8(e1489); her-1(y101hv1), produces ~37% XO animals as a result of the him-8 mutation, but they develop into fertile hermaphrodites rather than males as a result of the her-1 null allele y101hv1.

The C. briggsae wild-type strain AF16 (FITCH et al. 1995 Down) was obtained from the Caenorhabditis Genetics Center. The C. briggsae strain BW1850 was produced by backcrossing a male-incidence-high [mih-3(s1290)] strain, kindly provided by S. Bird and D. Baillie, twice to AF16. In BW1850 partial self-sterility of the hermaphrodites was overcome by mating to males of the same genotype, producing a population with ~50% males. All strains were cultured by techniques standard for C. elegans (BRENNER 1974 Down; SULSTON and HODGKIN 1988 Down).

DNA libraries:
The libraries used were kindly supplied to us by the following investigators: C. elegans embryonic cDNA from P. Okkema and A. Fire (Carnegie Institution of Washington, Baltimore), C. briggsae genomic from T. Snutch and D. Baillie (Simon Fraser University, Burnaby, BC, Canada), B. malayi genomic DNA library-97 from U. Wagner (University of Giessen, Germany), and B. malayi adult male cDNA library SAW94NL-BmAM from N. Ling and S. A. Williams (Filarial Genome Project Resource Center, Smith College, Northampton, MA). A C. briggsae high-density fosmid grid was purchased from Genome Systems Inc. (St. Louis).

PCR primers:
Sequences of primers referred to in the text are as follows:

  • zk287-41: AACCGTTGCCACCTGCCGCC;

  • zk287-42: TATGGAAAACAACGAATGCG;

  • zk287-43: CTGAATAATACGCAACGGCG;

  • zk287-44: GACAGATGAGTTGAAGGCG;

  • ACb1: TTTGGTCATAAAAATGAATGC;

  • ACb2: ACCATCTCAAAACCAGATCG;

  • BRU1: ATGGGACATTCTCTGATTCTAGC;

  • BRU2: TTATTTGGCATTCAATCTGATGC;

  • BRU3: GACCAATGTATACTTTCCCCGGC;

  • BRU4: GTTAATTATTTAATTTCGGGACC;

  • SL1: GGTTTAATTACCCAAGTTTGAG;

  • BCB1F: TAGAATCATCACTCTTCTCACCAT

  • BCB4R: ACGCTTCTGGAGATACGTCGTGTT;

  • BCB3R: CCAAAGACGGTGCAGCACACAGAA;

  • CB5'UTRF: GCTCTTCTCGCTAGCAGATCCGTCACACTTCTCT;

  • CBCE3'R: AGGCTAATGAGCCCAGATTCAGTGGATTGGACGCTTCTGGAGA;

  • BRU9F: CGATCAGTGCTAGCAAAGGAATATAATTATTAAGGGAACA;

  • BRU10R: AGGCTAATGAGCCCAGATTTATTTAATTTCGGGACCAATGTATACT.

Molecular techniques:
Standard methods were as described by SAMBROOK et al. 1989 Down. Other molecular methods are described below.

PCR protocols: Reverse transcriptase PCR (RT-PCR) was used to obtain partial C. briggsae cDNAs following the method of INNIS et al. 1990 Down. Reverse transcription was carried out with AMV Reverse Transcriptase (Promega Madison, WI), random hexamer primers (GIBCO/BRL, Gaithersburg, MD), and from 1.4 to 10 µg of C. briggsae RNA. The program for PCR was 1 min 95°; then 40 cycles of 1 min 95°, 1 min 55°, 1 min 72°; then 10 min 72°, 10 min 99°.

Nested PCR was used to isolate desired cDNA sequences directly from phage libraries. For the first round of PCR, 5 µl of a phage library were used as a template in a 100-µl reaction. The PCR program was 5 min 94°; then 30 cycles of 1 min 94°, 1 min 54°–58° (depending on the primers used), 1.5 min 72°; then 10 min 72°, 10 min 99°. For the second round of PCR, 1 µl of a 1:100 dilution from the above amplification product was used as the template. The PCR program used was the same as for the first round except that the initial denaturation step was shortened to 1 min. The resulting PCR product was either sequenced, labeled directly, or cloned blunt into the HincII site of pT7/T3{alpha}18 (GIBCO/BRL).

DNA sequencing: All samples were sequenced by the DNA sequencing facility in MCD Biology, Boulder, the DNA Sequencing Facility, Iowa State University, or the Genome Sequencing Center in St. Louis. Samples obtained by PCR were sequenced using the same primers as those used for amplification. The accession no. for the B. malayi genomic sequence (see below) is AF125985. All other sequences are available at the world wide web sites of the respective sequencing projects:

Cloning Cb-her-1 by synteny:
A partial cDNA (ZK287.4-V) from exons 2–6 of the predicted protease inhibitor gene ZK287.4 was obtained by nested PCR using the C. elegans embryonic cDNA library as template, primers zk287-41 and zk287-43 in the first round, and primers zk287-42 and zk287-44 in the second round. Sequencing of the resulting partial cDNA sequence confirmed the splicing shown in ACeDB, as predicted by Genefinder (SULSTON et al. 1992 Down; see also C. elegans web site above).

Using ZK287.4-V to probe the C. briggsae genomic library at low stringency (YOCHEM and GREENWALD 1989 Down), a clone (C.b.{lambda}1) consisting of two EcoRI fragments was isolated. Both were subcloned into pT3/T7{alpha}-18 to produce clones ZK287.4A2 (8-kb insert) and ZK287.4C4 (5.2-kb insert) that, when partially sequenced, were found to contain elements that were 70–80% identical at the nucleotide level to predicted exons of C. elegans ZK287.4.

A segment of ZK287.4A2 amplified with primers ACb1 and ACb2 was used to probe a C. briggsae high-density fosmid grid. Using the fingerprints of the cognate fosmids from the grid as a starting point, a contig was constructed by interactive consultation of a database of fingerprinted C. briggsae fosmids (M. MARRA, J. SCHEIN and T. KUCABA, unpublished results). A minimal tiling set of C. briggsae fosmids for this contig (G39O07 and G33P21) was sequenced by the Genome Center in St. Louis.

