- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Fasullo, M.
- Articles by Cera, C.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Fasullo, M.
- Articles by Cera, C.
Radiosensitive and Mitotic Recombination Phenotypes of the Saccharomyces cerevisiae dun1 Mutant Defective in DNA Damage-Inducible Gene Expression
Michael Fasulloa,b, Joseph Koudelikb, Peter AhChinga, Peter Giallanzaa, and Cinzia Ceraaa Department of Biochemistry and Molecular Biology, The Albany Medical College, Albany, New York 12208
b Department of Radiotherapy, Loyola University of Chicago, Maywood, Illinois 60153
Corresponding author: Michael Fasullo, Department of Biochemistry and Molecular Biology, Albany Medical College, 47 New Scotland Ave., Albany, NY 12208., mfasullo{at}ccgateway.amc.edu (E-mail)
Communicating editor: M. LICHTEN
| ABSTRACT |
|---|
The biological significance of DNA damage-induced gene expression in conferring resistance to DNA-damaging agents is unclear. We investigated the role of DUN1-mediated, DNA damage-inducible gene expression in conferring radiation resistance in Saccharomyces cerevisiae. The DUN1 gene was assigned to the RAD3 epistasis group by quantitating the radiation sensitivities of dun1, rad52, rad1, rad9, rad18 single and double mutants, and of the dun1 rad9 rad52 triple mutant. The dun1 and rad52 single mutants were similar in terms of UV sensitivities; however, the dun1 rad52 double mutant exhibited a synergistic decrease in UV resistance. Both spontaneous intrachromosomal and heteroallelic gene conversion events between two ade2 alleles were enhanced in dun1 mutants, compared to DUN1 strains, and elevated recombination was dependent on RAD52 but not RAD1 gene function. Spontaneous sister chromatid exchange (SCE), as monitored between truncated his3 fragments, was not enhanced in dun1 mutants, but UV-induced SCE and heteroallelic recombination were enhanced. Ionizing radiation and methyl methanesulfonate (MMS)-induced DNA damage did not exhibit greater recombinogenicity in the dun1 mutant compared to the DUN1 strain. We suggest that one function of DUN1-mediated DNA damage-induced gene expression is to channel the repair of UV damage into a nonrecombinogenic repair pathway.
THE expression of radiation-inducible genes is enhanced when cells are exposed to either UV or ionizing radiation. In prokaryotes, radiation induces the SOS response and triggers the expression of genes directly involved in DNA recombination, DNA repair, and cell cycle arrest (for review, see ![]()
![]()
![]()
![]()
In S. cerevisiae, ~1% of the yeast genome is estimated to encode DNA damage-inducible genes (![]()
![]()
![]()
![]()
; ![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
The identification of protein kinase mutants defective in the transcriptional induction of RNR3 and hyper-sensitive to DNA-damaging agents, however, has established a biological function for the DNA damage-inducible response in DNA repair. These protein kinases include the serine-threonine kinases Rad53/Sad1 (![]()
![]()
![]()
![]()
![]()
![]()
![]()
)-dependent transcriptional induction and RAD9-mediated cell cycle arrest are independent pathways that respond to DNA damage (![]()
After observing that rad9 mutants, which fail to arrest the cell cycle at the G2 checkpoint (![]()
![]()
| MATERIALS AND METHODS |
|---|
Methods:
Yeast extract, peptone, dextrose (YPD), synthetic dextrose (SD), synthetic complete (SC)-ADE, and SC-HIS are described by ![]()
![]()
![]()
Yeast strains and plasmids:
Yeast strains are described in Table 1. All yeast strains are derived from W303 (![]()
mutant (YA145), kindly provided by S. Elledge, contains dun1-
100::HIS3. In the plasmid pZZ66, the dun1-
100::HIS3 allele is present on a BamHI restriction fragment (![]()
100::his3::URA3 mutation was constructed by inserting the 1.1-kb URA3 fragment in the internal HindIII sites of HIS3. After digestion with BamHI, the dun1-
100::his3::URA3 fragment was then introduced into YA145 by one-step gene disruption (![]()
|
Construction of strains to monitor mitotic intrachromosomal and heteroallelic recombination:
YA156 (YKH12a) and YA157 (YKH12
), kindly provided by L. Symington, contain a nontandem duplication of ade2 that was generated upon integration of the pKH9 (URA3) plasmid (Figure 1). One copy of ade2 contains the nonrevertible allele ade2-a and the other copy of ade2 contains the nonrevertible allele ade2-n (![]()
|
Heteroallelic recombination was monitored in diploid strains containing ade2-a and ade2-n on different homologs. To identify Ura- Ade- haploids that contained either ade2-a or ade2-n, we obtained FOAR isolates of YA156 and YA157. Primers 5' CGCTATCCTCGGTTCTGCAT 3' and 5' TAACGCCGTATCGTGATTAA 3' were used to amplify the ade2 allele. Digestion of the PCR-amplified product with either AatII or NdeI restriction endonucleases indicated whether the ade2 allele contained one or both of the restriction sites. YD114 and YD115 (Table 1) containing ade2-a and ade2-n alleles, respectively, were mated to generate the diploid YD116; a strain with the identical genotype was made by ![]()
The plasmid pNN287, containing tandem his3 fragments (![]()
100::his3::URA3 mutant, and a meiotic segregant containing both dun1 and the integrated pNN287 was identified (YD123). Verification that His+ recombinants of YD122 resulted from SCE was demonstrated by the linkage of HIS3 and URA3 contained on pNN287. FOAR isolates of these His+ recombinants should be both Ura- and His-. Of 105 His+ recombinants, ~95% of the FOAR were His-, confirming that SCE occurred to generate the original recombinants.
