Genetics, Vol. 152, 909-919, July 1999, Copyright © 1999

Radiosensitive and Mitotic Recombination Phenotypes of the Saccharomyces cerevisiae dun1 Mutant Defective in DNA Damage-Inducible Gene Expression

Michael Fasulloa,b, Joseph Koudelikb, Peter AhChinga, Peter Giallanzaa, and Cinzia Ceraa
a Department of Biochemistry and Molecular Biology, The Albany Medical College, Albany, New York 12208
b Department of Radiotherapy, Loyola University of Chicago, Maywood, Illinois 60153

Corresponding author: Michael Fasullo, Department of Biochemistry and Molecular Biology, Albany Medical College, 47 New Scotland Ave., Albany, NY 12208., mfasullo{at}ccgateway.amc.edu (E-mail)

Communicating editor: M. LICHTEN


*  ABSTRACT
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

The biological significance of DNA damage-induced gene expression in conferring resistance to DNA-damaging agents is unclear. We investigated the role of DUN1-mediated, DNA damage-inducible gene expression in conferring radiation resistance in Saccharomyces cerevisiae. The DUN1 gene was assigned to the RAD3 epistasis group by quantitating the radiation sensitivities of dun1, rad52, rad1, rad9, rad18 single and double mutants, and of the dun1 rad9 rad52 triple mutant. The dun1 and rad52 single mutants were similar in terms of UV sensitivities; however, the dun1 rad52 double mutant exhibited a synergistic decrease in UV resistance. Both spontaneous intrachromosomal and heteroallelic gene conversion events between two ade2 alleles were enhanced in dun1 mutants, compared to DUN1 strains, and elevated recombination was dependent on RAD52 but not RAD1 gene function. Spontaneous sister chromatid exchange (SCE), as monitored between truncated his3 fragments, was not enhanced in dun1 mutants, but UV-induced SCE and heteroallelic recombination were enhanced. Ionizing radiation and methyl methanesulfonate (MMS)-induced DNA damage did not exhibit greater recombinogenicity in the dun1 mutant compared to the DUN1 strain. We suggest that one function of DUN1-mediated DNA damage-induced gene expression is to channel the repair of UV damage into a nonrecombinogenic repair pathway.


THE expression of radiation-inducible genes is enhanced when cells are exposed to either UV or ionizing radiation. In prokaryotes, radiation induces the SOS response and triggers the expression of genes directly involved in DNA recombination, DNA repair, and cell cycle arrest (for review, see FRIEDBERG et al. 1995 Down). Inducible recombination in prokaryotes functions in postreplication repair of UV-induced DNA lesions (RUPP et al. 1971 Down). The identification in Saccharomyces cerevisiae of both radiation-inducible genes (RUBY and SZOSTAK 1985 Down) and genes that arrest the cell cycle at specific cell cycle checkpoints (WEINERT et al. 1994 Down) underscores the importance of understanding whether radiation resistance in eukaryotes is conferred by elevating the expression of specific repair genes.

In S. cerevisiae, ~1% of the yeast genome is estimated to encode DNA damage-inducible genes (RUBY and SZOSTAK 1985 Down). These genes are involved in DNA metabolism, such as RNR3 (large subunit of ribonucleotide reductase; ELLEDGE and DAVIS 1990 Down), RNR2 (small subunit of ribonucleotide reductase; ELLEDGE and DAVIS 1987 Down), CDC9 (DNA ligase; BARKER et al. 1985 Down), and CDC17 (DNA polymerase {alpha}; JOHNSTON et al. 1987 Down), and in the recombinational repair of double-strand breaks, such as RAD54 (COLE et al. 1987 Down) and the yeast recA homolog, RAD51 (ABOUSSEKHRA et al. 1992 Down; BASILE et al. 1992 Down). Although it would seem logical that radiation-induced gene expression of DNA repair genes would enhance DNA repair, its biological significance in conferring radiation resistance is unclear. First, RAD1 (FRIEDBERG et al. 1995 Down) and RAD52 (COLE et al. 1989 Down), genes that participate directly in the repair of UV or ionizing radiation-induced damage, respectively, are not induced after the exposure of radiation in mitotic cells but are constitutively expressed. Second, deletion of the damage response element (DRE) sequences upstream of either RAD2 (SIEDE et al. 1989 Down) or RAD54 (COLE et al. 1989 Down) does not confer enhanced radiation sensitivity in growing cultures after exposure to UV or ionizing radiation, respectively. Thus, the basal level of expression of DNA repair genes appears sufficient to maintain wild-type levels of DNA damage resistance in mitotic yeast.

The identification of protein kinase mutants defective in the transcriptional induction of RNR3 and hyper-sensitive to DNA-damaging agents, however, has established a biological function for the DNA damage-inducible response in DNA repair. These protein kinases include the serine-threonine kinases Rad53/Sad1 (ALLEN et al. 1994 Down) and Dun1 (ZHOU and ELLEDGE 1993 Down), the ataxia-telangiectasia mutated (ATM)-like kinase, Mec1 (WEINERT et al. 1994 Down), and the casein kinase I isoform Hrr25 (HO et al. 1997 Down). The Dun1 kinase is hypostatic to Rad53/Sad1 and Mec1 protein kinases in the pathway for DNA damage induction (ALLEN et al. 1994 Down), but its epistatic relationship with Hrr25 is unknown (HO et al. 1997 Down). A subset of DNA-damage inducible genes can still be induced in dun1 mutants; for example, induction of RAD51, a gene involved in recombinational repair, is DUN1 independent but RAD9 dependent (ABOUSSEKHRA et al. 1996 Down). Further studies have indicated that the pathways for DUN2 (POL{epsilon})-dependent transcriptional induction and RAD9-mediated cell cycle arrest are independent pathways that respond to DNA damage (NAVAS et al. 1996 Down).

After observing that rad9 mutants, which fail to arrest the cell cycle at the G2 checkpoint (WEINERT and HARTWELL 1988 Down), exhibit higher frequencies of chromosomal rearrangements (FASULLO et al. 1998 Down), we investigated both the recombination and radiosensitive phenotypes of dun1 mutants. We demonstrate that the dun1 rad52 and dun1 rad9 mutants exhibit a synergistic increase in UV sensitivity and that dun1 mutants exhibit enhanced frequencies of spontaneous and UV-induced recombination. We suggest that the DUN1 pathway for DNA damage-induced gene expression participates in the RAD3 pathway, and that DNA damage tolerance in dun1 mutants is partially conferred by RAD52-dependent recombinational mechanisms.


*  MATERIALS AND METHODS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Methods:
Yeast extract, peptone, dextrose (YPD), synthetic dextrose (SD), synthetic complete (SC)-ADE, and SC-HIS are described by SHERMAN et al. 1982 Down. YP(A)D contains YPD supplemented with 80 mg/liter of adenine. Ura- isolates were selected on fluoroorotic acid (FOA) medium (BOEKE et al. 1984 Down). Yeast transformations were done according to CHEN et al. 1992 Down. Petite colonies were scored on YP plates supplemented with 2% lactic acid (pH 5.5).