The genomic interval surrounding the C. elegans her-1 gene was compared to the sequence obtained from the C. briggsae fosmids (see Figure 2) using the dot-plot program DOTTER with default parameter settings (SONNHAMMER and DURBIN 1996 Down). The finished sequence was submitted to BLAST (ALTSCHUL et al. 1997 Down), and the exons of Cb-her-1 were roughly identified by similarity to the C. elegans her-1 exons at the protein level.



View larger version (26K):
In this window
In a new window
Download PPT slide
  		Figure 2. Synteny is conserved in the her-1 regions of C. elegans and C. briggsae. Genomic organization of the C. elegans and C. briggsae her-1 regions were compared and displayed using the dot-matrix comparison program Dotter (SONNHAMMER and DURBIN 1996 Down), with default parameter settings. The C. elegans sequence is represented on the vertical axis and the C. briggsae sequence on the horizontal axis. Axes are labeled in base pairs. Extensive DNA sequence similarity between the two species is visible as a diagonal line. Also shown are the approximate locations and names of genes predicted by the C. elegans Genome Sequencing Consortium. Shaded boxes indicate the approximate extent of predicted genes, including both introns and exons. Lines extending from the colored boxes to the left axis of the plot indicate the sequence coordinates of the predicted genes. See text for further explanation.

Isolation of the genomic Bm-her-1 region:
Based on sequence information from the B. malayi cDNA sequencing project (see RESULTS), a partial cDNA (B.m.her-12E) was amplified from the adult male-derived B. malayi cDNA library SAW96MLW-BmAM by nested PCR using primers BRU1 and BRU4 in the first round and primers BRU2 and BRU3 in the second round. Using this partial cDNA as a probe, the B. malayi genomic library-97 was screened and two overlapping phage clones were isolated (B.m.{lambda}2 and B.m.{lambda}3). A 2.2-kb EcoRI fragment common to both clones that hybridized to the cDNA probe was subcloned and sequenced by primer walking (DNA Sequencing Facility, Iowa State University). The cDNA sequence is contained entirely within this fragment.

RNA isolation and analysis:
RNA used for RT-PCR and RNA blot analyses was isolated directly from mixed-stage populations of the C. briggsae strains AF16 and BW1850 and from embryos isolated by hypochlorite treatment of these populations. Isolation and analysis followed the procedure of TRENT et al. 1991 Down with the following modifications. The lysis step of the isolation was simplified as follows: the guanidinium isothiocyanate solution was added to the frozen pellet and vortexed constantly as the pellet thawed. For RNA blots, the gel and running buffers were modified as recommended by TSANG et al. 1993 Down, and gels were blotted onto Hybond N membranes (Amersham, Buckinghamshire, UK). Blots were probed with a partial C. briggsae her-1 cDNA obtained by RT-PCR (see below) and, to provide a loading control, with a C. briggsae clone (CbIC#9) containing the ribosomal protein gene rpl-29 obtained from D. Evans and T. Blumenthal (University of Colorado Health Sciences Center, Denver). Signals were detected and quantitated using a PhosphoImager (Storm 860, Molecular Dynamics, Sunnyvale, CA).

Gene structures of Cb-her-1 and Bm-her-1:
To determine the precise splice sites of the C. briggsae exons, a partial cDNA of Cb-her-1 was obtained by RT-PCR. The primers for the PCR step, designed on the basis of the genomic C. briggsae sequence, were BCB1F and BCB4R. Samples from six 100-µl PCR reactions were gel purified, pooled, and sequenced. The initiator AUG was inferred from inspection of the genomic sequence. Splice sites for the Bm-her-1 exons were determined by comparison of the genomic and cDNA sequences obtained as described above. The 5' end of the Bm-her-1 transcript was defined as the site of SL1 trans-splicing (see RESULTS).

Plasmid constructs for functional studies:
Plasmids containing the C. briggsae or B. malayi cDNAs driven by the Ce-unc-54 promoter and followed by the Ce-her-1 3'UTR were made by three-part ligation using the vector pPD30.38 (which contains the unc-54 promoter; FIRE et al. 1990 Down). The C. elegans her-1 3'UTR fragment was 0.8 kb in length, starting immediately after the termination codon. The C. briggsae cDNA was generated by RT-PCR using the primers CB5'UTRF (located 54 bp upstream of the putative initiator AUG) and CBCE3'R. The B. malayi cDNA was produced using the B. malayi library as template, the PCR program described above for RT-PCR, and the primers BRU9F (located 46 bp upstream of the inferred initiator AUG) and BRU10R. Candidate clones were checked by comparison to genomic sequence to eliminate those with PCR-introduced errors in protein-coding sequences. The clones used were designated pU54P/CbcDNA/Ce3' for the C. briggsae cDNA clone and pU54P/BmcDNA/Ce3' for the B. malayi clone. For control experiments, plasmid pU54P/CbFS/Ce3', containing a frameshift mutation in the C. briggsae cDNA, was made from pU54P/CbcDNA/Ce3' by filling in a unique XbaI site in exon 2. These constructs were chosen for comparison of protein functions because preliminary experiments with Ce-her-1 cDNA in such a transgenic construct had demonstrated dominant masculinization in both C. elegans and C. briggsae XX animals, presumably as the result of ectopic expression from the transgene (M. D. PERRY and W. B. WOOD, unpublished results).

The plasmid from which RNA was transcribed in vitro for RNA interference (RNAi) experiments (see below), designated pT7/T3CbcDNA, was made by cloning a 0.4-kb blunt-ended SspI-FspI fragment of the partial C. briggsae her-1 cDNA obtained by RT-PCR into the SmaI site of the vector pT7/T3{alpha}-18 (GIBCO/BRL).

Transgenic worms:
To observe effects of overexpression from cloned her-1 genes, DNA of the experimental plasmid was coinjected with the pRF4 plasmid carrying the rol-6(su1006dm) marker, each at a concentration of 100 µg/ml (MELLO et al. 1991 Down), to yield transgenic lines carrying extrachromosomal arrays.

RNAi:
The likely phenotype resulting from loss of function of the her-1 gene in C. briggsae was investigated by injection of double-stranded RNA transcribed in vitro from a Cb-her-1 cDNA plasmid into mated adult hermaphrodites, whose F1 XO progeny were then scored for feminization. This technique has been shown to be a potent, specific method of silencing many genes in C. elegans (FIRE et al. 1998 Down; MONTGOMERY and FIRE 1998 Down). Control experiments in C. elegans verified that her-1(RNAi) caused a phenotype similar to that resulting from a known her-1 null mutation.