Determining rates of spontaneous recombination and mutagenesis:
Rates of spontaneous, mitotic recombination were determined by the method of the median as described by ![]()
![]()
![]()
Quantitating radiation sensitivity and radiation stimulation of recombination:
To quantitate UV or
-ray sensitivities, strains were grown in YPD to saturation, plated directly on YPD medium after appropriate serial dilution, and irradiated. A 254-nM germicidal lamp (2 J/m2/sec) was used for UV irradiation. A nordion 1.8-kCi 137Cs irradiator was used as a
-ray source at 7.8 krads/hr. Colony-forming units (CFU) were counted after 3 days of growth and again after 1 wk. At least three independent experiments were performed for each indicated dose. Statistical differences were determined by the two-tailed t-test (![]()
To quantitate recombination after radiation or chemical exposure, yeast cultures were either grown to an A600 of 0.51 for log phase cells or to an A600 of 4 for stationary phase cells. To arrest cells at the G2 phase of the cell cycle, cells were grown to an A600 of 0.51 in YPD, nocodazole [methyl-5-(2-thienylcarbonyl)-H-benzimidazole-2-yl-carbamate] (25) was added to a final concentration of 15 µg/ml, cells were incubated at 30° for 3 hr, and cell cycle arrest was confirmed as previously described (![]()
![]()
![]()
![]()
![]()
| RESULTS |
|---|
UV sensitivity of dun1 and assignment of DUN1 to the RAD3 epistasis group:
The UV sensitivity of the dun1 haploid mutant (YA145) was compared to the UV sensitivities of the rad52 (YA133), rad9 (YA132), rad1 (YA131), and rad18 (YA154) haploid mutants (Figure 2). The dun1 mutant exhibited a level of UV sensitivity greater than wild type (P < 0.01) but not significantly different (P > 0.2) from the rad52 mutant defective in recombinational repair. All other single mutants exhibited greater levels of UV sensitivity than the dun1 mutant. To exclude the possibility that the dun1 mutant contained an extragenic suppressor that increased UV resistance, we backcrossed the dun1 mutant with the parental Rad+ W303 strain and determined the UV sensitivity at 30 mJ/m2 of 10 independent haploid segregants containing the dun1::HIS3 disruption. All 10 dun1 haploid segregants exhibited similar UV sensitivity (44% average survival), and all 10 DUN1 haploid segregants exhibited similar UV sensitivity (80% average survival), indicating that the original dun1 mutant did not contain an unlinked extragenic suppressor. Thus, the dun1 mutant is UV sensitive but is significantly more resistant than the mutants defective in the RAD3 or RAD6 pathways.
|
To determine whether the DUN1 gene participates in either the RAD3, RAD52, or RAD9 pathways for UV resistance, the UV sensitivity of haploid mutants containing combinations of the dun1 null mutation and the rad1, rad9, rad52, and rad18 mutations was quantitated (Figure 2). If DUN1 was important in one particular resistance pathway (epistasis group), then double mutants should exhibit no greater sensitivity than the most sensitive single mutant (![]()
We asked whether the synergistic decrease of UV resistance in the dun1 rad52 mutants, compared to the single mutants, depended on haploidy or growth of cells in stationary phase. As observed for the rad52 dun1 haploid cells, the same synergistic decrease in UV survival, compared to rad52 (YD118) and dun1 (YD117) diploid mutants, was observed in rad52 dun1 diploid (YD119) cells (data not shown). This occurred when cells were grown to either log phase or stationary phase. This suggests that RAD52-dependent recombination pathways participate in the tolerance of UV lesions in both haploid or diploid dun1 mutants.