Yeast strains and plasmids:
Yeast strains are described in Table 1. All yeast strains are derived from W303 (THOMAS and ROTHSTEIN 1989 Down). The rad52, rad9, rad18, and rad1 mutations contain insertions of TRP1, URA3, LEU2, and LEU2, respectively. The dun1{Delta} mutant (YA145), kindly provided by S. Elledge, contains dun1-{Delta}100::HIS3. In the plasmid pZZ66, the dun1-{Delta}100::HIS3 allele is present on a BamHI restriction fragment (ZHOU and ELLEDGE 1993 Down). The dun1-{Delta}100::his3::URA3 mutation was constructed by inserting the 1.1-kb URA3 fragment in the internal HindIII sites of HIS3. After digestion with BamHI, the dun1-{Delta}100::his3::URA3 fragment was then introduced into YA145 by one-step gene disruption (ROTHSTEIN 1983 Down) to generate YD123. The UV sensitivity of the Ura+ His- transformants after 120 J/m2 exposure was then confirmed. Double mutants were made by crossing the appropriate single mutants, dissecting tetrads of the resulting diploids, and identifying meiotic segregants that had the desired auxotrophic phenotype. The rad9 dun1 rad52 triple mutant (YD106) was made by crossing the rad9 single mutant (YA132) with the dun1 rad52 double mutant (YD103), and dissecting tetrads from the sporulated diploid.


 
View this table:
In this window
In a new window

 
Table 1. Yeast strains

Construction of strains to monitor mitotic intrachromosomal and heteroallelic recombination:
YA156 (YKH12a) and YA157 (YKH12{alpha}), kindly provided by L. Symington, contain a nontandem duplication of ade2 that was generated upon integration of the pKH9 (URA3) plasmid (Figure 1). One copy of ade2 contains the nonrevertible allele ade2-a and the other copy of ade2 contains the nonrevertible allele ade2-n (HUANG and SYMINGTON 1994 Down). Haploid strains containing the integrated pKH9, including the dun1 mutant (YD100), the rad52 (YD102), and rad1 (YD108) mutants, and the double dun1 rad52 double mutant (YD110) are meiotic segregants that were obtained after genetic crosses and tetrad dissections. An Ade+ Ura- recombinant of YD100, YD101, was used in genetic crosses for making strains that monitor heteroallelic recombination.



View larger version (16K):
In this window
In a new window
Download PPT slide
 
Figure 1. Recombination assays used in this study. Ovals represent centromeres and lines represent chromosomes. For simplicity, the left arms of chromosomes are not included. (A) Intrachromatid recombination between two heteroalleles of ade2, ade2-a, and ade2-n. The ade2 gene is represented by boxes and a heavy line marks the approximate position of the mutations. The genes are not drawn to scale. Mitotic recombination may result in either Ura+, Ade+ gene conversion events or Ade+, Ura- pop-out events, as described in HUANG and SYMINGTON 1994 Down. (B) Heteroallelic recombination between ade2-a and ade2-n. Mitotic recombination resulting in Ade+ recombinants. (C) Sister chromatid exchange (SCE) between two fragments of his3. The HIS3 gene is denoted by an arrow, the 3' deletion lacking the arrowhead and the 5' deletion lacking the feather tail. The fragments are not drawn to scale. Recombination between the fragments generates HIS3, as described previously (FASULLO and DAVIS 1987 Down).

Heteroallelic recombination was monitored in diploid strains containing ade2-a and ade2-n on different homologs. To identify Ura- Ade- haploids that contained either ade2-a or ade2-n, we obtained FOAR isolates of YA156 and YA157. Primers 5' CGCTATCCTCGGTTCTGCAT 3' and 5' TAACGCCGTATCGTGATTAA 3' were used to amplify the ade2 allele. Digestion of the PCR-amplified product with either AatII or NdeI restriction endonucleases indicated whether the ade2 allele contained one or both of the restriction sites. YD114 and YD115 (Table 1) containing ade2-a and ade2-n alleles, respectively, were mated to generate the diploid YD116; a strain with the identical genotype was made by BAI and SYMINGTON 1996 Down. The ade2-a and ade2-n haploids containing dun1, rad52, and rad1 mutations were generated by genetic crosses of YD114 and YD115 with YD101, YD108, or YD102 and sporulation.

The plasmid pNN287, containing tandem his3 fragments (FASULLO and DAVIS 1987 Down), was introduced into W303 by selecting for Ura+ transformants (YD122). YD122 was then crossed with the dun1-{Delta}100::his3::URA3 mutant, and a meiotic segregant containing both dun1 and the integrated pNN287 was identified (YD123). Verification that His+ recombinants of YD122 resulted from SCE was demonstrated by the linkage of HIS3 and URA3 contained on pNN287. FOAR isolates of these His+ recombinants should be both Ura- and His-. Of 105 His+ recombinants, ~95% of the FOAR were His-, confirming that SCE occurred to generate the original recombinants.

Determining rates of spontaneous recombination and mutagenesis:
Rates of spontaneous, mitotic recombination were determined by the method of the median as described by LEA and COULSON 1949 Down and executed by ESPOSITO et al. 1982 Down. Eleven independent colonies were used for each calculation. Three independent experiments were performed for each strain, and the significance of the differences was determined by the nonparametric statistical Whitney-Mann U-test (ZAR 1996 Down). Recombination rates were determined using colonies arising on YP(A)D medium, on which Ade+ cells have no selective advantage, and both ADE2 and ade2 colonies appeared white.

Quantitating radiation sensitivity and radiation stimulation of recombination:
To quantitate UV or {gamma}-ray sensitivities, strains were grown in YPD to saturation, plated directly on YPD medium after appropriate serial dilution, and irradiated. A 254-nM germicidal lamp (2 J/m2/sec) was used for UV irradiation. A nordion 1.8-kCi 137Cs irradiator was used as a {gamma}-ray source at 7.8 krads/hr. Colony-forming units (CFU) were counted after 3 days of growth and again after 1 wk. At least three independent experiments were performed for each indicated dose. Statistical differences were determined by the two-tailed t-test (ZAR 1996 Down).

To quantitate recombination after radiation or chemical exposure, yeast cultures were either grown to an A600 of 0.5–1 for log phase cells or to an A600 of 4 for stationary phase cells. To arrest cells at the G2 phase of the cell cycle, cells were grown to an A600 of 0.5–1 in YPD, nocodazole [methyl-5-(2-thienylcarbonyl)-H-benzimidazole-2-yl-carbamate] (25) was added to a final concentration of 15 µg/ml, cells were incubated at 30° for 3 hr, and cell cycle arrest was confirmed as previously described (FASULLO et al. 1998 Down). Irradiation protocols are described in FASULLO and DAVE 1994 Down. After irradiation, cells were plated for viability and for the generation of Ade+ or His+ recombinants. Colonies were counted after 3 days of incubation at 30° and again 1 wk later. For all experiments, measurements of the DNA damage-associated recombination were calculated by subtracting the spontaneous frequency from the frequency obtained after exposure to the agent, as in previous studies (FASULLO et al. 1994 Down, FASULLO et al. 1998 Down). Statistical differences were determined by the two-tailed t-test (ZAR 1996 Down).