DNA sequence analysis:
Searches for regions of sequence similarity in the 5' flanking region and intron 2 of Ce-her-1 and Cb-her-1 were carried out using a program for analyzing pairwise alignments of long sequences (SCHWARTZ et al. 1991 Down). Searches for smaller conserved sequence motifs were carried out using a pattern discovery program (HERTZ et al. 1990 Down; HERTZ and STORMO 1999 Down).


*  RESULTS
*TOP
 *ABSTRACT
 *MATERIALS AND METHODS
 *RESULTS
*DISCUSSION
 *LITERATURE CITED

Cloning of Cb-her-1 by synteny:
Several attempts to clone Cb-her-1 by low stringency hybridization to a Ce-her-1 probe were unsuccessful, suggesting that like the sex-determining genes tra-2 (KUWABARA 1996 Down) and tra-1 (DE BONO and HODGKIN 1996 Down), the her-1 gene might be poorly conserved between these species. Therefore, we attempted to identify Cb-her-1 by taking advantage of synteny, which previously allowed cloning of tra-2 (KUWABARA and SHAH 1994 Down).

From a C. briggsae genomic library we isolated a clone including predicted exons that were 70–80% identical, at the nucleotide level, to the C. elegans predicted protease inhibitor gene ZK287.4, which is located 11.7 kb upstream of the her-1 cap site. We used this C. briggsae clone to identify a contig of overlapping fosmids, two of which (G39O07 and G33P21, totaling 65 kb) together included most of the contig.

Sequencing of these fosmids indicated synteny in a region of >45 kb spanning the her-1 locus (Figure 2). Clear sequence similarities were evident at the nucleotide level between seven of eight predicted genes as well as several intergenic regions, but little if any similarity could be seen at the position of Ce-her-1. Moreover, a shift of the diagonal in the similarity plot (Figure 2) suggested that the region between the two genes that flank her-1 is ~10 kb larger in C. briggsae than in C. elegans. Nevertheless, at this position in the C. briggsae sequence a BLAST search (ALTSCHUL et al. 1997 Down) identified a predicted gene product that appeared to be a HER-1A homolog, with 57% identity and 76.7% similarity in the amino-acid sequence (Figure 3). We subsequently refer to this gene as Cb-her-1.



View larger version (42K):
In this window
In a new window
Download PPT slide
  		Figure 3. (A) Structure of her-1 genes from C. elegans, C. briggsae, and B. malayi. Lengths (in base pairs) of introns 1, 2, and 3, respectively, are the following: in C. elegans, 49, 3437, and 509; in C. briggsae, 48, 4076, and 1912; and in B. malayi, 224, 198, and 538. Italicized letters indicate approximate positions of common motifs or regions of similarity in the Ce and Cb genes that could include regulatory elements (see text). (B) Predicted amino acid sequences, shown using standard one-letter amino acid abbreviations, of HER-1 proteins encoded by the three homologs. Exon boundaries are indicated by carets (^). Sequences encoded by each of the four exons, as spliced in the twoCaenorhabditis species, are shown in a separate group of lines. In B. malayi the location of intron 1 is different, as shown by the caret in the first line. Predicted cleavage sites for secretion signal sequences are indicated by apostrophes in the first line, above for the two Caenorhabditis species and below for B. malayi. The cysteines (C) are printed in bold face. Identical residues are indicated by dark shading; residues similar to those in C. elegans are indicated by light shading. Asterisks indicate the amino acids altered by missense mutations in C. elegans that cause her-1 loss-of-function phenotypes.

Cb-her-1 produces a single transcript:
Sequencing of a partial Cb-her-1 cDNA showed that the intron positions in the C. briggsae transcript are the same as in C. elegans (Figure 3A). Compared to most C. elegans introns, Cb-her-1 introns 2 and 3 are unusually large (4076 and 1912 bp, respectively). Ce-her-1 intron 2 is also large (3437 bp) and contains a second promoter (P2), which drives production of the smaller (0.8-kb) her-1b transcript (TRENT et al. 1991 Down; PERRY et al. 1993 Down; LI et al. 1999 Down). When probed with the Cb-her-1 partial cDNA, blots of RNA from mixed-stage populations of the C. briggsae wild type (AF16; <1% males) and mih-3(s1290) (strain BW1850, ~50% males) showed a single band of ~1.1 kb, which was enriched in the mih-3 sample but present in both (Figure 4). When quantitated by PhosphoImager the difference in band intensity between the two samples indicated that this transcript is about threefold more abundant in males than in hermaphrodites. Similar results were obtained in a comparison of embryonic RNAs from these two strains (data not shown). We detected no band corresponding to the C. elegans smaller transcript her-1b in these experiments.



View larger version (48K):
In this window
In a new window
Download PPT slide
  		Figure 4. C. briggsae her-1 mRNA is enriched in males but also present in hermaphrodites. Blots of electrophoretically separated RNAs from mixed-stage populations of BW1850 (~50% males) and AF16 wild type (<1% males) were probed with a partial cDNA for Cb-her-1 (upper panel) and with a ribosomal protein gene (rpl-29) to provide a loading control (lower panel; see MATERIALS AND METHODS). Quantitation of all four bands by PhosphoImager and correction for the difference in loading indicated an approximately twofold higher level of Cb-her-1 RNA in BW1850 relative to AF16, indicating an approximately threefold higher level of this RNA in males. Positions relative to the more slowly migrating ribosomal RNA bands (not shown) indicated the size of the her-1 band to be ~1.1 kb, close to that of the larger Ce-her-1 transcript her-1a. Arrowhead shows the position expected for a smaller transcript of 0.7 kb, corresponding to Ce-her-1b, which was not detected.

In C. elegans, her-1b, but not the larger transcript her-1a, is trans-spliced to the leader sequence SL1 (PERRY et al. 1993 Down). Using seminested PCR to assay for trans-splicing of the Cb-her-1 mRNA with an SL1 primer and primers from exon 4 and then exon 3, we could detect no reproducible amplified product. This result is consistent with absence in C. briggsae of a smaller SL1-spliced transcript equivalent to Ce-her-1b, and it suggests that the Cb-her-1 1.1-kb transcript, like Ce-her-1a, is not trans-spliced to SL1.

