| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Corresponding author: Takeharu Nishimoto, Department of Molecular Biology, Graduate School of Medical Science, Kyushu University, 3-1-1, Maidashi, Higashi-ku, Fukuoka 812-8582, Japan., tnishi{at}molbiol.med.kyushu-u.ac.jp (E-mail)
Communicating editor: A. G. HINNEBUSCH
 | ABSTRACT |
|---|
 TOP ABSTRACT MATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
Prp20p and Rna1p are GDP/GTP exchanging and GTPase-activating factors of Gsp1p, respectively, and their mutations, prp20-1 and rna1-1, can both be suppressed by Saccharomyces cerevisiae gtr1-11. We found that gtr1-11 caused a single amino acid substitution in Gtr1p, forming S20L, which is a putative GDP-bound mutant protein, while Gtr1p has been reported to bind to GTP alone. Consistently, gtr1-S20N, another putative GDP-bound mutant, suppressed both prp20-1 and rna1-1. On the other hand, gtr1-Q65L, a putative GTP-bound mutant, was inhibitory to prp20-1 and rna1-1. Thus, the role that Gtr1p plays in vivo appears to depend upon the nucleotide bound to it. Our data suggested that the GTP-bound Gtr1p, but not the GDP-bound Gtr1p, interacts with itself through its C-terminal tail. S. cerevisiae possesses a novel gene, GTR2, which is homologous to GTR1. Gtr2p interacts with itself in the presence of Gtr1p. The disruption of GTR2 suppressed prp20-1 and abolished the inhibitory effect of gtr1-Q65L on prp20-1. This finding, taken together with the fact that Gtr1p-S20L is a putative, inactive GDP-bound mutant, implies that Gtr1p negatively regulates the Ran/Gsp1p GTPase cycle through Gtr2p.
SACCHAROMYCES cerevisiae Gsp1p is a homologue of mammalian Ran (Ras-like nuclear G protein, 
On the basis of an analogy with the Ras family (
The phenotype caused by a defect in the nucleotide exchange of Ran is pleiotropic. Cultures of the tsBN2 cell line, hamster rcc1 (
GTR1 is not essential for survival, but its loss leads to cold-sensitive growth (
In this article, we found that gtr1-11 possessed a single amino acid substitution, S20L, that corresponds to a GDP-bound mutant of G proteins. Consistent with this finding, both prp20-1 and rna1-1 were suppressed by another putative GDP-bound mutant of Gtr1p, gtr1-S20N, but not by the putative GTP-bound mutant gtr1-Q65L. Overexpression of Gtr1p-Q65L was rather inhibitory for colony formation of prp20-1 and rna1-1 cells. We found a novel protein homologous to Gtr1p, designated as Gtr2p, that formed complexes with Gtr1p. Interestingly, the disruption of GTR2 suppressed prp20-1 and abolished the inhibitory effect of gtr1-Q65L on prp20-1.
| MATERIALS AND METHODS |
|---|
| TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
Strains and media:
All the S. cerevisiae strains and plasmids used in this study are described in Table 1 and Table 2, respectively. They were constructed by standard genetic manipulations (
|
|
Site-directed mutagenesis:
The 3.4-kb ClaI/BamHI fragment of pL3 (
Construction of GTR1 and GTR2 plasmids:
The 5.2-kb XbaI/SalI fragment was cut out from pL3 (
The genomic DNA of the NBW5 strain was amplified using primers A and D as shown in Figure 6A, resulting in a 2.2-kb DNA fragment that was digested with BamHI/SalI enzymes and inserted into the BamHI/SalI sites of YEplac195. The 1.7-kb fragment of GTR2 carried on the resulting plasmid pL130 was amplified by PCR using 5' TACACCATGGGTTTAGAGGCTACAGATTCCAAGGCAATGC 3' and M13 Reverse as the primers and KOD Polymerase as a polymerase. The amplified DNA fragments were digested with NcoI and SalI enzymes and inserted into the NcoI/SalI sites of pEG-KG (
|
|
|
|
|
|
The 1.6-kb fragment of HA-fused GTR1 was cut out from the plasmid pL46 (
The 1.7-kb GTR2 fragment carried on pL130 was amplified as described above and inserted into the NcoI/SalI sites of pUC29. From the resulting pL136, the 1.8-kb GTR2 fragment was digested with NcoI and PstI enzymes and inserted into the NcoI/PstI sites of plasmid TKS-HA1 (
The 1.5-kb GTR1 fragments were digested from pL20 and its derivatives containing mutated gtr1 by the BamHI enzyme and then inserted into the BamHI site of pET-28a (Novagen Inc.), resulting in pL115 (wild type), pL117 (Gtr1-12
p), and pL118 (Gtr1-13p). The 1.3-kb fragment containing His6-T7 carried on pET-28a was digested by NcoI and SmaI enzymes and inserted into the NcoI/StuI sites of pUC29, resulting in pL96. The 0.1-kb His6-T7 fragment was digested from pL96 by the SacI enzyme and inserted into the SacI site of pEG-KG, resulting in pEH7-SH. The 1.5- and 1.7-kb BamHI fragments containing GTR1 and GTR2 were then inserted into the BamHI site of pEH7-SH, resulting in pL101 and pL210, respectively.