*  RESULTS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

UV sensitivity of dun1 and assignment of DUN1 to the RAD3 epistasis group:
The UV sensitivity of the dun1 haploid mutant (YA145) was compared to the UV sensitivities of the rad52 (YA133), rad9 (YA132), rad1 (YA131), and rad18 (YA154) haploid mutants (Figure 2). The dun1 mutant exhibited a level of UV sensitivity greater than wild type (P < 0.01) but not significantly different (P > 0.2) from the rad52 mutant defective in recombinational repair. All other single mutants exhibited greater levels of UV sensitivity than the dun1 mutant. To exclude the possibility that the dun1 mutant contained an extragenic suppressor that increased UV resistance, we backcrossed the dun1 mutant with the parental Rad+ W303 strain and determined the UV sensitivity at 30 mJ/m2 of 10 independent haploid segregants containing the dun1::HIS3 disruption. All 10 dun1 haploid segregants exhibited similar UV sensitivity (44% average survival), and all 10 DUN1 haploid segregants exhibited similar UV sensitivity (80% average survival), indicating that the original dun1 mutant did not contain an unlinked extragenic suppressor. Thus, the dun1 mutant is UV sensitive but is significantly more resistant than the mutants defective in the RAD3 or RAD6 pathways.




View larger version (45K):
In this window
In a new window
Download PPT slide
 
Figure 2. Sensitivity to UV of dun1, rad1, rad52, rad18, and rad9 single, double, and triple mutants. Survival curves are the mean of three independent experiments performed on independent segregants. Strains used are DUN1 (YA103, {diamondsuit}), dun1::HIS3 (YA145, {blacksquare}), rad52::TRP1 (YA133, {blacktriangleup}), rad1:LEU2 (YA131, {diamond}), rad9::URA3 (YA132, •), rad18::LEU2 (YA154, {blacktriangleup}), dun1::HIS3 rad52::TRP1 (YD103, X), dun1::HIS3 rad9::URA3 (YD104, {circ}), dun1::HIS3 rad1::LEU2 (YD105, {square}), dun1::HIS3 rad9::URA3 rad52::TRP1 (YD106, {triangleup}), dun1::HIS3 rad18::LEU2. (YD107, •) (A) Survival fractions at 30–120 J/m2 exposure. (B) Survival fractions at 10–30 J/m2.

To determine whether the DUN1 gene participates in either the RAD3, RAD52, or RAD9 pathways for UV resistance, the UV sensitivity of haploid mutants containing combinations of the dun1 null mutation and the rad1, rad9, rad52, and rad18 mutations was quantitated (Figure 2). If DUN1 was important in one particular resistance pathway (epistasis group), then double mutants should exhibit no greater sensitivity than the most sensitive single mutant (HAYNES and KUNZ 1981 Down). If DUN1 participated in a different UV repair pathway, then the double mutant should exhibit a synergistic (greater than additive) increase in UV sensitivity. The dun1 rad52 (YD103) dun1 rad9 (YD104), and dun1 rad18 (YD107) double mutants exhibited synergistic increases in UV sensitivities compared to the single mutants. However, there was no significant difference (P > 0.4) between the UV sensitivity of the dun1 rad1 double and the rad1 single mutant, even at relatively low levels of radiation exposure (10 and 20 J/m2). In comparison to the dun1 rad52 and dun1 rad9 double mutants, the dun1 rad52 rad9 triple mutant (YD106) exhibited a further synergistic increase in UV sensitivity, although the UV sensitivity was not as great as the rad1 mutant. This indicates that DUN1, RAD52, and RAD9 participate in three independent pathways that confer resistance to UV-induced DNA damage and that DUN1 is a member of the RAD3 epistasis group.

We asked whether the synergistic decrease of UV resistance in the dun1 rad52 mutants, compared to the single mutants, depended on haploidy or growth of cells in stationary phase. As observed for the rad52 dun1 haploid cells, the same synergistic decrease in UV survival, compared to rad52 (YD118) and dun1 (YD117) diploid mutants, was observed in rad52 dun1 diploid (YD119) cells (data not shown). This occurred when cells were grown to either log phase or stationary phase. This suggests that RAD52-dependent recombination pathways participate in the tolerance of UV lesions in both haploid or diploid dun1 mutants.

Sensitivity of the dun1 mutant to ionizing radiation:
We asked whether a synergistic increase in ionizing radiation sensitivity, in comparison to the single mutants, also occurred in the dun1 rad52, dun1 rad9, and dun1 rad1 double haploid (Figure 3). In comparison to wild type, all single mutants exhibit {gamma}-ray sensitivity, and rad1 and dun1 mutants exhibit the same low level of {gamma}-ray sensitivity (P > 0.2). The {gamma}-ray sensitivities of the dun1 rad9 and the dun1 rad1 double mutants are not different from the sensitivity of the single rad1 or rad9 mutants (P > 0.3). The {gamma}-ray sensitivity of the dun1 rad52 double mutant was enhanced compared to the rad52 single mutant (P < 0.05) but the increase in sensitivity was not synergistic. These results suggest that unrepaired DNA lesions induced by ionizing radiation in the dun1 mutants are not channeled into either the RAD52 or the RAD6 pathways.



View larger version (27K):
In this window
In a new window
Download PPT slide
 
Figure 3. Sensitivity to ionizing radiation of dun1, rad1, rad52, and rad9 single and double mutants. Survival fraction is plotted against {gamma}-ray dose in kiloradians (10 Gy = 1 krad). Survival curves are the mean of three independent experiments performed on independent segregants, and symbols are as described in legend to Figure 2.

dun1 exhibits higher rates of spontaneous, mitotic heteroallelic recombination:
The UV sensitivities of dun1 mutants suggest that either the RAD52 recombination pathway or the RAD6 error-prone pathway participate in UV resistance in the dun1 mutant. We therefore determined whether dun1 strains exhibit a RAD52-dependent, hyper-recombination phenotype. Recombination assays used included heteroallelic recombination, intrachromosomal recombination, and SCE (Figure 1), since UV exposure stimulates these mitotic recombination events (DAVIES et al. 1975 Down; KADYK and HARTWELL 1993 Down; GALLI and SCHIESTL 1995 Down; FASULLO et al. 1998 Down).

The spontaneous hyper-recombination phenotype of the dun1 mutant was demonstrated by determining the rates of spontaneous Ade+ prototrophs that result from mitotic, homolog recombination between two ade2 alleles, ade2-n and ade2-a. These Ade+ prototrophs can be distinguished from ade2 strains by colony pigment; on YPD medium, Ade+ colonies are white while ade2 strains are red. Since YPD contains insufficient adenine to ensure equal growth rates of Ade+ and Ade- colonies, Ade+ white colony sectors outgrow the perimeter of the red colony, while off-white sectors that do not outgrow the red colonies are Ade- and petite. Dun1 (YD117) colonies accumulated white Ade+ sectors more readily than wild type, but dun1 rad52 (YD119) colonies did not (Figure 4). When colonies are grown on YP(A)D, in which there is no growth advantage for Ade+ sectors, the rate of generating Ade+ prototrophs was ~5-fold above (P < 0.05) wild type (Table 2). Northern blots demonstrated that the level of ade2 RNA from either DUN1 or dun1 strains was equivalent (data not shown), indicating that the increase in recombination is not due to elevated ade2 transcription in the dun1 mutant. The higher rate of recombination in the dun1 mutant is RAD52 dependent; the rate of heteroallelic recombination in the dun1 rad52 double mutant is indistinguishable (P > 0.05) from that of the rad52 mutant and is reduced ~15-fold compared to wild type (Table 2).