The HER-1 amino acid sequence is partially conserved:
Cb-her-1 encodes a predicted protein of 174 amino acids (Cb-HER-1), compared to the predicted 175-residue Ce-HER-1A protein (Figure 3B). Whereas most homologous proteins in the closely related species C. briggsae and C. elegans exhibit high levels of identity (11 of 13 proteins compared ranged from 83 to 100% identity; DE BONO and HODGKIN 1996 Down), Cb-HER-1 is only 57% identical and 77% similar to Ce-HER-1A.

Despite its low degree of overall sequence similarity to Ce-HER-1A, the Cb-HER-1 sequence has several conserved features. First, both proteins include predicted secretion signal sequences at the N terminus (VON HEIJNE 1986 Down), with identical predicted cleavage sites. Second, the positions of the 14 cysteine residues are identical in the two proteins. Third, the two sequences are identical at each of the 13 positions (including seven of the cysteines) at which amino acid substitutions resulting from known missense mutations in C. elegans cause loss of her-1 function (PERRY et al. 1994 Down).

C. briggsae her-1 has masculinizing activity:
Consistent with the masculinizing role of the Ce-HER-1 protein, transgenic extrachromosomal arrays including Ce-her-1 cDNA driven by a Ce-unc-54 (myosin heavy-chain) promoter can masculinize C. elegans XX animals (PERRY et al. 1993 Down) and in preliminary experiments were also seen to masculinize C. briggsae (M. D. PERRY and W. B. WOOD, unpublished results). To test whether Cb-her-1 has masculinizing activity, we made transgenic C. elegans and C. briggsae hermaphrodites carrying arrays of a construct that included the Cb-her-1 cDNA sequence driven by the Ce-unc-54 promoter and terminated by sequence from the Ce-her-1 3'UTR (see MATERIALS AND METHODS). We coinjected the chimeric construct with a C. elegans rol-6(dm) marker plasmid (MELLO et al. 1991 Down). In C. elegans we observed 59 masculinized F1 progeny, all assumed to be transgenic since this phenotype is never seen among progeny of uninjected animals (Table 1 and Figure 5C). In support of this assumption, 57 of these animals were strongly masculinized and exhibited the Roller (Rol) phenotype. The remaining 2 were nonRol intersexes (note that only Rol transgenic progeny are listed in the body of Table 1). In C. briggsae we observed 371 F1 progeny, again assumed to be transgenic, exhibiting a range of masculinization from intersexes with partially masculinized tails and protruding vulvas (not shown) to apparent males (~80% of the total; male gonad, no vulva) with imperfect tails (Figure 5D). All Rol animals were masculinized. However, only ~20% (43) of the masculinized animals displayed the Rol phenotype, possibly because, relative to the Cb-her-1 construct, the Ce-rol-6 promoter is less effective or the phenotype resulting from the Ce-rol-6(dm) mutation has a lower penetrance in C. briggsae than in C. elegans. In a control experiment using a derivative of the Cb-her-1 construct with a frameshift mutation in exon 2 (Cb-her-1FS), we obtained 39 transgenic (Rol) F1 animals; all of these, as well as their non-Rol siblings, were hermaphrodites with no apparent masculinization. These results suggest that the Cb-her-1 gene has masculinizing activity when expressed ectopically from a transgenic extrachromosomal array in either C. elegans or C. briggsae.



View larger version (129K):
In this window
In a new window
Download PPT slide
  		Figure 5. Effects on tail morphology caused by Cb-her-1 and Bm-her-1 transgenes in XX animals and Cb-her-1 dsRNA in an XO animal. (a and b) Hermaphrodite and male tails, respectively, of wild-type C. elegans. Tail structures of the two sexes in C. briggsae, not shown, are virtually identical to those in C. elegans except for a fusion of rays 3 and 4 in the briggsae male. (c and d) Masculinized tails of C. elegans and C. briggsae XX animals, respectively, carrying transgenic arrays of Cb-her-1. (e) Masculinized tail of a C. elegans XX animal carrying a transgenic array of Bm-her-1. (f) F1 intersexual offspring, presumably XO, of a C. briggsae mih-3 hermaphrodite injected with Cb-her-1 dsRNA. See text for further explanation.


 
View this table:
In this window
In a new window

  		Table 1. Effects of Cb-her-1 and Bm-her-1 ectopic expression in C. briggsae and C. elegans

A possible alternative explanation might be that the observed masculinization results from the Ce-her-1 3'-UTR sequences present in transcripts from the Cb-her-1 construct, and that these sequences are absent in the Cb-her-1FS transgenic animals as a result of transcript degradation by the smg system (PULAK and ANDERSON 1993 Down). This explanation seems highly unlikely because (1) a Bm-her-1 transgenic construct (discussed below), carrying the same Ce-her-1 3'-UTR sequence, has only very weak, if any, masculinizing activity (Table 1), and (2) it was previously shown that the smaller her-1b transcript with an identical 3'-UTR sequence, when expressed in XX animals under control of either a heat-shock or a myosin heavy-chain (unc-54) promoter, had no detectable masculinizing activity (PERRY et al. 1993 Down).

As a further test for the normal activity of the her-1 gene in C. briggsae, we used RNA-mediated interference (RNAi) to determine its probable loss-of-function phenotype (FIRE et al. 1998 Down). As an assay, we compared the percentage of male F1 progeny produced by mated C. briggsae mih-3(s1290) (strain BW1850) hermaphrodites before and after injection with dsRNA made from Cb-her-1 cDNA. Before injection these animals produced ~44% male progeny, whereas after injection they produced only ~8% male progeny (Table 2), as well as some presumably XO intersexual animals (Figure 5F). For comparison, this experiment was also carried out with C. briggsae wild type (AF16), using the same dsRNA, and with C. elegans wild type (N2), using dsRNA transcribed from Ce-her-1 cDNA. As shown in Table 2, similar results were obtained in all three cases.