Construction of GAL4 TAD- and DBD-fused GTR1:
For the two-hybrid assay (
The 1.2-kb SacI/SalI fragment of pAS1 (
Disruption of GTR2:
The genomic DNA of NBW5 was amplified using either primers A and B or primers C and D (see Figure 6A) to obtain the fragments AB and CD, respectively. The fragment AB was digested with BamHI/XhoI enzymes and inserted into the BamHI/XhoI sites of pUC29, resulting in pL119. The fragment CD was then digested with XhoI/SalI enzymes and inserted into the XhoI site of pL119, resulting in pL126. Finally, the LEU2 gene of YEp13 ( was cut out with BamHI/NcoI enzymes from pL128 and then introduced into the strain N43.
Purification of Gtr1p:
GST- or His6-fused wild-type and mutated Gtr1p were expressed in Escherichia coli and purified as described by
Cosedimentation of HA-fused proteins with the GST-fused proteins:
The plasmids carrying the GST- and HA-fused gene were cointroduced into the strain NBW5GTR1. Transformant cultures were grown to OD660 = 1.0 in SR medium (0.67% yeast nitrogen base without amino acid, 2% raffinose) lacking uracil and tryptophan, and then 2% galactose was added. After incubation for 2 hr at 30°, the cells were spun down, washed once with distilled water, and then resuspended in S buffer [50 mM potassium phosphate, pH 6.5, 120 mM NaCl, 1 mM MgCl2, 0.1% Triton X-100, 10% glycerol, 1 mM 2-mercaptoethanol, and 0.2 mM 
-amidinophenyl-methane-sulfonyl fluoride (-APMSF)]. Cells were then frozen at -80° and disrupted by glass beads. After centrifugation at 83,500 x g for 30 min, the supernatant was mixed with glutathione Sepharose-4B beads that had been saturated with S buffer, and then rotated for 1 hr. The beads were spun down and washed five times with S buffer. Proteins bound to the beads were analyzed by SDS-PAGE and immunoblotting. All procedures were carried out at 4° except where otherwise indicated.
ß-Galactosidase assay:
Overnight cultures of transformants of Y190 (0.3 ml) expressing GAL4-TAD-fused clones and GAL4-DBD-fused clones were inoculated into 15 ml of synthetic medium containing 0.67% yeast nitrogen base without amino acid, 2% ethanol, 3% glycerol, and the appropriate amino acids. Cultures were allowed to grow to OD660 = 0.9 and then spun down, washed once with distilled water, resuspended in 200 µl lysis buffer (0.1 M Tris-HCl, pH 8.0, 20% glycerol, 1 mM DTT, and 0.2 mM -APMSF), and then frozen at -80°. Frozen cells were disrupted by beating with glass beads. After centrifugation at 83,500 x g for 30 min, the supernatant was used as the crude extract.