View larger version (100K):
In this window
In a new window
Download PPT slide
 
Figure 4. Spontaneous ade2 heteroallelic recombination is exhibited by changes in colony pigment from red (Ade-) to white (Ade+). Colony phenotypes are shown for DUN1 wild-type (YD116), dun1 (YD117), dun1 rad1(YD121), and dun1rad52 (YD119) mutants. Cells were plated on YPD medium and colonies were photographed after a 2-wk incubation.


 
View this table:
In this window
In a new window

 
Table 2. Effect of dun1, rad1, and rad52 mutations on heteroallelic recombination

Since DUN1 participates in the RAD3 pathway, we asked whether the spontaneous hyper-recombination phenotype was dependent upon RAD1 (Table 2). Rates of mitotic heteroallelic recombination in the rad1 strain (YD120) were similar to that of wild type, as expected from previous studies (MONTELONE et al. 1988 Down). The hyper-recombination phenotype of the dun1 mutant was also observed in the rad1 dun1 double mutant (YD121), which is significantly different from wild type (P < 0.05) but not significantly different than dun1 (P > 0.05). Dun1 rad1 colonies also accumulate more white Ade+ sectors than wild type on YPD medium (Figure 4). Thus, the hyper-recombination phenotype of dun1 mutants is not dependent upon RAD1.

AGUILERA and KLEIN 1988 Down identified two classes of mitotic hyper-recombination (hpr) mutants that exhibit elevated intrachromosomal recombination: those that result in increased gene conversion events, and those that result in reciprocal exchange events. We therefore determined whether Ade+ recombinants, occurring by heteroallelic recombination, resulted from gene conversion or reciprocal exchange events. Ten independent, spontaneous Ade+ recombinants isolated from wild type (YD116) and from dun1 (YD117) diploids were sporulated, and tetrads dissected. For all 20 diploids, Ade+::Ade- exhibited 2:2 segregation (data not shown). Ade- meiotic segregants from each Ade+ diploid were backcrossed to ade2-a and ade2-n haploids, YD114 and YD115. If the Ade+ diploid recombinant resulted from reciprocal exchange between the two alleles, then the ade2 meiotic segregants would contain both ade2-a and ade2-n alleles (ade2-a,n), and would not yield spontaneous Ade+ recombinants when backcrossed to YD114 and YD115. From each of the 20 ade2 meiotic segregants from the 10 dun1 recombinants and 10 wild-type recombinants, we obtained Ade- diploids from a single backcross that yielded Ade+ recombinants. Conversion of ade2-a or ade2-n to ADE2 occurred in approximately the same ratio, 8:12. Thus, we conclude that in all 20 Ade+ recombinants from both wild-type and dun1 mutants, ADE2 resulted from gene conversion and not from reciprocal exchange of the two ade2 alleles. We did not address whether such gene conversion events were associated with flanking marker exchange. Our data are consistent with observations that mitotic, heteroallelic recombination predominately results from gene conversion events (reviewed in PETES et al. 1991 Down).

dun1 mutants exhibit more intrachromosomal gene conversion events but fewer pop-out events:
Since the recombination assay that measures heteroallelic recombination generally monitors gene conversion events, we also determined whether dun1 mutants exhibit a bias toward gene conversion events. We used an intrachromosomal recombination assay where pop-outs (loss of an integrated plasmid by either crossovers or gene conversion) could be readily detected (Figure 1). The assay consisted of direct repeats of ade2 that flank URA3 (HUANG and SYMINGTON 1994 Down). The rate of generating Ade+ recombinants was approximately the same in wild type (YA156) as in the dun1 mutant (YD100), but reduced 10-fold in both the rad52 and the rad52 dun1 mutants (Table 3). In wild type, 57% of Ade+ recombinants are Ura- and result from pop-outs; in dun1, rad1, and dun1 rad1 mutants, ~5% were Ura-. Consistent with this observation, the rate at which the integrated pKH9 plasmid is lost in dun1 (YD100), as measured by the rate of FOAR colonies, was 6.1 x 10-6, ~10-fold less than the rate of 5.9 x 10-5 observed in the wild-type strain YA156. This indicates that spontaneous, mitotic recombination in the dun1 mutant results in a higher proportion of gene conversion events and fewer pop-outs. The rad52 and the rad52 dun1 mutants exhibit higher percentages of pop outs, consistent with previous findings that gene conversion events are RAD52-dependent (JACKSON and FINK 1981 Down). Thus, spontaneous intrachromosomal recombination between direct repeats in the dun1 mutant is biased toward gene conversion events that are not associated with crossover events.


 
View this table:
In this window
In a new window

 
Table 3. Effect of dun1, rad52, and rad1 mutations on intrachromosomal recombination

DNA damage-induced mitotic recombination in the dun1 mutant:
If UV resistance in dun1 mutants is partially conferred by RAD52-dependent recombinational repair, then UV-induced mitotic recombination should be enhanced in dun1 mutants. Since the synergistic effect of dun1 and rad52 is observed in haploids, where heteroallelic recombination does not occur, as well as diploids, we investigated whether dun1 mutants exhibit an enhanced level of UV-induced unequal SCE (Table 4). We found no differences in the rate of spontaneous SCE in the dun1 mutant (1.1 ± 0.2) x 10-6, compared to the rate in wild type (1.4 ± 0.3) x 10-6. After UV irradiation, we observed significant (P < 0.05) two- to threefold increases in recombination, compared to wild type. However, if cells were arrested in G2 with the microtubule inhibitor nocodazole prior to irradiation, there was no difference between the stimulation of SCE events in the dun1 mutant compared to wild type. We speculate that dun1-enhanced UV-stimulated SCE depends on replication of the UV dimer.


 
View this table:
In this window
In a new window

 
Table 4. Stimulation of SCE by UV in DUN1 and the dun1 mutant

Since spontaneous heteroallelic recombination is greater in dun1 diploids than wild type, we exposed both wild-type and dun1 diploid mutants to UV, {gamma}-rays, and MMS to quantitate whether the stimulation of heteroallelic recombination was greater in dun1 cells for any particular DNA damaging agent (Table 5). Although the dun1-enhanced recombination is modest (approximately twofold), it is significantly different (P < 0.01) from wild-type levels of UV stimulation. However, there was no increase in the levels of {gamma}-ray and MMS-stimulated heteroallelic recombination in the dun1 mutant (data not shown). Thus, the recombinogenicity of only a subset of DNA-damaging agents is enhanced in dun1.