 
View this table:
In this window
In a new window

  		Table 2. Phenotypes resulting from her-1 (RNAi) in C. briggsae and C. elegans

To ascertain the karyotypes of the F1 hermaphrodites, we plated some of them individually and allowed them to produce F2 self-progeny for analysis (Table 2). All the F1 hermaphrodites from AF16 before injection produced normal-sized F2 broods of hermaphrodites only. Most of the F1 hermaphrodites from AF16 after injection also produced normal F2 broods of hermaphrodites, but 12% of these F1 hermaphrodites produced either completely nonviable F2 broods or broods with very small numbers of viable animals, predominantly males. We observed similar effects from dsRNA made from Ce-her-1 injected into mated C. elegans wild type. These results suggest that her-1(RNAi) in both C. briggsae and C. elegans results in transformation of XO animals into marginally fertile hermaphrodites, which is also the phenotype resulting from strong her-1(lf) alleles in C. elegans XO animals (HODGKIN 1980 Down). We conclude that Cb-her-1 and Ce-her-1 are likely to be functional orthologs, required for male development in both species.

Searches for conserved her-1 non-coding sequences:
In the hope of identifying potential regulatory elements, we first searched visually for conserved nucleotide sequences in upstream and intron 2 regions identified previously as important for Ce-her-1 regulation (PERRY et al. 1993 Down; LI et al. 1999 Down). The region of the Ce-her-1 P1 promoter (b in Figure 3A), as defined by loss-of-function mutations (PERRY et al. 1994 Down), contains two short sequence motifs separated by five nucleotides, which are also found as a single sequence with no separation upstream of Cb-her-1 (Table 3). In intron 2, which contains the Ce-her-1 P2 promoter, an 8-bp sequence is found as an inverted repeat at the upstream end of a 400-bp sequence suspected from in vivo titration experiments to contain negative regulatory elements (LI et al. 1999 Down). In Cb-her-1, only the right half of the palindrome is present in a more distal region of the intron (Table 3; d in Figure 3A).


 
View this table:
In this window
In a new window

  		Table 3. Similarities in noncoding sequences of Ce-her-1 and Cb-her-1

Additional searches of upstream and intron 2 sequences were carried out using computer algorithms with finer resolution than Dotter (Figure 2). Using an algorithm for analyzing pairwise alignments of long sequences (SCHWARTZ et al. 1991 Down; with assistance from W. Miller, Pennsylvania State University), we identified three additional regions with significant similarity (63–65%) indicated in Figure 3A as a (70 nucleotides), c (105 nucleotides), and e (142 nucleotides; also located in the 400-bp C. elegans intron 2 sequence mentioned above). Using a pattern discovery program (HERTZ et al. 1990 Down; HERTZ and STORMO 1999 Down; with assistance from G. Stormo, University of Colorado, Boulder), we identified smaller sequence motifs common to the two genes, including two occurrences of CCGCCC in intron 2 of Ce-her-1 and three in intron 2 of Cb-her-1, as well as a few other closely approximate matches in both sequences. Based on the previous mutational analysis, the P1 motif b could be a positive regulatory element common to the two her-1 genes. The remaining similarities represent potential regulatory sites, but at present there is no evidence that any of them have functional significance.

A her-1 homolog in the parasitic nematode B. malayi:
The cDNA sequence that originally identified a potential Bm-her-1 homolog was found as an EST (GenBank accession no. AA068389) in the course of the Filarial Genome Project (by I. H. Kamal and S. A. Williams). A complete cDNA was isolated and sequenced (by I. H. Kamal, R. M. Ramzy, D. Guiliano, and S. A. Williams; GenBank accession no. AF004290). We amplified and sequenced a partial cDNA clone from an adult male cDNA library, and then isolated and sequenced clones from a B. malayi genomic library to confirm the cDNA sequence and determine the gene structure, shown in Figure 3A and discussed below. The cDNA encodes a predicted protein of 183 amino acids (Figure 3B), which is only 35% identical and 42% similar to the sequence of Ce-HER-1A between residues 38 and 169. As observed with C. briggsae, however, despite the limited overall sequence similarity, the predicted Brugia sequence exhibits several conserved features. First, it includes a predicted secretion signal sequence at the N terminus, with a predicted cleavage site two residues upstream of the cleavage sites in the Caenorhabditis genes. Second, it includes 14 cysteine residues, which can be aligned with those of the Caenorhabditis proteins by the introduction of three single amino acid gaps. Third, with this alignment, the Brugia sequence is identical to that of Ce-HER-1A at 12 of the 13 positions (including seven of the cysteines) at which amino acid substitutions resulting from missense mutations in C. elegans cause loss of her-1 function (PERRY et al. 1994 Down). (At the 13th position, the Brugia sequence has alanine in place of the serine in Caenorhabditis, whereas the C. elegans missense mutant has a less similar residue, phenylalanine, at this position.) Based on these conserved features, we will refer subsequently to this gene as Bm-her-1.

Like Ce-her-1 and Cb-her-1, Bm-her-1 includes four exons (Figure 3A). Intron positions are partially conserved: intron 1 is somewhat farther 5', but introns 2 and 3 are located at precisely the same positions relative to the coding sequence as in the two Caenorhabditis genes when the cysteine codons are aligned as in Figure 3B. In contrast to the Caenorhabditis genes, all the introns in Bm-her-1 are quite small.

The first four nucleotides of the Bm-her-1 cDNA clone are identical to the last four nucleotides of SL1, which is highly conserved among all nematodes (BLAXTER and LIU 1996 Down). Using PCR with an SL1 primer and nested primers in exons 4 and 3, we were able to reproducibly amplify one major fragment of the expected size from the B. malayi cDNA library. Sequencing of this product confirmed the boundaries of exons 1 and 2, including the SL1 splice site. These results indicate that the Bm-her-1 mRNA (in contrast to Ce-her-1a and Cb-her-1) is trans-spliced to SL1 and suggest that B. malayi does not make an SL1-trans-spliced shorter transcript corresponding to Ce-her-1b.

To test for masculinizing activity of the Bm-her-1 gene, we carried out transgene experiments similar to those described above for Cb-her-1. When a construct consisting of the Ce-unc-54 promoter driving the Brugia cDNA with the Ce-her-1 3'UTR appended was injected into C. elegans wild-type hermaphrodites with the rol-6 marker construct, we observed 513 transgenic Rol F1 progeny, most of which looked like normal hermaphrodites (Table 1). However, we also found 4 progeny with abnormal tails (Figure 5E), including 1 clearly masculinized animal in which ray structures were present (not shown). Similar injections into hermaphrodites of the C. briggsae wild-type strain AF16 resulted in only 1 strongly masculinized animal among the 80 transgenic Rol progeny recovered. These results could be interpreted to indicate that the Bm-her-1 gene has a very weak masculinizing activity in both C. elegans and C. briggsae XX animals. An alternative possibility is that the small effects observed could result from the Ce-her-1 3'UTR sequence that was present in the Bm-her-1 constructs. Previous experiments, mentioned above in connection with Table 1, found that no masculinization of C. elegans XX animals resulted from ectopic expression of the smaller her-1b transcript, which carries the same 3'-UTR sequence (PERRY et al. 1993 Down); however, the number of animals analyzed may have been too small to detect a very weak effect.

