Genetics, Vol. 152, 1037-1044, July 1999, Copyright © 1999

I-SceI Endonuclease, a New Tool for Studying DNA Double-Strand Break Repair Mechanisms in Drosophila

Yohanns Bellaichea, Vladic Mogila1,a,c, and Norbert Perrimona,b
a Department of Genetics, Harvard Medical School, Boston, Massachusetts 02115,
b Howard Hughes Medical Institute, Harvard Medical School, Boston, Massachusetts 02115
c Institute of Gene Biology, Russian Academy of Sciences, Moscow 117334, Russia

Corresponding author: Norbert Perrimon, Harvard Medical School, Alpert Bldg., 200 Longwood Ave., Boston, MA 02115., perrimon{at}rascal.med.harvard.edu (E-mail)

Communicating editor: S. HENIKOFF


*  ABSTRACT
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

As a step toward the development of a homologous recombination system in Drosophila, we have developed a methodology to target double-strand breaks (DSBs) to a specific position in the Drosophila genome. This method uses the mitochondrial endonuclease I-SceI that recognizes and cuts an 18-bp restriction site. We find that >6% of the progeny derived from males that carry a marker gene bordered by two I-SceI sites and that express I-SceI in their germ line lose the marker gene. Southern blot analysis and sequencing of the regions surrounding the I-SceI sites revealed that in the majority of the cases, the introduction of DSBs at the I-SceI sites resulted in the complete deletion of the marker gene; the other events were associated with partial deletion of the marker gene. We discuss a number of applications for this novel technique, in particular its use to study DSB repair mechanisms.


IONIZING radiation and radiomimetic drugs induce DNA double-strand breaks (DSBs) at random positions in the genome. During mating-type switching in yeast, transposition of P elements in Drosophila, or rearrangements of immunoglobulin genes in vertebrates, DSBs are introduced at specific positions within the genome (KLAR 1989 Down; JACKSON and JEGGO 1995 Down; WEAVER 1995 Down). During evolution, to maintain genome integrity, a number of genetic pathways have been deployed to repair DSBs (reviewed in HABER 1995 Down).

The mechanisms underlying DSB repair have been studied in Drosophila using the P-element transposase as a means to generate the chromosomal breaks (ENGELS et al. 1990 Down; KAUFMAN and RIO 1992 Down). These studies have revealed that DSBs, induced by excision of P elements, can be repaired by a conservative mechanism during which the genetic information near a DSB site is copied from a homologous region in the genome (FORMOSA and ALBERTS 1986 Down; ENGELS et al. 1990 Down, ENGELS et al. 1994 Down; GLOOR et al. 1991 Down; NASSIF et al. 1994 Down; MUELLER et al. 1996 Down; KEELER and GLOOR 1997 Down). The synthesis-dependent strand annealing (SDSA) model has been put forward to describe the mechanisms underlying the repair of those conservative events. This model proposes that the broken ends of DNA invade and displace independently a local loop of homologous regions of DNA during the repair process (FORMOSA and ALBERTS 1986 Down; NASSIF et al. 1994 Down; MUELLER et al. 1996 Down).

Although studies of the repair mechanism of DSBs induced by P-element excision have been very successful, the use of the P element to induce DSBs is technically limiting. P elements are used as transformation vectors; therefore, most of the studies can only analyze DSB events introduced at the extremity of a given transgene. Further, it is possible that there is a bias in the repair process of P-element-induced DSBs caused by the inverted repeat binding protein (IRBP), a homologue of the Ku70 protein that plays a central role in the repair process (RIO and RUBIN 1988 Down; BEALL et al. 1994 Down; BEALL and RIO 1996 Down; DYNAN and YOO 1998 Down). P-element termini are bound by IRBP, and the P-element transposase cuts the P-element termini directly adjacent to the IRBP binding site (BEALL and RIO 1996 Down; BEALL and RIO 1997 Down). Thus, it is possible that the binding of IRBP to the P element prior to the cut might affect the kinetics of the repair process, and in this way affect the outcome of the repair mechanism, such as the ratio between conservative and nonconservative repair (STAVELEY et al. 1995 Down; BEALL and RIO 1996 Down). Further, it has been proposed that the ratio of imprecise vs. precise repair following P-element-induced DSBs is biased toward imprecise repair because of the unusual 17-bp overhang that is left after cleavage by the P-element transposase (O'BROCHTA et al. 1991 Down; ENGELS et al. 1994 Down; BEALL and RIO 1997 Down).

The availability of a technique that is different from the use of P elements to induce DSBs in Drosophila would allow the analysis of the SDSA model in a more general manner. A number of recent studies have shown that the yeast I-SceI homing endonuclease can introduce DSBs in the genome of mouse cells or Xenopus oocytes (for review see JASIN 1996 Down). Such studies have confirmed some aspects of DSB repair mechanisms previously analyzed by transfection or injection of linear DNA molecules. I-SceI is encoded by an intron of the large mitochondrial rRNA (DUJON 1988 Down). Biochemical studies have shown that this restriction enzyme has an 18-bp specificity and leaves a 4-bp 5' overhang after the cleavage (COLLEAUX et al. 1988 Down). In this article, we show that expression of the yeast I-SceI endonuclease in Drosophila can be used as a general method to induce DSBs at I-SceI target sites in the Drosophila genome. We discuss the use of this novel technique to study SDSA and to analyze the functions of mutagen-sensitive (mus) mutations (DUSENBERY and SMITH 1996 Down) that have been implicated in DNA repair mechanisms.