 
View this table:
In this window
In a new window

 
Table 5. Stimulation of heteroallelic recombination by DNA-damaging agents in DUN1 and the dun1::HIS3 diploids

Higher percentages of petites are generated in dun1 mutants:
We observed a 10-fold higher percentage of petites generated in the dun1 (YA145) strain (7.1 ± 0.9% or 57/804 total) compared to the wild-type (YA103) strain (0.7 ± 0.4% or 13/1697 total). However, rates of spontaneous reversion to Trp+ and Ade+ prototrophy due to spontaneous mutagenesis are not higher in the dun1 mutant (data not shown). Since mitochondrial DNA repair is less efficient than genomic DNA repair (YAKES and VAN HOUTEN 1997 Down), higher spontaneous numbers of petites is consistent with the DNA repair defect.


*  DISCUSSION
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Three independent pathways participate in the repair of UV-induced DNA damage in S. cerevisiae. These include pathways for excision repair, mutagenic repair, and recombinational repair. Which pathway is chosen to repair UV-induced DNA damage is not completely understood. DUN1 encodes a serine-threonine protein kinase that is activated by signal transduction pathways for sensing DNA damage. Dun1 mutants, which exhibit both UV and MMS sensitivity, are defective in DNA damage-inducible expression of ribonucleotide reductase (ZHOU and ELLEDGE 1993 Down) and MAG1 (LIU 1997 Down) and are partially defective in DNA damage-induced G2 checkpoint (PATI et al. 1997 Down). In this study, we demonstrate that DUN1 participates in the RAD3 pathway for excision repair and that dun1 mutants exhibit higher rates of spontaneous gene conversion and enhanced UV-induced mitotic recombination. We suggest that the DUN1 pathway for DNA damage-induced gene expression channels the repair of UV damage into a nonrecombinogenic pathway.

The participation of DUN1 in the RAD3 epistasis group elucidates previous observations that DUN2 (POL{epsilon})-mediated transcriptional induction and RAD9-mediated cell cycle arrest are independent DNA damage-inducible pathways (NAVAS et al. 1996 Down). The independence of these pathways was supported by the enhanced UV sensitivity of the dun2 rad9 mutant, compared to the single mutants. Based on the participation of DUN1 in the excision repair pathway, we speculate that the DUN2 pathway may activate other genes that participate in UV excision repair.

Differences in genetic interactions between rad9 and dun1 regarding sensitivity to UV and ionizing radiation:
Since several models of DNA double-strand break repair involve DNA synthesis (SZOSTAK et al. 1983 Down; MALKOVA et al. 1996 Down), we expected that dun1 mutants would also be sensitive to ionizing radiation. However, we observed no synergism between rad9 and dun1 with respect to {gamma}-ray sensitivity. Nonetheless, the dun1 {gamma}-ray sensitivity is still consistent with DUN1 belonging to the RAD3 epistasis group, since dun1 mutants exhibit the same level of {gamma}-ray sensitivity as rad1 mutants. Essentially identical {gamma}-ray survival curves are obtained for single mutants dun1 and rad1 and for rad1 dun1 double mutants (Figure 3), for rad9 and dun1 rad9 (Figure 3), and for rad9 and rad9 rad1 (FASULLO et al. 1998 Down). Further experiments are in progress to determine whether DUN1, similar to RAD1, participates in the single-strand annealing (SSA) mechanism for double-strand break repair (FISHMAN-LOBELL and HABER 1992 Down).

Recombination phenotypes of the dun1 mutants:
Since tolerance to DNA damage in dun1 mutants is partially conferred by RAD52-dependent mechanisms, it is interesting that only a subset of spontaneous RAD52-dependent recombination events is enhanced in the dun1 mutant, compared to wild-type strains. While spontaneous heteroallelic and intrachromosomal gene conversion events are enhanced, intrachromosomal pop-outs are decreased, and spontaneous unequal SCE is unchanged in dun1 mutants. Although we do not understand why the proportion of intrachromosomal recombination events that result from exchange (pop-outs) is decreased in the dun1 mutant, a similar phenomena (Table 3) was observed for rad1 mutants, suggesting that DUN1 also participates in the SSA mechanism for spontaneous recombination. We speculate that the unchanged rate of spontaneous SCE in dun1 mutants, compared to the rate in wild type, results from a lower level of crossovers but a higher level of sister-chromatid gene conversions. However, due to the low frequency of spontaneous SCE, the percentages of spontaneous SCE that result from reciprocal exchanges and gene conversion events are unknown (FASULLO and DAVIS 1987 Down; KADYK and HARTWELL 1992 Down). Thus, detection of enhanced spontaneous recombination in dun1 mutants may depend on the recombination assays used to monitor gene conversion.

Which spontaneous DNA lesions are more recombinogenic in the dun1 mutant is unclear. Spontaneous DNA lesions include those that result from oxidation and alkylation damage (depurination). Since neither ionizing radiation nor MMS were more recombinogenic in dun1 mutants, dun1-enhanced spontaneous recombination may result from spontaneous DNA lesions similar to those induced by UV.

The synergistic increase in UV sensitivity in the rad52 dun1 double mutant, compared to the single mutants, for both haploids and diploids, suggests that one recombination mechanism by which UV damage is tolerated in dun1 mutants is SCE. Although in comparison to wild type, the frequency of UV-stimulated recombinants that result from unequal SCE increased a modest two- to threefold in the dun1 strain, a more direct physical measurement of SCE may demonstrate a greater enhancement. Less enhanced UV stimulation of heteroallelic recombination in the dun1 mutant is consistent with observations that sister chromatids are preferred substrates for DNA repair (KADYK and HARTWELL 1992 Down). Thus, we suggest that higher levels of SCE and heteroallelic recombination constitute a subset of RAD52-dependent mechanisms that lead to DNA damage tolerance in the dun1 mutant.

Possible mechanisms for dun1-stimulated recombination:
The RAD1 independence of the spontaneous hyper-recombination phenotype of the dun1 mutants suggests possible mechanisms for how dun1-enhanced recombination occurs. Similar to dun1 recombination phenotypes, spontaneous RAD1-independent intrachromosomal recombination (RATTRAY and SYMINGTON 1995 Down) and UV-induced RAD1-independent unequal SCE (PAULOVICH et al. 1998 Down) mostly occurs by RAD52-dependent gene conversion. KADYK and HARTWELL 1993 Down suggest that such SCE events may be initiated when UV lesions are bypassed by the replication machinery; the resulting recombinogenic single-strand gaps may then be processed into either daughter-strand gap, double-strand break, or replication slippage pathways. The cell cycle dependence of the dun1-enhanced UV stimulation also suggests that in dun1 mutants, some UV lesions are bypassed by the replication enzymatic machinery and the resulting recombinogenic single-strand gaps may trigger RAD52-dependent recombination.

The RAD1-independence of the dun1 hyper-recombination phenotype differs from the RAD1-dependence of the hyper-recombination phenotypes of other DNA repair mutants. These include rad9 mutants (FASULLO et al. 1998 Down) and rem mutants (MALONE and HOEKSTRA 1984 Down) defective in the Rad3 helicase (MONTELONE et al. 1988 Down). Rad1, as part of the Rad1-Rad10 endonuclease (BARDWELL et al. 1994 Down), may participate in mitotic recombination by excising nonhomologous DNA from recombinogenic double-strand breaks to form stable recombination intermediates (FISHMAN-LOBELL and HABER 1992 Down), or by processing DNA lesions into recombinogenic single-stranded DNA during excision repair (MONTELONE et al. 1988 Down). The first role of RAD1 may be important in hyper-recombination mutants where recombination between repeated sequences on nonhomologous chromosomes (ectopic recombination) is enhanced (BAILIS et al. 1992 Down; FASULLO et al. 1998 Down). Since the dun1-enhanced recombination occurs between homologs or chromatids that are essentially identical, and the initiating lesion may be generated by DNA replication, RAD1 may not be needed to either initiate or process the recombination intermediates.