To test whether the chimeric Bm-her-1 cDNA construct might be capable of rescuing (masculinizing) XO animals lacking an endogenous her-1 gene, we injected into C. elegans hermaphrodites of genotype him-8(e1489); her-1(y101hv1) (strain PA43; this strain produces ~37% XO animals, which develop as hermaphrodites because her-1 function is lacking). Whereas injection of Ce-her-1 constructs allows these animals to produce XO male progeny (PERRY et al. 1993 Down), injection of the Bm-her-1 construct resulted in no masculinized animals among 48 transgenic progeny that could be identified by their Rol phenotype (Table 1).


*  DISCUSSION
*TOP
 *ABSTRACT
 *MATERIALS AND METHODS
 *RESULTS
 *DISCUSSION
*LITERATURE CITED

Conservation of genomic organization:
The Spirurid parasitic nematode B. malayi is only distantly related to the Rhabditid species C. elegans and C. briggsae. It differs markedly in morphology as well as life cycle, and although current estimates are highly uncertain, these two orders of nematodes may have diverged as long as 400 mya (BLAXTER 1998 Down; BLAXTER et al. 1998 Down; M. BLAXTER, personal communication). In contrast, C. elegans and C. briggsae are almost indistinguishable morphologically and are considered to be closely related. Nevertheless, genomic differences between these two species suggest that they may be as divergent as different orders of mammals, with perhaps as much as 50 million years of separation (reviewed in FITCH and THOMAS 1997 Down; BLAXTER 1998 Down). In spite of this divergence, preliminary results suggest some synteny between C. elegans and B. malayi, and between the two Caenorhabditis species there is extensive synteny (reviewed in BLAXTER 1998 Down), as there is between representatives of different mammalian orders. This feature has been exploited previously in cloning the C. briggsae homologs of C. elegans genes with too little sequence similarity for recognition by DNA hybridization, starting from closely linked genes with higher similarity (KUWABARA and SHAH 1994 Down). We have demonstrated synteny over at least 45 kb in the her-1 region, allowing a gene that is quite distant from her-1 (~10 kb) to be used as a starting point.

Conservation of the her-1 locus and transcripts:
The intron-exon structures of the her-1 genes are highly conserved among the three species. Introns 2 and 3 are at the same positions in all three species; intron 1 is somewhat farther 5' in B. malayi (Figure 3B). Unlike most C. elegans genes (BLUMENTHAL and STEWARD 1997 Down), both the Ce-her-1 and Cb-her-1 genes have an exceptionally long intron 2; in the latter, intron 3 is also very long (Figure 3A). In Ce-her-1, intron 2 contains a second promoter (P2), which drives a shorter transcript (PERRY et al. 1993 Down); we have shown that there is probably no such shorter transcript from Cb-her-1. Interestingly, in C. elegans the sex-determining genes tra-1 and tra-2 also have shorter transcripts with functions that are not well understood, and all these shorter transcripts are either absent or different in C. briggsae (DE BONO and HODGKIN 1996 Down; KUWABARA 1996 Down; KUWABARA et al. 1998 Down). A second difference between Cb-her-1 and Ce-her-1 is in the sex specificity of transcript accumulation. Whereas in C. elegans, males were estimated to have about 100-fold higher levels of her-1b mRNA than hermaphrodites (TRENT et al. 1991 Down), our preliminary analysis of C. briggsae expression shows that males have only ~3-fold higher levels of her-1 transcripts than hermaphrodites (see further discussion below). Despite these differences in expression, our sequence comparisons identified several conserved regions that could represent common regulatory elements; however, there is so far no evidence that they function in sex-specific regulation.

Conservation of the HER-1 proteins:
The sequences of the three HER-1 proteins compared here are considerably more divergent than those of other proteins not involved in sex determination that have been compared among C. elegans, C. briggsae (DE BONO and HODGKIN 1996 Down), and in a few cases, B. malayi (M. BLAXTER, personal communication; see discussion of evolutionary implications below). We had hoped that this divergence would help in identification of domains important for HER-1 function. However, except for the hydrophobic N termini, which presumably serve as secretion signals, we did not find localized conserved domains. Instead, we found that the similarities extend over virtually the entire protein (Figure 3). Most striking is the perfect conservation of the 14 cysteine residues. The apparent distribution of functionally important elements is consistent with the finding that loss-of-function missense mutations are also found distributed throughout most of the her-1 coding regions in C. elegans (PERRY et al. 1994 Down). It is noteworthy that all of the 13 amino acids affected by these mutations are conserved in C. briggsae, and all but one are conserved in B. malayi. These conserved features and the apparent ability of at least two of these proteins to masculinize C. elegans suggest that some biochemical functions are conserved as well. Whereas we have demonstrated directly that the C. briggsae her-1 gene is required for normal sex determination, we can draw no conclusions about whether the B. malayi her-1 gene also controls male development. Unfortunately, little is known about the sex determining mechanism in B. malayi. The finding of the Bm-her-1 cDNA in a male-derived library is consistent with a masculinizing function. Alternatively, however, it could play a biochemical role similar to that of Ce-her-1 but in a different signaling pathway, as may be the case for murine homologs of the C. elegans masculinizing gene fem-1 (VENTURA-HOLMAN et al. 1998 Down).