The enzyme assay was performed as reported (
Immunoblotting:
Proteins were loaded on 11% SDS-PAGE, transferred onto PVDF membrane filters, and then probed with the anti-HA mAb (Babco) or anti-T7 mAb (Novagen, Inc.) as described previously (
| RESULTS |
|---|
| TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
Mutation site of gtr1-11:
To clarify how gtr1-11, a cold-sensitive mutation of GTR1, suppresses both prp20 and rna1, we isolated the GTR1 gene from the gtr1-11 strain and determined its nucleotide sequence. In comparison with the wild-type GTR1, gtr1-11 was found to have thymine instead of cytosine at the 20th codon of Gtr1p, and serine was thereby changed to leucine (S20L, Figure 1 insert). No other nucleotide substitution was found in the gtr1-11 sequence. By comparison with other small G proteins, the 20th amino acid of Gtr1p, serine, was suggested to correspond to threonine, the 24th and 26th amino acid of Ran and Gsp1p, respectively (Figure 1). Hence, by analogy with the RanT24N mutant (
When the gtr1 mutants carried on a single-copy vector were expressed in the gtr1-1 strain (Figure 2A), two putative GTP-bound mutants, gtr1-S15V and gtr1-S15G, rescued the cold sensitivity of the gtr1-1 strain with an efficiency similar to that of wild-type GTR1, but another putative GTP-bound mutant, gtr1-Q65L, rescued it only weakly. On the other hand, both putative GDP-bound mutants, gtr1-S20N and gtr1-S20L, did not rescue the cold sensitivity of the gtr1-1 strain. Thus, both gtr1-S15V and gtr1-S15G behaved like wild types, whereas the other mutants did not. The mutated and wild-type GTR1 clones carried on a multicopy vector were then introduced into the haploid strains prp20/2c (prp20-1), NN19-5B (rna1-1), and, as a control, NBW5 (wild type). Ura+ transformants were selected and plated on synthetic medium lacking uracil at the three temperatures indicated (Figure 2B)—the permissive, semipermissive, and nonpermissive temperatures for each mutated strain.
The two putative GDP-bound mutants, gtr1-S20L and gtr1-S20N, both rescued the temperature sensitivity of each of the prp20-1 and rna1-1 strains, whereas a putative GTP-bound mutant, gtr1-Q65L, did not (Figure 2B). Interestingly, gtr1-Q65L inhibited the colony formation of both prp20-1 and rna1-1 cells at 30° and 28°, the semipermissive temperatures for each mutant. The other putative GTP-bound mutants, gtr1-S15V and gtr1-S15G, did not show any inhibitory effect on prp20-1 and rna1-1 cells. Thus, both gtr1-S15V and gtr1-S15G behaved like the wild types, consistent with the finding that these mutants effectively complemented gtr1-1 (Figure 2A).
Gtr1p binds not only to GTP, but also to GDP:
E. coli-produced GST-fused Gtr1p was purified on glutathione Sepharose-4B beads. The purified GST-fused Gtr1p was mixed with either 3H-labeled GTP or GDP. As a control, the nucleotide-binding experiments were also conducted in the presence of EDTA, which is reported to release the nucleotides from Ran (
To further determine the nucleotide-binding ability of Gtr1p, [3H]GTP was mixed with an increasing amount of cold GTP, GDP, or ATP, and was then incubated with E. coli-produced, GST-fused Gtr1p. After incubation at 30° for 30 min, the radioactivity coprecipitated with the glutathione Sepharose-4B beads was quantified using a liquid scintillation counter. In the presence of GTP, the amount of [3H]GTP bound to Gtr1p was greatly reduced (Figure 3A). On the other hand, ATP did not prevent [3H]GTP from binding to Gtr1p, even at the higher concentrations. Compared with the effect of ATP, GDP significantly inhibited the binding of [3H]GTP to Gtr1p, indicating that GDP bound to Gtr1p in a manner that competed with GTP.
The GDP-binding ability of Gtr1p was further confirmed using the Gtr1p-Q65L that may have a defect in GTPase similar to the Q61L mutant of rasH (
Gtr1p interacts with itself:
Gtr1p has a long C-terminal tail (from 200 to 310 aa) outside the nucleotide-binding domains (Figure 1A). It contains a large number of leucine residues and is predicted to also contain a coiled-coil motif (p) were fused to either the GAL4 TAD or the GAL4 DBD, and then introduced into the Y190 strain. Considerable ß-galactosidase activity was observed when TAD-GTR1 was coexpressed with DBD-GTR1 (Table 3). When the wild-type GTR1 was coexpressed with the C-terminal-deleted mutant gtr1-12, however, no significant ß-galactosidase activity was detected (Table 3). Similar to wild-type Gtr1p, Gtr1-12p was produced in S. cerevisiae to a significant degree (Figure 4A, compare lanes 1 and 6). Thus, the failure to detect ß-galactosidase activity when the wild-type Gtr1p and Gtr1-12p were coexpressed did not result from a low expression of Gtr1-12p, implying that the C-terminal tail of Gtr1p is required for self-interaction of Gtr1p.
|
To further confirm that Gtr1p forms a complex with itself, the HA- and GST-GTR1 clones were cointroduced into the NBW5GTR1 (gtr1-1) strain. Crude extracts were prepared, mixed with glutathione Sepharose-4B beads, and the beads were then pelleted. The resulting precipitates were analyzed for the presence of HA-Gtr1p by immunoblotting using the mAb to HA. As shown in Figure 4B, lane 4, HA-Gtr1p was coprecipitated with GST-Gtr1p.