DNA damage-inducible gene expression and dun1 phenotypes:
The DUN1 pathway for DNA damage-inducible gene expression controls the expression of several genes involved in DNA repair, rendering it difficult to ascribe all the dun1 phenotypes to a defect in the DNA damage inducibility of the RNR genes. However, the UV sensitivity of dun1 mutants can be suppressed by the overexpression of RNR1 (ZHAO et al. 1998 Down), and cells exposed to hydroxyurea, an inhibitor of ribonucleotide reductase, also exhibit more mitotic recombination (GALLI and SCHIESTL 1996 Down). Both dun1 and cdc8 (deoxythymidylate kinase; JONG et al. 1984 Down) mutants exhibit higher levels of mitotic recombination and spontaneous petites (SCLAFANI and FANGMAN 1984 Down). Thus, by analogy with cdc8 phenotypes, nulceotide imbalance may result in some of the dun1 phenotypes.

Since the substrates for the Dun1 protein kinase have not been identified, we cannot exclude the possibility that some dun1 phenotypes directly result from failure to phosphorylate DNA repair proteins. For example, the Srs2/RadH/Hpr5 helicase, which exhibits amino acid similarity to UvrD, contains several potential phosphorylation sites for serine/threonine protein kinases (genetics computer group, protein motif comparison). Hpr5 mutants exhibit variable, elevated rates of mitotic gene conversion (PALLADINO and KLEIN 1992 Down). Thus, a full explanation for the dun1 recombination phenotypes awaits the identification of the substrates of Dun1 kinase.

Mutants defective in other yeast protein kinases, including Cdc5 (AGUILERA and KLEIN 1988 Down) and Pkc1 (HUANG and SYMINGTON 1994 Down), exhibit spontaneous hyper-recombination phenotypes. Currently the interactions between these protein kinases and Dun1 is unknown. PKC1 is involved in stress responses that include heat and osmotic shock, and pkc1 mutants exhibit an extended S phase (LEVIN and BARTLETT-HEUBUSCH 1992 Down). Heat shock may induce recombination by causing oxidative damage (BRENNAN et al. 1994 Down; DAVIDSON et al. 1996 Down). Thus, it would be interesting if pkc1 rad52 double mutants exhibited a synergistic sensitivity to environmental stress.

Summary:
We have shown that DNA damage tolerance in dun1 mutants is partially conferred by RAD52-dependent recombination. This is the first demonstration that a defect in a protein kinase directly involved in the transcriptional induction of DNA damage-inducible genes also increases spontaneous, mitotic recombination in yeast. It will be important to determine whether other protein kinases involved in the DNA damage-inducible responses have similar phenotypes.


*  ACKNOWLEDGMENTS

We thank R. Rothstein for the W303 derived strains that contain the rad1, rad52, rad9, and rad18 gene disruptions, S. Elledge and Z. Zhou for dun1 mutants, and L. Symington for YK12. We thank N. Faegerman, T. Hryciw, W. Xiao, and Z. Dong or carefully reading this manuscript. The work was supported by U.S. Public Health Service grant CA70105, and a grant from the Leukemia Research Foundation.

Manuscript received November 18, 1998; Accepted for publication April 15, 1999.


*  LITERATURE CITED
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

ABOUSSEKHRA, A., R. CHANET, A. ADJIRI, and F. FABRE, 1992  Semidominant suppressors of Srs2 helicase mutation of Saccharomyces cerevisiae map in the RAD51 gene, whose sequence predicts a protein with similarities to procaryotic RecA proteins. Mol. Cell. Biol. 12:3224-3234[Abstract/Free Full Text].

ABOUSSEKHRA, A., J. E. VIALARD, D. MORRISON, M. A. TORR-RUIZ, and L. CERNAKOVA et al., 1996  A novel role for the budding yeast RAD9 checkpoint gene in DNA damage-dependent transcription. EMBO J. 15:3912-3933[Medline].

ALLEN, J. B., Z. ZHOU, W. SIEDE, E. C. FRIEDBERG, and S. J. ELLEDGE, 1994  The SAD1/RAD53 protein kinase controls multiple checkpoints and DNA damage-induced transcription in yeast. Genes Dev. 8:2401-2415[Abstract/Free Full Text].

AGUILERA, A. and H. L. KLEIN, 1988  Genetic control of intrachromosomal recombination of Saccharomyces cerevisiae. I. Isolation and genetic characterization of hyper-recombination mutations. Genetics 119:779-790[Abstract/Free Full Text].

BAI, Y. and L. S. SYMINGTON, 1996  A Rad52 homolog is required for RAD51-independent mitotic recombination in Saccharomyces cerevisiae.. Genes Dev. 10:2025-2037[Abstract/Free Full Text].

BAILIS, A. M., L. ARTHUR, and R. ROTHSTEIN, 1992  Genome rearrangement in top3 mutants of Saccharomyces cerevisiae requires a functional RAD1 excision repair gene. Mol. Cell. Biol. 12:4988-4993[Abstract/Free Full Text].

BARDWELL, A. J., L. BARDWELL, A. E. TOMKINSON, and E. C. FRIEDBERG, 1994  Specific cleavage of model recombination and repair intermediates by the yeast Rad1/Rad10 endonuclease. Science 265:2082-2085[Abstract/Free Full Text].

BARKER, D. G., J. H. M. WHITE, and L. H. JOHNSTON, 1985  The nucleotide sequence of the DNA ligase gene (CDC9) from Saccharomyces cerevisiae, a gene which is cell cycle regulated and induced in response to DNA damage. Nucleic Acids Res. 13:8323-8338[Abstract/Free Full Text].

BASILE, G., M. AKER, and R. K. MORTIMER, 1992  Nucleotide sequence and transcriptional regulation of the yeast recombinational repair gene RAD51.. Mol. Cell. Biol. 12:3235-3246[Abstract/Free Full Text].

BOEKE, J. D., F. LACROUTE, and G. R. FINK, 1984  A positive selection for mutants lacking orotidene-5'-phosphate decarboxylase activity in yeast: 5-fluoro-orotic acid resistance. Mol. Gen. Genet. 197:345-347[Medline].

BRENNAN, R. J., E. P. S. BENNET, and R. H. SCHIESTL, 1994  Oxidative mutagens induce intrachromosomal recombination in yeast. Mutat. Res. 308:159-167[Medline].

CHEN, D., B. YANG, and T. KUO, 1992  One-step transformation of yeast in stationary phase. Curr. Genet. 21:83-84[Medline].