Evolutionary implications:
Sex-determining mechanisms appear to evolve relatively rapidly (reviewed by MARIN and BAKER 1998 Down). In several classes of animals, it has been observed that gene products involved in sex determination are more divergent than most other proteins compared among species (e.g., OANEIL and BELOTE 1992 Down; TUCKER and LUNDRIGAN 1993 Down; WHITFIELD et al. 1993 Down). Three more examples have been reported among Rhabditid nematodes in comparisons of the sex-determining proteins TRA-2 (KUWABARA 1996 Down), TRA-1 (DE BONO and HODGKIN 1996 Down), and FEM-2 (HANSEN and PILGRIM 1998 Down) and their homologs between C. elegans and C. briggsae, and we have here reported on the HER-1 proteins as a fourth example. We have also obtained evidence that, although her-1 is male determining in both Caenorhabditis species, its mechanism of sex-specific regulation may also have diverged. In C. elegans her-1 activity is regulated at the transcript level (TRENT et al. 1991 Down; PERRY et al. 1993 Down), while in C. briggsae, transcript concentrations in the two sexes appear similar enough to suggest that post-transcriptional regulation may also be necessary.

Rapid divergence of sex-determining mechanisms and component proteins may be selected for as contributing to speciation. Whatever its causes, aspects of this divergence suggest a "bottom-up" model for evolution of sex determination (WILKINS 1995 Down; MARIN and BAKER 1998 Down). In general, downstream elements of sex-determining pathways appear to be more conserved; the farther up the pathways one looks the more divergent sex-determining mechanisms become. For example, the mab-3 gene, a downstream target of the sex-determining C. elegans transcription factor TRA-1, appears homologous to the downstream Drosophila sex-determining gene doublesex (RAYMOND et al. 1998 Down). Upstream of mab-3, the C. elegans genes her-1, tra-2, fem-2, and tra-1 (Figure 1) appear to have no Drosophila homologs involved in sex determination, although they do have functional homologs in C. briggsae as reviewed above. her-1 is so far the farthest upstream gene in C. elegans for which the C. briggsae homolog has been found. There is evidence that regulation of tra-2, at least in the soma, is similar in C. elegans and C. briggsae (KUWABARA 1996 Down). Our results suggest that, in contrast, her-1 may be controlled differently in the two species. It is tempting to speculate that her-1 might be a point at which sex-determining mechanisms in C. elegans and C. briggsae have diverged. It will be interesting to determine whether homologs of genes farther upstream in the C. elegans pathway, such as the sdc genes and xol-1, exist and exhibit conserved functions in C. briggsae. The completion of the C. elegans genome sequencing project and the availability of a C. briggsae fosmid library of genomic clones should allow straightforward searches for such homologs, even if their sequence conservation is minimal.


*  FOOTNOTES

1 Present address: Institute for Zoology, University of Zurich, Winterthurerstr. 190, 8057 Zurich, Switzerland. Back
2 Present address: Department of Biochemistry, Ain Shams University, Abassiah, Cairo 11566, Egypt. Back


*  ACKNOWLEDGMENTS

We are grateful to J. Yochem for protocols, to members of the Wood lab for helpful discussions, to D. Baillie and collaborators for the C. briggsae strains and genomic library, to M. Blaxter for originally bringing the Brugia her-1 homolog to our attention and for comments on the manuscript, to S. A. Williams and the Filarial Genome Project Resource Center as well as to U. Wagner for B. malayi libraries, and to G. Stormo and W. Wilson for help with genomic sequence comparisons. Some C. elegans strains were supplied by the Caenorhabditis Genetics Center, which is funded by the National Institutes of Health (NIH) National Center for Research Resources. A.S. received postdoctoral fellowship support from the Swiss National Science Foundation and the Ciba-Geigy Jubiläumsstiftung, and I.H.K. was funded by a WHO-UNDP-World Bank Tropical Diseases Research Program grant to the Filarial Genome Project. Research carried out in St. Louis was supported by the Washington University Genome Sequencing Center. Research carried out in Boulder was supported by NIH grant HD-11762 to W.B.W.

Manuscript received February 22, 1999; Accepted for publication April 23, 1999.


*  LITERATURE CITED
*TOP
 *ABSTRACT
 *MATERIALS AND METHODS
 *RESULTS
 *DISCUSSION
 *LITERATURE CITED

ALTSCHUL, S. F., T. L. MADDEN, A. A. SCHAFFER, J. ZHANG, and Z. ZHANG et al., 1997  Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402[Abstract/Free Full Text].

BLAXTER, M., 1998  Caenorhabditis elegans is a nematode. Science 282:2041-2046[Abstract/Free Full Text].

BLAXTER, M., and D. BIRD, 1997 Parasitic nematodes, pp. 851–878 in C. elegans II, edited by D. L. RIDDLE, T. BLUMENTHAL, B. J. MEYER and J. R. PRIESS. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

BLAXTER, M. and L. LIU, 1996  Nematode spliced leaders—ubiquity, evolution and utility. Int. J. Parasitol. 26:1025-1033[Medline].

BLAXTER, M. L., P. DE LEY, J. R. GAREY, L. X. LIU, and P. SCHELDEMAN et al., 1998  A molecular evolutionary framework for the phylum Nematoda. Nature 392:71-75[Medline].

BLUMENTHAL, T., and K. STEWARD, 1997 RNA processing and gene structure, pp. 117–145 in C. elegans II, edited by D. L. RIDDLE, T. BLUMENTHAL, B. J. MEYER and J. R. PRIESS. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

BRENNER, S., 1974  The genetics of Caenorhabditis elegans.. Genetics 77:71-94[Abstract/Free Full Text].

CLINE, T. W. and B. J. MEYER, 1996  Vive la difference: males vs. females in flies vs. worms. Annu. Rev. Genet. 30:637-702[Medline].

DE BONO, M. and J. HODGKIN, 1996  Evolution of sex determination in Caenorhabditis: unusually high divergence of tra-1 and its functional consequences. Genetics 144:587-595[Abstract].

FIRE, A., S. W. HARRISON, and D. DIXON, 1990  A modular set of lacZ fusion vectors for studying gene expression in Caenorhabditis elegans.. Gene 93:189-198[Medline].

FIRE, A., S. XU, M. K. MONTGOMERY, S. A. KOSTAS, and S. E. DRIVER et al., 1998  Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans.. Nature 391:806-811[Medline].

FITCH, D. H. A., and W. K. THOMAS, 1997 Evolution, pp. 815–850 in C. elegans II, edited by D. L. RIDDLE, T. BLUMENTHAL, B. J. MEYER and J. R. PRIESS. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

FITCH, D., B. BUGAI-GAWEDA, and S. EMMONS, 1995  18S Ribosomal RNA gene phylogeny for some Rhabditidae related to Caenorhabditis. Mol. Biol. Evol. 12:346-358[Abstract].