Self-interaction of Gtr1p depends upon the bound nucleotide state:
The amount of HA-Gtr1p coprecipitated with GST-Gtr1p was reduced in the presence of an increasing amount of EDTA (Figure 4B, lanes 5 and 6). Because EDTA releases the nucleotides from Ran (
To determine whether self-interaction of Gtr1p is dependent upon the bound nucleotide state, putative GDP- or GTP-bound mutants of Gtr1p were fused with either the GAL4 TAD or the GAL4 DBD. As shown in Table 3, when TAD-gtr1-Q65L was coexpressed with DBD-gtr1-Q65L, a strong transactivation of ß-galactosidase was observed, but there was no transactivation of lacZ when TAD-gtr1-S20L was coexpressed with DBD-gtr1-S20L or when TAD-gtr1-S20N was coexpressed with DBD-gtr1-S20N. The immunoblotting analysis of yeast lysates revealed that the mutant Gtr1p proteins were present at levels similar to those of wild-type Gtr1p (Figure 4A). These findings, therefore, imply that the ability of Gtr1p to interact with itself is dependent upon the bound nucleotide state. This interpretation prompted us to ask whether the lack of interaction shown by the C-terminal deletion was caused by the loss of nucleotide-binding ability. To address this issue, His6-tagged Gtr1-12p, and as controls, His6-fused wild-type and Gtr1p-Q65L, were expressed in E. coli. Purified His6-fused Gtr1p was then examined for nucleotide-binding ability. Similar to the wild-type and Gtr1p-Q65L, Gtr1-12p bound efficiently to GTP (Figure 3B), revealing that the inability of Gtr1-12p to interact with itself was not caused by the loss of nucleotide-binding ability.
Gtr1p belongs to a novel family of small G proteins:
RagA and RagB have been reported to be mammalian homologues of Gtr1p (
Gtr1p and its homologues do not have a lipid modification site that is characteristic of Ras (
GTR2 rescues gtr1-11, but not gtr1-1:
To investigate potential functional interactions between Gtr1p and Gtr2p, we examined the consequence of overexpressing Gtr2p. We amplified GTR2 by PCR using the primers shown in Figure 6A and inserted it into a multicopy vector, YEplac195, under its own promoter. Overproduction of Gtr2p partially rescued the cold sensitivity of the gtr1-11 strain, but not that of the gtr1-1 strain (Figure 6B). Thus, Gtr1p cannot be replaced by Gtr2p.
We also examined the consequences of Gtr2p loss by creating a null allele in the diploid N43 strain (Figure 6A). Cultures of the N43GTR2 strain were sporulated and subjected to tetrad analysis. Most tetrads showed a ratio of viable to nonviable segregants of 4:0, demonstrating that GTR2 was not essential for survival (data not shown). The disruption of GTR2 in a haploid strain caused the yeast to become cold sensitive (Figure 6C). On the basis of this finding, we constructed a double-null disruptant (gtr1 gtr2) of GTR1 and GTR2 that grew well at 30°, the permissive temperature for each mutant, implying that gtr1 was not synthetically lethal with gtr2.
Self-interaction of Gtr2p requires Gtr1p:
Because Gtr1p interacted with itself, we asked whether Gtr2p also interacts with itself. GTR2 was fused to either the GST- or HA-tag, and the constructs were introduced into the gtr2-1 strain. As a control, both GST- and HA-GTR1 were coexpressed in the gtr1-1 strain. Transformants were selected in synthetic medium lacking uracil and tryptophan, crude extracts were prepared, GST-fused Gtr2p or Gtr1p was pulled down with glutathione Sepharose-4B beads, and the resultant precipitates were analyzed for the presence of HA-Gtr2p or Gtr1p by immunoblotting using the mAb to HA. As shown in Figure 7A, HA-Gtr2p was coprecipitated with GST-Gtr2p (lanes 5–8), similar to the case of Gtr1p (lanes 1–4).