*  MATERIALS AND METHODS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Plasmid constructions:
P{FRT-I-SceI-y+-{Delta}(w)::XEN-I-SceI-FRT}: Two direct flip recombinase target (FRT) repeats of the J32 vector (STRUHL and BASLER 1993 Down) were PCR amplified using the oligonucleotides 5'-GCCTAACTGCAGGGTACCCAGCTTCAAAAGCGCTCT and 5'-AGTGAATTCGAGCTCGGTACCCGGG, and they were cloned at the SacI and PstI site of a P-CarY vector (PATTON et al. 1992 Down) in which the NotI site has been deleted by blunt-end ligation. Two I-SceI sites were then added in direct orientation by subcloning two double-strand oligonucleotides, 5'-CTAGCTAGGGATAACAGGGTAATG/3'-GATCCCTATTGTCCCATTACAGCT and 5'-TCGACGCGGCCGCTAGGGATAACAGGGTAATG/3'-GCGCCGGCGATCCCTATTGTCCCATTACCTAG, at the NheI and BamHI sites, creating the P{2XFRT-I-SceI} vector. The two double-strand oligonucleotides also contain a SalI site, as well as a NotI site between two I-SceI sites. The 5.2-kb SalI fragment of the yellow gene from the Y.E.S. vector (PATTON et al. 1992 Down) was then cloned into the SalI site of the P{2XFRT-I-SceI} vector, creating the P{FRT-I-SceI-y+-FRT-I-SceI} vector. A 9-kb HindIII fragment from the white gene containing two-thirds of the first exon and 5 kb of 3' untranslated region (O'HARE et al. 1984 Down) was modified by insertion of the double-strand oligonucleotide 5'-CCGGATAGCTCGAGAATAAATCGCGATGAATTCGT/3'-CCGGACGAATTCATCGCGATTTATTCTCGAGCTAT at the BspM I (11063) site (O'HARE et al. 1984 Down). The insertion introduces a frameshift and three new restriction sites for EcoRI, NruI, and XhoI in the white sequence. This fragment was then flanked by NotI linkers and cloned at the NotI site of the P{FRT-I-SceI-y+-FRT-I-SceI} vector. The resulting plasmid was named P{FRT-I-SceI-y+-{Delta}(w)::XEN-I-SceI-FRT}.

P{ß2-tubulin-3nls-I-SceI}: The BamHI/HindIII fragment, which contains a DNA sequence from -511 to +156 of the ß2-tubulin promoter from the PWMelPvu vector (MICHIELS et al. 1993 Down), was cloned between the BamHI and EcoRI sites of the pPGK3Xnls-I-SceI vector (DONOHO 1996 Down). This vector contains the 3nls-I-SceI sequence cloned between the EcoRI and SalI sites of pBluescriptKS+ vector (Stratagene, La Jolla, CA). The NotI, SalI fragment, which contains the promoter and 3nlsI-SceI, was then cloned with a SalI, NotI fragment from the 3' sequence of the hsp70 gene from the pCasperHsp70 vector at the NotI site of the pDM30 transformation vector. The pDM30 transformation vector contains the ry+ gene.

Molecular methods:
Genomic DNA was prepared as described in ASHBURNER 1989 Down, and Southern blot analysis was conducted as described in SAMBROOK et al. 1989 Down. PCR amplifications of genomic fragments were carried out with the Ready-To-Go kit (Pharmacia, Piscataway, NJ) using the following primers: TCTCACGGCGGACTTATTAAGC or ATATGCGTAATTAGCGTTCG for the 3' end of P element, and CACGTTTGCTTGTTGAGAGG or AAAGCTTGTCGGCGTCAT for the 5' end of P element. PCR products were subcloned into a Promega pGEM-T vector and sequenced using the Sequenase2 kit (United States Biochemical/Amersham).

Flies were grown on standard cornmeal media. Mutations and chromosome aberrations not described in the text can be found in LINDSLEY and ZIMM 1992 Down. P-element transformation was performed using either the yw; Delta 2–3, Sb/TM6 stock, or the p{pi}25.1 helper plasmid (ASHBURNER 1989 Down).


*  RESULTS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

As part of an attempt to develop a general technique to induce gene knockouts in Drosophila, we have developed a new system to induce DSBs. We first describe the gene knockout strategy to provide the background for which the new technique to induce DSBs was developed.