COLE, G. M., D. SCHILD, S. T. LOVETT, and R. K. MORTIMER, 1987  Regulation of RAD54- and RAD52-lacZ gene fusions in Saccharomyces cerevisiae in response to DNA damage. Mol. Cell. Biol. 7:1078-1084[Abstract/Free Full Text].

COLE, G. M., S. T. LOVETT, D. SCHILD, and R. K. MORTIMER, 1989  Failure to induce a DNA repair gene, RAD54, in Saccharomyces cerevisiae does not affect DNA repair or recombination pathways. Mol. Cell. Biol. 9:3314-3322[Abstract/Free Full Text].

DAVIDSON, J. F., B. WHYTE, P. H. BISSINGER, and R. H. SCHIESTL, 1996  Oxidative stress is involved in heat-induced cell death in Saccharomyces cerevisiae.. Proc. Natl. Acad. Sci. USA 93:5116-5121[Abstract/Free Full Text].

DAVIES, P. J., W. E. EVANS, and J. M. PARRY, 1975  Mitotic recombination induced by chemical and physical agents in the yeast Saccharomyces cerevisiae.. Mutat. Res. 51:327-332.

ELLEDGE, S. J. and R. W. DAVIS, 1987  Identification and isolation of the gene encoding the small subunit of ribonucleotide reductase from Saccharomyces cerevisiae.. Mol. Cell. Biol. 7:2783-2793[Abstract/Free Full Text].

ELLEDGE, S. J. and R. W. DAVIS, 1990  Two genes differtially regulated in the cell cycle and by DNA damaging agents encode alternative regulatory elements of ribonucleotide reductase. Genes Devel. 4:4932-4940.

ESPOSITO, M. S., D. T. MALEAS, K. A. BJORNSTAD, and C. V. BRUSCHI, 1982  Simultaneous detection of changes in chromosome number, gene conversion and intergenic recombination during mitosis of Saccharomyces cerevisiae: spontaneous and ultraviolet light induced events. Curr. Genet. 6:5-11.

FASULLO, M. and P. DAVE, 1994  Mating-type regulates the DNA damage-associated stimulation of reciprocal translocation events in Saccharomyces cerevisiae.. Mol. Gen. Genet. 243:63-70[Medline].

FASULLO, M. T. and R. W. DAVIS, 1987  Recombinational substrates designed to study recombination between unique and repetitive sequences in vivo.. Proc. Natl. Acad. Sci. USA 84:6215-6219[Abstract/Free Full Text].

FASULLO, M., P. DAVE, and R. ROTHSTEIN, 1994  DNA-damaging agents stimulate the formation of directed reciprocal translocations in Saccharomyces cerevisiae.. Mutat. Res. 314:121-133[Medline].

FASULLO, M., T. BENNETT, P. AHCHING, and J. KOUDELIK, 1998  The Saccharomyces cerevisiae RAD9 checkpoint reduces the DNA damage-associated stimulation of directed translocations. Mol. Cell. Biol. 18:1190-1200[Abstract/Free Full Text].

FISHMAN-LOBELL, J. and J. HABER, 1992  Removal of non-homologous DNA ends in double-strand break recombination—the role of the yeast ultraviolet repair gene RAD1.. Science 258:480-484[Abstract/Free Full Text].

FRIEDBERG, E. C., G. C. WALKER and W. SIEDE, 1995 DNA Repair and Mutagenesis. American Society for Microbiology Press, Washington DC.

GALLI, A. and R. H. SCHIESTL, 1995  On the mechanism of UV and gamma-ray induced intrachromosomal recombination in yeast cells synchronized in different stages of the cell cycle. Mol. Gen. Genet. 248:301-310[Medline].

GALLI, A. and R. H. SCHIESTL, 1996  Hydroxyurea induces recombination in dividing but not in G1 or G2 cell cycle arrested yeast cells. Mut. Res. 354:69-75[Medline].

HAYNES, R. H., and B. A. KUNZ, 1981 DNA repair and mutagenesis in yeast, pp. 371–414 in The Molecular Biology of the Yeast Saccharomyces, edited by J. STRATHERN, E. JONES and J. BROACH, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

HO, Y., S. MASON, R. KOBAYASHI, M. HOEKSTRA, and B. ANDREWS, 1997  Role of the casein kinase I isoform, Hrr25, and the cell cycle-regulatory transcription factor, SBF, in the transcriptional response to DNA damage in Saccharomyces cerevisiae.. Proc. Natl. Acad. Sci. USA 94:581-586[Abstract/Free Full Text].

HUANG, K. and L. S. SYMINGTON, 1994  Mutation of the gene encoding protein kinase C 1 stimulates mitotic recombination in Saccharomyces cerevisiae.. Mol. Cell. Biol 14:6039-6044[Abstract/Free Full Text].

JACKSON, J. A. and G. R. FINK, 1981  Gene conversion between duplicated genetic elements in yeast. Nature 292:306-311[Medline].

JOHNSTON, L. H., J. H. M. WHITE, A. L. JOHNSON, G. LUCCHINI, and P. PLEVANI, 1987  The yeast DNA polymerase I transcript is regulated in both the mitotic cell cycle and in meiosis and is also induced after DNA damage. Nucleic Acids Res. 15:5017-5030[Abstract/Free Full Text].

JONG, A. Y. S., C. L. KUO, and J. L. CAMPBELL, 1984  The CDC8 gene of yeast encodes thymidylate kinase. J. Biol. Chem. 259:11052-11059[Abstract/Free Full Text].

KADYK, L. C. and L. H. HARTWELL, 1992  Sister chromatids are preferred over homologs as substrates for recombinational repair in Saccharomyces cerevisiae.. Genetics 132:387-402[Abstract].

KADYK, L. C. and L. H. HARTWELL, 1993  Replication dependent sister chromatid recombination in rad1 mutants of Saccharomyces cerevisiae.. Genetics 133:469-487[Abstract].

LEA, D. E. and C. A. COULSON, 1949  The distribution of the numbers of mutants in bacterial populations. J. Genet. 49:264-284.

LEVIN, D. E. and E. BARTLETT-HEUBUSCH, 1992  Mutants in the S. cerevisiae PKC1 gene display a cell cycle-specific osmotic stability defect. J. Cell Biol. 116:1221-1229[Abstract/Free Full Text].

LIU, Y., 1997 Molecular regulatory mechanisms of DNA damage-inducible genes, MAG1 and DDI1, from Saccharomyces cerevisiae. Ph.D. Thesis, University of Saskatchewan, Saskatoon, Canada.

MALKOVA, A., E. IVANOV, and J. E. HABER, 1996  Double-strand break repair in the absence of RAD51 in yeast: a possible role for break-induced DNA replication. Proc. Natl. Acad. Sci. USA 93:7131-7136[Abstract/Free Full Text].

MALONE, R. E. and M. F. HOEKSTRA, 1984  Relationship between a hyper-rec mutation (rem1) and other recombination and repair genes in yeast. Genetics 107:33-48[Abstract/Free Full Text].

MONTELONE, B. A., M. F. HOEKSTRA, and R. E. MALONE, 1988  Spontaneous mitotic recombination in yeast: the hyper-recombinational rem1 mutations are alleles of the RAD3 gene. Genetics 119:289-301[Abstract/Free Full Text].