Sensitivity of the dun1 mutant to ionizing radiation:
We asked whether a synergistic increase in ionizing radiation sensitivity, in comparison to the single mutants, also occurred in the dun1 rad52, dun1 rad9, and dun1 rad1 double haploid (Figure 3). In comparison to wild type, all single mutants exhibit
-ray sensitivity, and rad1 and dun1 mutants exhibit the same low level of
-ray sensitivity (P > 0.2). The
-ray sensitivities of the dun1 rad9 and the dun1 rad1 double mutants are not different from the sensitivity of the single rad1 or rad9 mutants (P > 0.3). The
-ray sensitivity of the dun1 rad52 double mutant was enhanced compared to the rad52 single mutant (P < 0.05) but the increase in sensitivity was not synergistic. These results suggest that unrepaired DNA lesions induced by ionizing radiation in the dun1 mutants are not channeled into either the RAD52 or the RAD6 pathways.
|
dun1 exhibits higher rates of spontaneous, mitotic heteroallelic recombination:
The UV sensitivities of dun1 mutants suggest that either the RAD52 recombination pathway or the RAD6 error-prone pathway participate in UV resistance in the dun1 mutant. We therefore determined whether dun1 strains exhibit a RAD52-dependent, hyper-recombination phenotype. Recombination assays used included heteroallelic recombination, intrachromosomal recombination, and SCE (Figure 1), since UV exposure stimulates these mitotic recombination events (![]()
![]()
![]()
![]()
The spontaneous hyper-recombination phenotype of the dun1 mutant was demonstrated by determining the rates of spontaneous Ade+ prototrophs that result from mitotic, homolog recombination between two ade2 alleles, ade2-n and ade2-a. These Ade+ prototrophs can be distinguished from ade2 strains by colony pigment; on YPD medium, Ade+ colonies are white while ade2 strains are red. Since YPD contains insufficient adenine to ensure equal growth rates of Ade+ and Ade- colonies, Ade+ white colony sectors outgrow the perimeter of the red colony, while off-white sectors that do not outgrow the red colonies are Ade- and petite. Dun1 (YD117) colonies accumulated white Ade+ sectors more readily than wild type, but dun1 rad52 (YD119) colonies did not (Figure 4). When colonies are grown on YP(A)D, in which there is no growth advantage for Ade+ sectors, the rate of generating Ade+ prototrophs was ~5-fold above (P < 0.05) wild type (Table 2). Northern blots demonstrated that the level of ade2 RNA from either DUN1 or dun1 strains was equivalent (data not shown), indicating that the increase in recombination is not due to elevated ade2 transcription in the dun1 mutant. The higher rate of recombination in the dun1 mutant is RAD52 dependent; the rate of heteroallelic recombination in the dun1 rad52 double mutant is indistinguishable (P > 0.05) from that of the rad52 mutant and is reduced ~15-fold compared to wild type (Table 2).
|
|
Since DUN1 participates in the RAD3 pathway, we asked whether the spontaneous hyper-recombination phenotype was dependent upon RAD1 (Table 2). Rates of mitotic heteroallelic recombination in the rad1 strain (YD120) were similar to that of wild type, as expected from previous studies (![]()
![]()
![]()
dun1 mutants exhibit more intrachromosomal gene conversion events but fewer pop-out events:
Since the recombination assay that measures heteroallelic recombination generally monitors gene conversion events, we also determined whether dun1 mutants exhibit a bias toward gene conversion events. We used an intrachromosomal recombination assay where pop-outs (loss of an integrated plasmid by either crossovers or gene conversion) could be readily detected (Figure 1). The assay consisted of direct repeats of ade2 that flank URA3 (![]()
![]()
|
DNA damage-induced mitotic recombination in the dun1 mutant:
If UV resistance in dun1 mutants is partially conferred by RAD52-dependent recombinational repair, then UV-induced mitotic recombination should be enhanced in dun1 mutants. Since the synergistic effect of dun1 and rad52 is observed in haploids, where heteroallelic recombination does not occur, as well as diploids, we investigated whether dun1 mutants exhibit an enhanced level of UV-induced unequal SCE (Table 4). We found no differences in the rate of spontaneous SCE in the dun1 mutant (1.1 ± 0.2) x 10-6, compared to the rate in wild type (1.4 ± 0.3) x 10-6. After UV irradiation, we observed significant (P < 0.05) two- to threefold increases in recombination, compared to wild type. However, if cells were arrested in G2 with the microtubule inhibitor nocodazole prior to irradiation, there was no difference between the stimulation of SCE events in the dun1 mutant compared to wild type. We speculate that dun1-enhanced UV-stimulated SCE depends on replication of the UV dimer.
|
Since spontaneous heteroallelic recombination is greater in dun1 diploids than wild type, we exposed both wild-type and dun1 diploid mutants to UV,
-rays, and MMS to quantitate whether the stimulation of heteroallelic recombination was greater in dun1 cells for any particular DNA damaging agent (Table 5). Although the dun1-enhanced recombination is modest (approximately twofold), it is significantly different (P < 0.01) from wild-type levels of UV stimulation. However, there was no increase in the levels of
-ray and MMS-stimulated heteroallelic recombination in the dun1 mutant (data not shown). Thus, the recombinogenicity of only a subset of DNA-damaging agents is enhanced in dun1.