HANSEN, D. and D. PILGRIM, 1998  Molecular evolution of a sex determination protein: fem-2 (pp2c) in Caenorhabditis. Genetics 149:1353-1362[Abstract/Free Full Text].

HERTZ, G. Z. and G. D. STORMO, 1999  Identifying DNA and protein patterns with statistically significant alignments of multiple sequences. Bioinformatics in press.

HERTZ, G. Z., G. W. HARTZELL, and G. D. STORMO, 1990  Identification of consensus patterns in unaligned DNA sequences known to be functionally related. Comput. Appl. Biosci. 6:81-92[Abstract/Free Full Text].

HODGKIN, J., 1980  More sex-determination mutants of Caenorhabditis elegans.. Genetics 96:649-664[Abstract/Free Full Text].

HODGKIN, J., 1992  Genetic sex determination: mechanisms and evolution. BioEssays 14:253-261[Medline].

HODGKIN, J., H. HORVITZ, and S. BRENNER, 1979  Nondisjunction mutants of the nematode Caenorhabditis elegans.. Genetics 91:67-94[Abstract/Free Full Text].

HUNTER, C. and W. B. WOOD, 1992  Evidence from mosaic analysis of the masculinizing gene her-1 for cell interactions in C. elegans sex determination. Nature 355:551-555[Medline].

INNIS, M. A., D. H. GELFAND, J. J. SNINSKY and T. J. WHITE, 1990 PCR Protocols. Academic Press, San Diego.

KUWABARA, P. E., 1996  Interspecies comparison reveals evolution of control regions in the Nematode sex-determining gene tra-2. Genetics 144:597-607[Abstract].

KUWABARA, P. E. and S. SHAH, 1994  Cloning by synteny: identifying C. briggsae homologues of C. elegans genes. Nucleic Acids Res. 22:4414-4418[Abstract/Free Full Text].

KUWABARA, P., P. OKKEMA, and J. KIMBLE, 1992  tra-2 encodes a membrane protein and may mediate cell communication in the Caenorhabditis elegans sex determination pathway. Mol. Biol. Cell 3:461-473[Abstract].

KUWABARA, P. E., P. G. OKKEMA, and J. KIMBLE, 1998  Germ-line regulation of the Caenorhabditis elegans sex-determining gene tra-2.. Dev. Biol. 204:251-262[Medline].

LI, W., A. STREIT, B. ROBERTSON, and W. B. WOOD, 1999  Evidence for multiple promoter elements orchestrating male-specific regulation of the her-1 gene in C. elegans.. Genetics 152:237-248[Abstract/Free Full Text].

MANAK, J. and M. SCOTT, 1994  A class act: conservation of homeodomain protein functions. Development (Suppl.) 120S:61-71.

MARIN, I. and B. S. BAKER, 1998  The evolutionary dynamics of sex determination. Science 281:1990-1994[Abstract/Free Full Text].

MELLO, C., J. KRAMER, D. STINCHCOMB, and V. AMBROS, 1991  Efficient gene transfer in C. elegans: extrachromosomal maintenance and integration of transforming sequences. EMBO J. 10:3959-3970[Medline].

MEYER, B. J., 1997 Sex determination and X chromosome dosage compensation, pp. 209–240 in C. elegans II, edited by D. L. RIDDLE, T. BLUMENTHAL, B. J. MEYER and J. R. PRIESS. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

MONTGOMERY, M. K. and A. FIRE, 1998  Double-stranded RNA as a mediator in sequence-specific genetic silencing and co-suppression. Trends Genet. 14:255-258[Medline].

O'NEIL, M. T. and J. M. BELOTE, 1992  Interspecific comparison of the transformer gene of Drosophila reveals an unusually high degree of evolutionary divergence. Genetics 131:113-128[Abstract].

PERRY, M., W. LI, C. TRENT, B. ROBERTSON, and A. FIRE et al., 1993  Molecular characterization of the her-1 gene suggests a direct role in cell signaling during Caenorhabditis elegans sex determination. Genes Dev. 7:216-228[Abstract/Free Full Text].

PERRY, M. D., C. TRENT, B. ROBERTSON, C. CHAMBLIN, and W. B. WOOD, 1994  Sequenced alleles of the C. elegans sex-determining gene her-1 include a novel class of conditional promoter mutations. Genetics 138:317-327[Abstract].

PULAK, R. and P. ANDERSON, 1993  mRNA surveillance by the Caenorhabditis elegans smg genes. Genes Dev. 7:1885-1897[Abstract/Free Full Text].

RAYMOND, C. S., C. E. SHAMU, M. M. SHEN, K. J. SEIFERT, and B. HIRSCH et al., 1998  Evidence for evolutionary conservation of sex-determining genes. Nature 391:692-695.

RYNER, L. and A. SWAIN, 1995  Sex in the '90s. Cell 81:483-493[Medline].

SAMBROOK, J., E. F. FRITSCH and T. MANIATIS, 1989 Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

SCHWARTZ, S., W. MILLER, C. M. YANG, and R. C. HARDISON, 1991  Software tools for analyzing pairwise alignments of long sequences. Nucleic Acids Res. 19:4663-4667[Abstract/Free Full Text].

SONNHAMMER, E. L. L. and R. DURBIN, 1996  A dot-matrix program with dynamic threshold control suited for genomic DNA and protein sequence analysis. Gene 167:GC1-10.

SULSTON, J., and J. HODGKIN, 1988 Methods, pp. 81–122 in The Nematode Caenorhabditis elegans, edited by W. B. WOOD. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

SULSTON, J., Z. DU, K. THOMAS, R. WILSON, and L. HILLIR et al., 1992  The C. elegans genome sequencing project: a beginning. Nature 356:37-41[Medline].

TRENT, C., B. PURNELL, S. GAVINSKI, J. HAGEMAN, and C. CHAMBLIN et al., 1991  Sex-specific transcriptional regulation of the C. elegans sex-determining gene her-1.. Mech. Dev. 34:43-56[Medline].

TSANG, S. S., X. YIN, C. GUZZO-ARKURAN, V. S. JONES, and A. J. DAVISON, 1993  Loss of resolution in gel electrophoresis of RNA: a problem associated with the presence of formaldehyde gradients. Biotechniques 14:380-381[Medline].

TUCKER