|
Because GTR2 rescued the cold sensitivity of the gtr1-11 strain, we examined whether Gtr2p interacts with Gtr1p. GST-fused GTR2 or GTR1 was coexpressed with HA-fused GTR1 or GTR2 in the NBW5GTR1/GTR2 (gtr1-1 gtr2-1) strain, as indicated in Figure 7B. From the crude extracts of Ura+ and Trp+ transformants, GST-fused proteins were pulled down with glutathione Sepharose-4B beads. The resultant precipitates were analyzed for the presence of HA-fused proteins by immunoblotting using the mAb to HA. As shown in Figure 7B, Gtr1p was coprecipitated with Gtr2p, indicating that Gtr2p forms complexes with Gtr1p. Interestingly, HA-Gtr2p was not coprecipitated with GST-Gtr2p in the NBW5GTR1/GTR2 strain (Figure 7C, lane 4). Hence, self-interaction of Gtr2p requires Gtr1p.
Disruption of GTR2 suppresses prp20:
The requirement of Gtr1p for the self-interaction of Gtr2p suggested that the function of Gtr2p is dependent upon Gtr1p. This notion is consistent with the finding that the overexpression of Gtr2p rescued gtr1-11, but not gtr1-1. Although we do not know whether Gtr2p interacts with GTP-Gtr1p, Gtr2p could be an effector downstream of Gtr1p. If so, prp20 might be suppressed by a defect in Gtr2p, because gtr1-11, which encodes a presumed inactive form of Gtr1p, suppresses prp20 and rna1-1. To address this issue, GTR2 was disrupted in the strain HS203 (prp20-1), as described in MATERIALS AND METHODS. Resultant HS203GTR2 (prp20-1 gtr2-1) and HS203 strains were then transfected with wild-type gtr1-S20N or gtr1-Q65L carried on the multicopy vectors. Ura+ transformants were plated on synthetic medium lacking uracil and were then incubated at 26°, 30°, or 31°, which are the permissive, semipermissive, or nonpermissive temperatures, respectively, for prp20-1.
As expected, loss of GTR2 suppressed prp20-1 (Figure 8A). Moreover, loss of GTR2 suppressed the inhibitory effects of gtr1-Q65L (Figure 8A, 30°). This finding is consistent with the idea that Gtr2p functions downstream of Gtr1p (see Figure 10). However, the disruption of GTR1 did not suppress prp20-1 (Figure 8B). Furthermore, the double disruption of GTR1 and GTR2 did not increase the ability to rescue the temperature sensitivity of prp20-1 (Figure 8B). Hence, it is unlikely that Gtr1p and Gtr2p have parallel functions in the Ran GTPase cycle (see Figure 10).
|
|
|
No effect on nucleocytoplasmic transport:
The strain prp20/2c (prp20-1) has a defect in mRNA splicing and export (gtr1 and gtr2 do not show any defect in either NLS-dependent nuclear protein import or nuclear export signal (NES)-dependent protein export, even at the nonpermissive temperature (data not shown). Hence, we presumed that Gtr2p regulates the Ran/Gsp1p GTPase cycle through unknown pathways other than the nucleus/cytosol exchange of macromolecules.
Localization of Gtr2p:
Gtr1p has been reported to be localized within both the nucleus and the cytoplasm (GTR2 and NBW5GTR1/GTR2 strains. As a control, T7-tagged Gtr1p was expressed in the NBW5GTR1 and NBW5GTR1/GTR2 strains. T7-tagged Gtr1p and Gtr2p rescued the cold sensitivity of gtr1 and gtr2 strains, respectively. Gtr1p was distributed throughout both the cytoplasm and the nucleus, as reported previously (gtr1 gtr2 cells (data not shown). Because Gtr1p and Gtr2p were produced in similar amounts, these results indicate that Gtr2p has a tendency to accumulate in the nucleus.