|
Higher percentages of petites are generated in dun1 mutants:
We observed a 10-fold higher percentage of petites generated in the dun1 (YA145) strain (7.1 ± 0.9% or 57/804 total) compared to the wild-type (YA103) strain (0.7 ± 0.4% or 13/1697 total). However, rates of spontaneous reversion to Trp+ and Ade+ prototrophy due to spontaneous mutagenesis are not higher in the dun1 mutant (data not shown). Since mitochondrial DNA repair is less efficient than genomic DNA repair (![]()
| DISCUSSION |
|---|
Three independent pathways participate in the repair of UV-induced DNA damage in S. cerevisiae. These include pathways for excision repair, mutagenic repair, and recombinational repair. Which pathway is chosen to repair UV-induced DNA damage is not completely understood. DUN1 encodes a serine-threonine protein kinase that is activated by signal transduction pathways for sensing DNA damage. Dun1 mutants, which exhibit both UV and MMS sensitivity, are defective in DNA damage-inducible expression of ribonucleotide reductase (![]()
![]()
![]()
The participation of DUN1 in the RAD3 epistasis group elucidates previous observations that DUN2 (POL
)-mediated transcriptional induction and RAD9-mediated cell cycle arrest are independent DNA damage-inducible pathways (![]()
Differences in genetic interactions between rad9 and dun1 regarding sensitivity to UV and ionizing radiation:
Since several models of DNA double-strand break repair involve DNA synthesis (![]()
![]()
-ray sensitivity. Nonetheless, the dun1
-ray sensitivity is still consistent with DUN1 belonging to the RAD3 epistasis group, since dun1 mutants exhibit the same level of
-ray sensitivity as rad1 mutants. Essentially identical
-ray survival curves are obtained for single mutants dun1 and rad1 and for rad1 dun1 double mutants (Figure 3), for rad9 and dun1 rad9 (Figure 3), and for rad9 and rad9 rad1 (![]()
![]()
Recombination phenotypes of the dun1 mutants:
Since tolerance to DNA damage in dun1 mutants is partially conferred by RAD52-dependent mechanisms, it is interesting that only a subset of spontaneous RAD52-dependent recombination events is enhanced in the dun1 mutant, compared to wild-type strains. While spontaneous heteroallelic and intrachromosomal gene conversion events are enhanced, intrachromosomal pop-outs are decreased, and spontaneous unequal SCE is unchanged in dun1 mutants. Although we do not understand why the proportion of intrachromosomal recombination events that result from exchange (pop-outs) is decreased in the dun1 mutant, a similar phenomena (Table 3) was observed for rad1 mutants, suggesting that DUN1 also participates in the SSA mechanism for spontaneous recombination. We speculate that the unchanged rate of spontaneous SCE in dun1 mutants, compared to the rate in wild type, results from a lower level of crossovers but a higher level of sister-chromatid gene conversions. However, due to the low frequency of spontaneous SCE, the percentages of spontaneous SCE that result from reciprocal exchanges and gene conversion events are unknown (![]()
![]()
Which spontaneous DNA lesions are more recombinogenic in the dun1 mutant is unclear. Spontaneous DNA lesions include those that result from oxidation and alkylation damage (depurination). Since neither ionizing radiation nor MMS were more recombinogenic in dun1 mutants, dun1-enhanced spontaneous recombination may result from spontaneous DNA lesions similar to those induced by UV.