NAVAS, T. A., Y. SANCHEZ, and S. J. ELLEDGE, 1996  RAD9 and DNA polymerase {epsilon} form parallel sensory branches for transducing the DNA damage checkpoint signal in Saccharomyces cerevisiae.. Genes Dev. 10:2632-2643[Abstract/Free Full Text].

PALLADINO, F. and H. KLEIN, 1992  Analysis of mitotic and meiotic defects in Saccharomyces cerevisiae SRS2 DNA helicase mutants. Genetics 132:23-37[Abstract].

PATI, D., C. KELLER, M. GROUDINE, and S. PLON, 1997  Reconstitution of a MEC1-independent checkpoint in yeast by expression of a novel human fork head cDNA. Mol. Cell. Biol. 17:3037-3046[Abstract/Free Full Text].

PAULOVICH, A. G., C. D. ARMOUR, and L. H. HARTWELL, 1998  RAD9, RAD17, RAD24, and MEC3 genes are required for tolerating irreparable, ultraviolet-induced DNA damage. Genetics 150:75-93[Abstract/Free Full Text].

PETES, T. D., R. E. MALONE and L. S. SYMINGTON, 1991 Recombination in yeast, pp. 407–523 in The Molecular and Cellular Biology of the Yeast Saccharomyces, edited by J. R. BROACH, J. R. PRINGLE and E. W. JONES, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

RATTRAY, A. and L. SYMINGTON, 1995  Multiple pathways for homologous recombination in Saccharomyces cerevisiae.. Genetics 139:45-56[Abstract].

ROTHSTEIN, R. J., 1983  One step gene disruption in yeast. Methods Enzymol. 101:202-211[Medline].

RUBY, S. and J. SZOSTAK, 1985  Specific Saccharomyces cerevisiae genes are expressed in response to DNA-damaging agents. Mol. Cell. Biol. 5:75-84[Abstract/Free Full Text].

RUPP, W. D., C. E. I. WILDE, D. L. RENO, and P. HOWARD-FLANDERS, 1971  Exchanges between DNA strands in ultraviolet-irradiated Escherichia coli.. J. Mol. Biol. 61:25-44[Medline].

SCLAFANI, R. A. and W. L. FANGMAN, 1984  Yeast gene CDC8 encodes thymidylate kinase and is complemented by herpes thymidine kinase gene TK. Proc. Natl. Acad. Sci. USA 81:5821-5826[Abstract/Free Full Text].

SHERMAN, F., G. R. FINK and J. B. HICKS, 1982 Methods of Yeast Genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

SIEDE, W., G. W. ROBINSON, D. KALAINOV, T. MALLEY, and E. C. FRIEDBERG, 1989  Regulation of the RAD2 gene of Saccharomyces cerevisiae.. Mol. Microbiol. 3:1697[Medline].

SZOSTAK, J. W., T. L. ORR-WEAVER, R. ROTHSTEIN, and F. W. STAHL, 1983  The double-strand break model for recombination. Cell 33:25-35[Medline].

THOMAS, B. J. and R. ROTHSTEIN, 1989  The genetic control of direct-repeat recombination in Saccharomyces: the effect of rad52 and rad1 on mitotic recombination at GAL10, a transcriptionally regulated gene. Genetics 123:725-738[Abstract/Free Full Text].

WEINERT, T. A. and L. H. HARTWELL, 1988  The RAD9 gene controls the cell cycle response to DNA damage in Saccharomyces cerevisiae.. Science 241:317-322[Abstract/Free Full Text].

WEINERT, T. A., G. L. KISER, and L. H. HARTWELL, 1994  Mitotic checkpoint genes in budding yeast and the dependence of mitosis on DNA replication and repair. Genes Dev. 8:652-665[Abstract/Free Full Text].

YAKES, F. M. and B. VAN HOUTEN, 1997  Mitochondrial DNA damage is more extensive and persists longer than nuclear DNA damage in human cells following oxidative stress. Proc. Natl. Acad. Sci. USA 94:514-519[Abstract/Free Full Text].

ZAR, J. H., 1996 Biostatistical Analysis. Prentice Hall, Inc., Englewood Cliffs, NJ.

ZHAO, X., E. G. MULLER, and R. ROTHSTEIN, 1998  A suppressor of two essential checkpoint genes identifies a novel protein that negatively affects dNTP pools. Mol. Cell. Biol. 2:329-340.

ZHOU, Z. and S. J. ELLEDGE, 1993  DUN1 encodes a protein kinase that controls the DNA damage response in yeast. Cell 75:1119-1127[Medline].




This article has been cited by other articles:


Home page
GeneticsHome page
E. Coic, T. Feldman, A. S. Landman, and J. E. Haber
Mechanisms of Rad52-Independent Spontaneous and UV-Induced Mitotic Recombination in Saccharomyces cerevisiae
Genetics, May 1, 2008; 179(1): 199 - 211.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
C. J. Ramey, S. Howar, M. Adkins, J. Linger, J. Spicer, and J. K. Tyler
Activation of the DNA Damage Checkpoint in Yeast Lacking the Histone Chaperone Anti-Silencing Function 1
Mol. Cell. Biol., December 1, 2004; 24(23): 10313 - 10327.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
K. L. Schollaert, J. M. Poisson, J. S. Searle, J. A. Schwanekamp, C. R. Tomlinson, and Y. Sanchez
A Role for Saccharomyces cerevisiae Chk1p in the Response to Replication Blocks
Mol. Biol. Cell, September 1, 2004; 15(9): 4051 - 4063.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
R. A. Hand, N. Jia, M. Bard, and R. J. Craven
Saccharomyces cerevisiae Dap1p, a Novel DNA Damage Response Protein Related to the Mammalian Membrane-Associated Progesterone Receptor
Eukaryot. Cell, April 1, 2003; 2(2): 306 - 317.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. Chang, M. Bellaoui, C. Boone, and G. W. Brown
A genome-wide screen for methyl methanesulfonate-sensitive mutants reveals genes required for S phase progression in the presence of DNA damage
PNAS, December 24, 2002; 99(26): 16934 - 16939.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Hammet, B. L. Pike, and J. Heierhorst
Posttranscriptional Regulation of the RAD5 DNA Repair Gene by the Dun1 Kinase and the Pan2-Pan3 Poly(A)-Nuclease Complex Contributes to Survival of Replication Blocks
J. Biol. Chem., June 14, 2002; 277(25): 22469 - 22474.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
F. Osman, I. R. Tsaneva, M. C. Whitby, and C. L. Doe
UV Irradiation Causes the Loss of Viable Mitotic Recombinants in Schizosaccharomyces pombe Cells Lacking the G2/M DNA Damage Checkpoint
Genetics, March 1, 2002; 160(3): 891 - 908.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
V. I. Bashkirov, J. S. King, E. V. Bashkirova, J. Schmuckli-Maurer, and W.-D. Heyer
DNA Repair Protein Rad55 Is a Terminal Substrate of the DNA Damage Checkpoints
Mol. Cell. Biol., June 15, 2000; 20(12): 4393 - 4404.
[Abstract] [Full Text] [PDF]