| DISCUSSION |
|---|
| TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
Gtr1p has been reported to bind only to GTP, so it was thought to be a putative G protein (
Gtr2p is homologous to Gtr1p. As for Gtr1p, Gtr2p interacts with itself. However, self-interaction of Gtr2p requires Gtr1p. This finding indicates that Gtr1p forms a complex with Gtr2p. Given that Gtr1p and Gtr2p form a complex, it is noteworthy that they exhibit some of the same genetic interactions: disruptions of GTR2 and the gtr1-11 mutation both suppress prp20-1. We assume that Gtr2p is an effector downstream of Gtr1p, as shown in Figure 10. The fact that the loss of GTR2 suppresses prp20-1 is consistent with the presumption that gtr1-11 encodes a putative GDP-bound, inactive mutant of Gtr1p. The inactive G protein could not turn on the downstream cascade; this resulted in the same effect as the loss of a downstream effector. Consistent with this interpretation, Gtr1p-Q65L, a putative GTP-bound and, therefore, active form of Gtr1p, inhibits the growth of prp20-1 and rna1-1 strains. The fact that the growth inhibitory effect of Gtr1p-Q65L on prp20-1 is abolished by the disruption of GTR2 is consistent with the notion that Gtr2p is a downstream effector of Gtr1p. These results suggest that GTP-Gtr1p has a negative effect on both Prp20p and Rna1p. Taking account of the fact that Prp20p and Rna1p are the GDP/GTP-exchanging and GTPase-activating factors of Gsp1p, respectively, it would seem that Gtr1p may negatively regulate the Ran/Gsp1p cycle through Gtr2p (Figure 10).
The fact that the disruption of GTR1 does not suppress prp20-1, however, suggests that an inhibitory function of Gtr2p on the Ran/Gsp1p cycle is also activated by some factor other than Gtr1p (Figure 10X). This finding also indicates that Gtr1p-S20L dominantly abolishes the negative effect of Gtr2p on the Ran/Gsp1p cycle. In this regard, both GTP- and GDP-bound Gtr1p may make a complex with Gtr2p. It has been reported recently that the Rho family members Cdc42 and Rac2 form homodimers in the GTP-bound state, and that one of the GTP-bound proteins stimulates the GTP hydrolysis of the other protein (
The finding that the nucleus/cytosol exchange of macromolecules is not affected by Gtr1p-S20L, Gtr1p-Q65L, or gtr2 suggests that the unknown pathways of Ran/Gsp1p other than the nucleus/cytosol exchange of macromolecules are regulated by the Gtr1p/Gtr2p pathway. Dis3p and RanBPM have previously been reported to interact with Gsp1p and Ran. Dis3p is localized in the nucleolus and is suggested to be required for ribosomal RNA processing (
| ACKNOWLEDGMENTS |
|---|
We thank M. Funakoshi (Kyushu University) for plasmid YEplac112-XA; H. Sumimoto (Kyushu University) for helpful discussion; and C. Nowak, S. Malak, C. Villa-Braslavsky, J. Kuhlmann, and A. Wittinghofer (Max Planck Institut, Dortmund, Germany) for their help in analyzing E. coli-produced Gtr1p at the beginning of this work. This work was supported by Grants-in-Aid for Specially Promoted Research and by Human Frontier Science Program. The English used in this manuscript was revised by K. Miller (Royal English Language Centre, Fukuoka, Japan).
Manuscript received September 24, 1998; Accepted for publication March 18, 1999.
| LITERATURE CITED |
|---|
| TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONLITERATURE CITED |
|---|
AEBI, M., M. W. CLARK, U. VIJAYRAGHAVAN, and J. ABELSON, 1990 A yeast mutant, PRP20, altered in mRNA metabolism and maintenance of the nuclear structure, is defective in a gene homologous to the human gene RCC1 which is involved in the control of chromosome condensation. Mol. Gen. Genet. 224:72-80[Medline].
AMBERG, D. C., A. L. GOLDSTEIN, and C. N. COLE, 1992 Isolation and characterization of RAT1: an essential gene of Saccharomyces cerevisiae required for the efficient nucleocytoplasmic trafficking of mRNA. Genes Dev. 6:1173-1189
AVIS, J. M. and P. CLARKE, 1996 Ran, a GTPase involved in nuclear processes: its regulators and effectors. J. Cell Sci. 109:2423-2427[Abstract].