The synergistic increase in UV sensitivity in the rad52 dun1 double mutant, compared to the single mutants, for both haploids and diploids, suggests that one recombination mechanism by which UV damage is tolerated in dun1 mutants is SCE. Although in comparison to wild type, the frequency of UV-stimulated recombinants that result from unequal SCE increased a modest two- to threefold in the dun1 strain, a more direct physical measurement of SCE may demonstrate a greater enhancement. Less enhanced UV stimulation of heteroallelic recombination in the dun1 mutant is consistent with observations that sister chromatids are preferred substrates for DNA repair (![]()
Possible mechanisms for dun1-stimulated recombination:
The RAD1 independence of the spontaneous hyper-recombination phenotype of the dun1 mutants suggests possible mechanisms for how dun1-enhanced recombination occurs. Similar to dun1 recombination phenotypes, spontaneous RAD1-independent intrachromosomal recombination (![]()
![]()
![]()
The RAD1-independence of the dun1 hyper-recombination phenotype differs from the RAD1-dependence of the hyper-recombination phenotypes of other DNA repair mutants. These include rad9 mutants (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
DNA damage-inducible gene expression and dun1 phenotypes:
The DUN1 pathway for DNA damage-inducible gene expression controls the expression of several genes involved in DNA repair, rendering it difficult to ascribe all the dun1 phenotypes to a defect in the DNA damage inducibility of the RNR genes. However, the UV sensitivity of dun1 mutants can be suppressed by the overexpression of RNR1 (![]()
![]()
![]()
![]()
Since the substrates for the Dun1 protein kinase have not been identified, we cannot exclude the possibility that some dun1 phenotypes directly result from failure to phosphorylate DNA repair proteins. For example, the Srs2/RadH/Hpr5 helicase, which exhibits amino acid similarity to UvrD, contains several potential phosphorylation sites for serine/threonine protein kinases (genetics computer group, protein motif comparison). Hpr5 mutants exhibit variable, elevated rates of mitotic gene conversion (![]()
Mutants defective in other yeast protein kinases, including Cdc5 (![]()
![]()
![]()
![]()
![]()
Summary:
We have shown that DNA damage tolerance in dun1 mutants is partially conferred by RAD52-dependent recombination. This is the first demonstration that a defect in a protein kinase directly involved in the transcriptional induction of DNA damage-inducible genes also increases spontaneous, mitotic recombination in yeast. It will be important to determine whether other protein kinases involved in the DNA damage-inducible responses have similar phenotypes.
| ACKNOWLEDGMENTS |
|---|
We thank R. Rothstein for the W303 derived strains that contain the rad1, rad52, rad9, and rad18 gene disruptions, S. Elledge and Z. Zhou for dun1 mutants, and L. Symington for YK12. We thank N. Faegerman, T. Hryciw, W. Xiao, and Z. Dong or carefully reading this manuscript. The work was supported by U.S. Public Health Service grant CA70105, and a grant from the Leukemia Research Foundation.
Manuscript received November 18, 1998; Accepted for publication April 15, 1999.
| LITERATURE CITED |
|---|
ABOUSSEKHRA, A., R. CHANET, A. ADJIRI, and F. FABRE, 1992 Semidominant suppressors of Srs2 helicase mutation of Saccharomyces cerevisiae map in the RAD51 gene, whose sequence predicts a protein with similarities to procaryotic RecA proteins. Mol. Cell. Biol. 12:3224-3234
ABOUSSEKHRA, A., J. E. VIALARD, D. MORRISON, M. A. TORR-RUIZ, and L. CERNAKOVA et al., 1996 A novel role for the budding yeast RAD9 checkpoint gene in DNA damage-dependent transcription. EMBO J. 15:3912-3933[Medline].
ALLEN, J. B., Z. ZHOU, W. SIEDE, E. C. FRIEDBERG, and S. J. ELLEDGE, 1994 The SAD1/RAD53 protein kinase controls multiple checkpoints and DNA damage-induced transcription in yeast. Genes Dev. 8:2401-2415
AGUILERA, A. and H. L. KLEIN, 1988 Genetic control of intrachromosomal recombination of Saccharomyces cerevisiae. I. Isolation and genetic characterization of hyper-recombination mutations. Genetics 119:779-790
BAI, Y. and L. S. SYMINGTON, 1996 A Rad52 homolog is required for RAD51-independent mitotic recombination in Saccharomyces cerevisiae.. Genes Dev. 10:2025-2037
BAILIS, A. M., L. ARTHUR, and R. ROTHSTEIN, 1992 Genome rearrangement in top3 mutants of Saccharomyces cerevisiae requires a functional RAD1 excision repair gene. Mol. Cell. Biol. 12:4988-4993
BARDWELL, A. J., L. BARDWELL, A. E. TOMKINSON, and E. C. FRIEDBERG, 1994 Specific cleavage of model recombination and repair intermediates by the yeast Rad1/Rad10 endonuclease. Science 265:2082-2085
BARKER, D. G., J. H. M. WHITE, and L. H. JOHNSTON, 1985 The nucleotide sequence of the DNA ligase gene (CDC9) from Saccharomyces cerevisiae, a gene which is cell cycle regulated and induced in response to DNA damage. Nucleic Acids Res. 13:8323-8338
BASILE, G., M. AKER, and R. K. MORTIMER, 1992 Nucleotide sequence and transcriptional regulation of the yeast recombinational repair gene RAD51.. Mol. Cell. Biol. 12:3235-3246
BOEKE, J. D., F. LACROUTE, and G. R. FINK, 1984 A positive selection for mutants lacking orotidene-5'-phosphate decarboxylase activity in yeast: 5-fluoro-orotic acid resistance. Mol. Gen. Genet. 197:345-347[Medline].
BRENNAN, R. J., E. P. S. BENNET, and R. H. SCHIESTL, 1994 Oxidative mutagens induce intrachromosomal recombination in yeast. Mutat. Res. 308:159-167[Medline].
CHEN, D., B. YANG, and T. KUO, 1992 One-step transformation of yeast in stationary phase. Curr. Genet. 21:83-84[Medline].
COLE, G. M., D. SCHILD, S. T. LOVETT, and R. K. MORTIMER, 1987 Regulation of RAD54- and RAD52-lacZ gene fusions in Saccharomyces cerevisiae in response to DNA damage. Mol. Cell. Biol. 7:1078-1084
COLE, G. M., S. T. LOVETT, D. SCHILD, and R. K. MORTIMER, 1989 Failure to induce a DNA repair gene, RAD54, in Saccharomyces cerevisiae does not affect DNA repair or recombination pathways. Mol. Cell. Biol. 9:3314-3322
DAVIDSON, J. F., B. WHYTE, P. H. BISSINGER, and R. H. SCHIESTL, 1996 Oxidative stress is involved in heat-induced cell death in Saccharomyces cerevisiae.. Proc. Natl. Acad. Sci. USA 93:5116-5121
DAVIES, P. J., W. E. EVANS, and J. M. PARRY, 1975 Mitotic recombination induced by chemical and physical agents in the yeast Saccharomyces cerevisiae.. Mutat. Res. 51:327-332.
ELLEDGE, S. J. and R. W. DAVIS, 1987 Identification and isolation of the gene encoding the small subunit of ribonucleotide reductase from Saccharomyces cerevisiae.. Mol. Cell. Biol. 7:2783-2793
ELLEDGE, S. J. and R. W. DAVIS, 1990 Two genes differtially regulated in the cell cycle and by DNA damaging agents encode alternative regulatory elements of ribonucleotide reductase. Genes Devel. 4:4932-4940.
ESPOSITO, M. S., D. T. MALEAS, K. A. BJORNSTAD, and C. V. BRUSCHI, 1982 Simultaneous detection of changes in chromosome number, gene conversion and intergenic recombination during mitosis of Saccharomyces cerevisiae: spontaneous and ultraviolet light induced events. Curr. Genet. 6:5-11.
FASULLO, M. and P. DAVE, 1994 Mating-type regulates the DNA damage-associated stimulation of reciprocal translocation events in Saccharomyces cerevisiae.. Mol. Gen. Genet. 243:63-70[Medline].
FASULLO, M. T. and R. W. DAVIS, 1987 Recombinational substrates designed to study recombination between unique and repetitive sequences in vivo.. Proc. Natl. Acad. Sci. USA 84:6215-6219
FASULLO, M., P. DAVE, and R. ROTHSTEIN, 1994 DNA-damaging agents stimulate the formation of directed reciprocal translocations in Saccharomyces cerevisiae.. Mutat. Res. 314:121-133[Medline].
FASULLO, M., T. BENNETT, P. AHCHING, and J. KOUDELIK, 1998 The Saccharomyces cerevisiae RAD9 checkpoint reduces the DNA damage-associated stimulation of directed translocations. Mol. Cell. Biol. 18:1190-1200
FISHMAN-LOBELL, J. and J. HABER, 1992 Removal of non-homologous DNA ends in double-strand break recombinationthe role of the yeast ultraviolet repair gene RAD1.. Science 258:480-484
FRIEDBERG, E. C., G. C. WALKER and W. SIEDE, 1995 DNA Repair and Mutagenesis. American Society for Microbiology Press, Washington DC.
GALLI, A. and R. H. SCHIESTL, 1995 On the mechanism of UV and gamma-ray induced intrachromosomal recombination in yeast cells synchronized in different stages of the cell cycle. Mol. Gen. Genet. 248:301-310[Medline].
GALLI, A. and R. H. SCHIESTL, 1996 Hydroxyurea induces recombination in dividing but not in G1 or G2 cell cycle arrested yeast cells. Mut. Res. 354:69-75[Medline].
HAYNES, R. H., and B. A. KUNZ, 1981 DNA repair and mutagenesis in yeast, pp. 371414 in The Molecular Biology of the Yeast Saccharomyces, edited by J. STRATHERN, E. JONES and J. BROACH, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
HO, Y., S. MASON, R. KOBAYASHI, M. HOEKSTRA, and B. ANDREWS, 1997 Role of the casein kinase I isoform, Hrr25, and the cell cycle-regulatory transcription factor, SBF, in the transcriptional response to DNA damage in Saccharomyces cerevisiae.. Proc. Natl. Acad. Sci. USA 94:581-586
HUANG, K. and L. S. SYMINGTON, 1994 Mutation of the gene encoding protein kinase C 1 stimulates mitotic recombination in Saccharomyces cerevisiae.. Mol. Cell. Biol 14:6039-6044
JACKSON, J. A. and G. R. FINK, 1981 Gene conversion between duplicated genetic elements in yeast. Nature 292:306-311[Medline].