BELHUMEUR, P., A. LEE, R. TAM, T. D'PAOLO, and N. FORTIN et al., 1993 GSP1 and GSP2, genetic suppressors of prp20-1 mutant in Saccharomyces cerevisiae: GTP-binding proteins involved in the maintenance of nuclear organization. Mol. Cell. Biol. 13:2152-2161
BISCHOFF, F. R. and H. PONSTINGL, 1991 Mitotic regulator protein RCC1 is complexed with a nuclear ras-related polypeptide. Proc. Natl. Acad. Sci. USA 88:10830-10834
BISCHOFF, F. R., H. KREBBER, E. SMIRNOVA, W. DONG, and H. PONSTINGL, 1995 Co-activation of RanGTPase and inhibition of GTP dissociation by Ran-GTP binding protein RanBP1. EMBO J. 14:705-715[Medline].
BOGUSKI, M. and F. MCCORMICK, 1993 Proteins regulating Ras and its relatives. Nature 366:643-653[Medline].
BROACH, J. R., J. N. STRATHERN, and J. B. HICKS, 1979 Transformation in yeast: development of a hybrid cloning vector and isolation of the CAN1 gene. Gene 8:121-133[Medline].
BUN-YA, M., S. HARASHIMA, and Y. OSHIMA, 1992 Putative GTP-binding protein, Gtr1, associated with the function of the Pho84 inorganic phosphate transporter in Saccharomyces cerevisiae.. Mol. Cell. Biol. 12:2958-2966
CHI, N. C., E. J. H. ADAM, G. D. VISSER, and S. A. ADAM, 1996 RanBP1 stabilizes the interaction of Ran with p97 in nuclear protein import. J. Cell Biol. 135:559-569
CLARK, K. L. and G. F. SPRAGUE, JR., 1989 Yeast pheromone response pathway: characterization of a suppressor that restores mating to receptorless mutants. Mol. Cell. Biol. 9:2682-2694
COUTAVAS, E., M. REN, J. D. OPPENHEIM, P. D'EUSTACHIO, and M. G. RUSH, 1993 Characterization of proteins that interact with the cell-cycle regulatory protein Ran/TC4. Nature 366:585-587[Medline].
DASSO, M., T. SEKI, Y. AZUMA, T. OHBA, and T. NISHIMOTO, 1994 A mutant form of the Ran/TC4 protein disrupts nuclear function in Xenopus laevis egg extracts by inhibiting the RCC1 protein, a regulator of chromosome condensation. EMBO J. 13:5732-5744[Medline].
DER, C. J., T. FINKEL, and G. M. COOPER, 1986 Biological and biochemical properties of human rasH genes mutated at codon 61. Cell 44:167-176[Medline].
DINGWALL, C. D., S. KANDELS-LEWIS, and B. SERAPHIN, 1995 A family of Ran binding proteins that includes nucleoporins. Proc. Natl. Acad. Sci. USA 92:7525-7529
DRIVAS, G. T., A. SHIH, E. COUTAVAS, M. G. RUSH, and P. D'EUSTACHIO, 1990 Characterization of four novel RAS-related genes expressed in a human teratocarcinoma cell line. Mol. Cell. Biol. 10:1793-1798
DURFEE, T., K. BECHERER, P.-L. CHEN, S.-H. YEH, and Y. YANG et al., 1993 The retinoblastoma protein associated with the protein phosphatase type 1 catalytic subunit. Genes Dev. 7:555-569
FIELDS, S. and O.-K. SONG, 1989 A novel genetic system to direct protein-protein interaction. Nature 340:245-246[Medline].
FORRESTER, W., F. STUTZ, M. ROSBASH, and M. WICKENS, 1992 Defects in mRNA 3'-end formation, transcription initiation, and mRNA transport associated with the yeast mutation prp20: possible coupling of mRNA processing and chromatin structure. Genes Dev. 6:1914-1926
FUNAKOSHI, M., H. SIKDER, H. EBINA, K. IRIE, and K. SUGIMOTO et al., 1997 Xenopus cyclin A1 can associate with Cdc28 in budding yeast, causing cell-cycle arrest with an abnormal distribution of nuclear DNA. Genes Cells 2:329-343[Abstract].
GIETZ, R. D. and A. SUGINO, 1998 New yeast-Escherichia coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking six-base pair restriction sites. Gene 74:527-534.
GÖRLICH, D., 1998 Transport into and out of the cell nucleus. EMBO J. 17:2721-2727[Medline].
GÖRLICH, D. and I. W. MATTAJ, 1996 Nucleocytoplasmic transport. Science 271:1513-1518[Abstract].