JOHNSTON, L. H., J. H. M. WHITE, A. L. JOHNSON, G. LUCCHINI, and P. PLEVANI, 1987 The yeast DNA polymerase I transcript is regulated in both the mitotic cell cycle and in meiosis and is also induced after DNA damage. Nucleic Acids Res. 15:5017-5030
JONG, A. Y. S., C. L. KUO, and J. L. CAMPBELL, 1984 The CDC8 gene of yeast encodes thymidylate kinase. J. Biol. Chem. 259:11052-11059
KADYK, L. C. and L. H. HARTWELL, 1992 Sister chromatids are preferred over homologs as substrates for recombinational repair in Saccharomyces cerevisiae.. Genetics 132:387-402[Abstract].
KADYK, L. C. and L. H. HARTWELL, 1993 Replication dependent sister chromatid recombination in rad1 mutants of Saccharomyces cerevisiae.. Genetics 133:469-487[Abstract].
LEA, D. E. and C. A. COULSON, 1949 The distribution of the numbers of mutants in bacterial populations. J. Genet. 49:264-284.
LEVIN, D. E. and E. BARTLETT-HEUBUSCH, 1992 Mutants in the S. cerevisiae PKC1 gene display a cell cycle-specific osmotic stability defect. J. Cell Biol. 116:1221-1229
LIU, Y., 1997 Molecular regulatory mechanisms of DNA damage-inducible genes, MAG1 and DDI1, from Saccharomyces cerevisiae. Ph.D. Thesis, University of Saskatchewan, Saskatoon, Canada.
MALKOVA, A., E. IVANOV, and J. E. HABER, 1996 Double-strand break repair in the absence of RAD51 in yeast: a possible role for break-induced DNA replication. Proc. Natl. Acad. Sci. USA 93:7131-7136
MALONE, R. E. and M. F. HOEKSTRA, 1984 Relationship between a hyper-rec mutation (rem1) and other recombination and repair genes in yeast. Genetics 107:33-48
MONTELONE, B. A., M. F. HOEKSTRA, and R. E. MALONE, 1988 Spontaneous mitotic recombination in yeast: the hyper-recombinational rem1 mutations are alleles of the RAD3 gene. Genetics 119:289-301
NAVAS, T. A., Y. SANCHEZ, and S. J. ELLEDGE, 1996 RAD9 and DNA polymerase
form parallel sensory branches for transducing the DNA damage checkpoint signal in Saccharomyces cerevisiae.. Genes Dev. 10:2632-2643
PALLADINO, F. and H. KLEIN, 1992 Analysis of mitotic and meiotic defects in Saccharomyces cerevisiae SRS2 DNA helicase mutants. Genetics 132:23-37[Abstract].
PATI, D., C. KELLER, M. GROUDINE, and S. PLON, 1997 Reconstitution of a MEC1-independent checkpoint in yeast by expression of a novel human fork head cDNA. Mol. Cell. Biol. 17:3037-3046[Abstract].
PAULOVICH, A. G., C. D. ARMOUR, and L. H. HARTWELL, 1998 RAD9, RAD17, RAD24, and MEC3 genes are required for tolerating irreparable, ultraviolet-induced DNA damage. Genetics 150:75-93
PETES, T. D., R. E. MALONE and L. S. SYMINGTON, 1991 Recombination in yeast, pp. 407523 in The Molecular and Cellular Biology of the Yeast Saccharomyces, edited by J. R. BROACH, J. R. PRINGLE and E. W. JONES, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
RATTRAY, A. and L. SYMINGTON, 1995 Multiple pathways for homologous recombination in Saccharomyces cerevisiae.. Genetics 139:45-56[Abstract].
ROTHSTEIN, R. J., 1983 One step gene disruption in yeast. Methods Enzymol. 101:202-211[Medline].
RUBY, S. and J. SZOSTAK, 1985 Specific Saccharomyces cerevisiae genes are expressed in response to DNA-damaging agents. Mol. Cell. Biol. 5:75-84
RUPP, W. D., C. E. I. WILDE, D. L. RENO, and P. HOWARD-FLANDERS, 1971 Exchanges between DNA strands in ultraviolet-irradiated Escherichia coli.. J. Mol. Biol. 61:25-44[Medline].
SCLAFANI, R. A. and W. L. FANGMAN, 1984 Yeast gene CDC8 encodes thymidylate kinase and is complemented by herpes thymidine kinase gene TK. Proc. Natl. Acad. Sci. USA 81:5821-5826
SHERMAN, F., G. R. FINK and J. B. HICKS, 1982 Methods of Yeast Genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
SIEDE, W., G. W. ROBINSON, D. KALAINOV, T. MALLEY, and E. C. FRIEDBERG, 1989 Regulation of the RAD2 gene of Saccharomyces cerevisiae.. Mol. Microbiol. 3:1697[Medline].