GÖRLICH, D., M. DABROWSKI, F. R. BISCHOFF, U. KUTAY, and P. BORK et al., 1997 A novel class of RanGTP binding proteins. J. Cell Biol. 138:65-80
GUAN, K. L. and J. E. DIXON, 1991 Eukariotic proteins expressed in Escherichia coli: an improved thrombin cleavage and purification procedure of fusion proteins with glutathione S-transferase. Anal. Biochem. 192:262-267[Medline].
HARPER, J. W., G. R. ADAMI, N. WEI, K. KEYOMARSI, and S. J. ELLEDGE, 1993 The p21 Cdk-interacting protein Cip1 is a potent inhibitor of G1 cyclin-dependent kinases. Cell 75:805-816[Medline].
HAYASHI, N., H. SEINO, K. IRIE, M. WATANABE, and K. L. CLARK et al., 1996 Genetical interaction of DED1 encoding a putative ATP-dependent RNA helicase with SRM1 encoding a mammalian RCC1 homologue in Saccharomyces cerevisiae.. Mol. Gen. Genet. 253:149-156[Medline].
HIGGINS, D. G., A. J. BLEASBY, and R. FUCHS, 1992 CLUSTAL V: improved software for multiple sequence alignment. Comput. Appl. Biosci. 8:189-191
HILL, J. E., K. A. G. DONALD, and D. E. GRIFFITHS, 1991 DMSO-enhanced whole cell yeast transformation. Nucleic Acids Res. 19:5791
HIROSE, E., N. NAKASHIMA, T. SEKIGUCHI, and T. NISHIMOTO, 1998 RagA is a functional homologue of S. cerevisiae Gtr1p involved in the Ran/Gsp1-GTPase pathway. J. Cell Sci. 111:11-21[Abstract].
HOPPER, A. K., F. BANKS, and V. EVANGELIDIS, 1978 A yeast mutant which accumulates precursor tRNAs. Cell 19:211-219.
HUTCHISON, H. T., L. H. HARTWELL, and C. S. MCLAUGHLIN, 1969 Temperature-sensitive yeast mutant defective in ribonucleic acid production. J. Bacteriol. 99:807-814
ICHIHARA, Y. and Y. KUROSAWA, 1993 Construction of new T vectors for direct cloning of PCR products. Gene 130:153-154[Medline].
KADOWAKI, T., D. GOLDFARB, L. M. SPITZ, A. M. TARTAKOFF, and M. OHNO, 1993 Regulation of RNA processing and transport by a nuclear guanine nucleotide release protein and members of the Ras superfamily. EMBO J. 12:2929-2937[Medline].
KAISER, C., S. MICHEALIS and A. MITCHELL, 1994 Methods in Yeast Genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
KANDELS-LEWIS, S. and B. SERAPHIN, 1993 Role of U6 snRNA in 5' splice selection. Science 262:2035-2039
KLEBE, C., F. R. BISCHOFF, H. PONSTINGL, and A. WITTINGHOFER, 1995a Interaction of the nuclear GTP-binding protein Ran with its regulatory proteins RCC1 and RanGAP1. Biochemistry 34:639-647[Medline].
KLEBE, C., H. PRINZ, A. WITTINGHOFER, and R. S. GOODY, 1995b The kinetic mechanism of Ran-nucleotide exchange catalyzed by RCC1. Biochemistry 34:12543-12552[Medline].
LI, Y., J. KANG, and M. S. HORWITZ, 1997 Interaction of an adenovirus 14.7-kilodalton protein inhibitor of tumor necrosis factor alpha cytolysis with a new member of the GTPase superfamily of signal transducers. J. Virol. 71:1576-1582[Abstract].
LUPAS, A., 1996 Prediction and analysis of coiled-coil structures. Methods Enzymol. 266:513-525[Medline].
LUPAS, A., M. VAN DYKE, and J. STOCK, 1991 Predicting coiled coils from protein sequences. Science 252:1162-1164[Medline]
), or ATP (
). After incubation at 30° for 30 min, the beads were spun down, washed, and the radioactivity coprecipitated with the beads was quantified using a liquid scintillation counter. The vertical axis indicates the ratio (percentage) of the CPM bound to Gtr1p in the presence of the indicated amount of cold nucleotides, on the basis of CPM bound to Gtr1p without cold nucleotides. (B) A total of 0.8 nmol of the E. coli-produced His6-Gtr1p proteins [wild type (Gtr1p), Q65L (Gtr1-13p), and C-del. (Gtr1-12