SZOSTAK, J. W., T. L. ORR-WEAVER, R. ROTHSTEIN, and F. W. STAHL, 1983 The double-strand break model for recombination. Cell 33:25-35[Medline].
THOMAS, B. J. and R. ROTHSTEIN, 1989 The genetic control of direct-repeat recombination in Saccharomyces: the effect of rad52 and rad1 on mitotic recombination at GAL10, a transcriptionally regulated gene. Genetics 123:725-738
WEINERT, T. A. and L. H. HARTWELL, 1988 The RAD9 gene controls the cell cycle response to DNA damage in Saccharomyces cerevisiae.. Science 241:317-322
WEINERT, T. A., G. L. KISER, and L. H. HARTWELL, 1994 Mitotic checkpoint genes in budding yeast and the dependence of mitosis on DNA replication and repair. Genes Dev. 8:652-665
YAKES, F. M. and B. VAN HOUTEN, 1997 Mitochondrial DNA damage is more extensive and persists longer than nuclear DNA damage in human cells following oxidative stress. Proc. Natl. Acad. Sci. USA 94:514-519
ZAR, J. H., 1996 Biostatistical Analysis. Prentice Hall, Inc., Englewood Cliffs, NJ.
ZHAO, X., E. G. MULLER, and R. ROTHSTEIN, 1998 A suppressor of two essential checkpoint genes identifies a novel protein that negatively affects dNTP pools. Mol. Cell. Biol. 2:329-340.
ZHOU, Z. and S. J. ELLEDGE, 1993 DUN1 encodes a protein kinase that controls the DNA damage response in yeast. Cell 75:1119-1127[Medline].
This article has been cited by other articles:
![]() |
E. Coic, T. Feldman, A. S. Landman, and J. E. Haber Mechanisms of Rad52-Independent Spontaneous and UV-Induced Mitotic Recombination in Saccharomyces cerevisiae Genetics, May 1, 2008; 179(1): 199 - 211. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Ramey, S. Howar, M. Adkins, J. Linger, J. Spicer, and J. K. Tyler Activation of the DNA Damage Checkpoint in Yeast Lacking the Histone Chaperone Anti-Silencing Function 1 Mol. Cell. Biol., December 1, 2004; 24(23): 10313 - 10327. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. L. Schollaert, J. M. Poisson, J. S. Searle, J. A. Schwanekamp, C. R. Tomlinson, and Y. Sanchez A Role for Saccharomyces cerevisiae Chk1p in the Response to Replication Blocks Mol. Biol. Cell, September 1, 2004; 15(9): 4051 - 4063. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. Hand, N. Jia, M. Bard, and R. J. Craven Saccharomyces cerevisiae Dap1p, a Novel DNA Damage Response Protein Related to the Mammalian Membrane-Associated Progesterone Receptor Eukaryot. Cell, April 1, 2003; 2(2): 306 - 317. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Chang, M. Bellaoui, C. Boone, and G. W. Brown A genome-wide screen for methyl methanesulfonate-sensitive mutants reveals genes required for S phase progression in the presence of DNA damage PNAS, December 24, 2002; 99(26): 16934 - 16939. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Hammet, B. L. Pike, and J. Heierhorst Posttranscriptional Regulation of the RAD5 DNA Repair Gene by the Dun1 Kinase and the Pan2-Pan3 Poly(A)-Nuclease Complex Contributes to Survival of Replication Blocks J. Biol. Chem., June 14, 2002; 277(25): 22469 - 22474. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Osman, I. R. Tsaneva, M. C. Whitby, and C. L. Doe UV Irradiation Causes the Loss of Viable Mitotic Recombinants in Schizosaccharomyces pombe Cells Lacking the G2/M DNA Damage Checkpoint Genetics, March 1, 2002; 160(3): 891 - 908. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. I. Bashkirov, J. S. King, E. V. Bashkirova, J. Schmuckli-Maurer, and W.-D. Heyer DNA Repair Protein Rad55 Is a Terminal Substrate of the DNA Damage Checkpoints Mol. Cell. Biol., June 15, 2000; 20(12): 4393 - 4404. [Abstract] [Full Text] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Fasullo, M.
- Articles by Cera, C.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Fasullo, M.
- Articles by Cera, C.



), dun1::HIS3 (YA145,
), rad52::TRP1 (YA133,
), rad1:LEU2 (YA131,
), rad9::URA3 (YA132, ), rad18::LEU2 (YA154,
), dun1::HIS3 rad1::LEU2 (YD105,
), dun1::HIS3 rad9::URA3 rad52::TRP1 (YD106,
), dun1::HIS3 rad18::LEU2. (YD107, ) (A) Survival fractions at 30120 J/m2 exposure. (B) Survival fractions at 1030 J/m2.