Gene targeting in Drosophila:
One of the technical limitations of Drosophila as a system to study specific gene functions is the absence of a general gene-targeting system to allow systematic, reverse genetic studies. Such an approach to analyze gene functions is greatly needed, especially in light of the growing amount of information generated by the Drosophila Genome Project. A technique to target specific gene conversion events close to a preexisting P-element insertion site using P-element-induced DSBs has been developed (GLOOR et al. 1991 Down). However, this system does not allow a systematic analysis of every gene in the genome since P-element insertions are not evenly distributed throughout the genome. To circumvent this problem, we have attempted to develop a homologous recombination system for Drosophila genes. One of the critical steps of this system involves the linearization of a circular plasmid in the male germ line. To achieve this, we have used the yeast mitochondrial I-SceI enzyme to cut a circular piece of DNA generated by the FLP-out event (Figure 1). The I-SceI endonuclease recognizes a specific 18-bp sequence and leaves a 4-bp 5' overhang following the cut (COLLEAUX et al. 1988 Down). We expected that few, if any, I-SceI sites would be present in the Drosophila genome since, theoretically, a single I-SceI site should be found in a genome equivalent to 350 Drosophila genomes (ASHBURNER 1989 Down). A number of studies have shown that I-SceI efficiently cleaves genomic DNA or extrachromosomal DNA in plants and mammalian cell lines (reviewed in JASIN 1996 Down). However, no studies have assessed the activity of a rare cutting endonuclease in a whole organism. Thus, we decided to conduct a detailed analysis of the activity of I-SceI in Drosophila.



View larger version (18K):
In this window
In a new window
Download PPT slide
 
Figure 1. Homologous recombination strategy. (A) General strategy: the general scheme for gene targeting in various organisms involves the transfection of a linear molecule of DNA containing a modified version of an endogenous gene. Following a homologous recombination event, the modified gene will replace the endogenous sequence. To adapt a similar system to Drosophila, we introduced an inactive version of the white gene into the fly genome via P-element transformation. The mutant version of the white gene is subsequently released and linearized in the nucleus. The excision step is achieved by FLP-mediated recombination between the two direct FRT repeats, and linearization of the circular plasmid is catalyzed by I-SceI that recognizes and cuts an 18-bp restriction site. (B) Outline of the homologous recombination screen for the white locus. We designed a P-element vector in which a yellow+ marker and an inactive version of the white gene are flanked by the two FRT and the two I-SceI sites (see also Figure 2 for details). The yellow+ marker is used as a P-element transformation marker, and it can be used to monitor the excision of the inactive white gene and to analyze the reintegration events. This construct is named P{FRT-I-SceI-y+-{Delta}(w)::XEN-I-SceI-FRT}. We expressed both the FLP and I-SceI enzymes under the control of the ß2 tubulin promoter. The ß2 tubulin promoter drives expression of reporter genes in the male germ line cells during the late stages of spermatogenesis; therefore, the progeny of a single male will derive from a number of independent, I-SceI-induced excision events.

Expression of I-SceI in Drosophila induces DSBs:
To promote nuclear localization of the I-SceI enzyme, we used a fusion between the SV40 nuclear localization signal (nls) and the I-SceI coding sequence: this construct is referred to as 3nlsI-SceI (DONOHO 1996 Down). We generated four independent, P-element-transformed lines that carry the 3nlsI-Sce-I sequence downstream of the ß2-tubulin promoter. This promoter drives expression in postmitotic spermatids (FULLER 1995 Down) such that progeny from a single male should be derived from a number of independent repair events. None of the transgenic insertions affected male fertility since stocks that are either homozygous or heterozygous for these insertions can be maintained.

To determine whether the I-SceI enzyme, which is expressed under the control of the ß2-tubulin promoter, could induce DSBs, we constructed a reporter designated P{FRT-I-SceI-y+-{Delta}(w)::XEN-I-SceI-FRT} (Figure 2B). In this construct, the yellow+ gene is flanked by two I-SceI sites and, therefore, introduction of DSBs at the I-SceI sites should result in the loss of the yellow+ marker. To use the same construct for our gene-targeting experiment, two FRT sites and an inactive version of the white gene are also present in the reporter construct (Figure 1B and Figure 2B). These additional sequences should not affect our assay, which is based on the loss of the yellow+ marker that is flanked by the two I-SceI sites. We obtained three independent P-element-transformed fly lines of this reporter construct.



View larger version (42K):
In this window
In a new window
Download PPT slide
 
Figure 2. Test of the activity of the I-SceI endonuclease in the male germ line. (A) The P{ß2tubulin-3nls-I-SceI} expression construct: the I-SceI sequence was fused with the SV40 nuclear localization signal (3nls-I-SceI) to promote localization of the enzyme into the nucleus. The signal 3nls-I-SceI was cloned downstream of the ß2-tubulin promoter in a P-element vector marked with the rosy+ gene. Four independent P{ß2tubulin-3nls-I-SceI} insertions were recovered on the third chromosome. Two of these, insertions 1 and 2 are associated with zygotic lethality, while insertions 3 and 4 are homozygous viable insertions. (B) The P{FRT-I-SceI-y+-{Delta}(w)::XEN-I-SceI-FRT} reporter construct: this construct contains a yellow+ gene placed between two recognition sites for I-SceI. Three independent P{FRT-I-SceI-y+-{Delta}(w)::XEN-I-SceI-FRT} insertions were recovered, one on the first chromosome and two on the second chromosome. (C) To show that the I-SceI can induce DSBs in the male germ line, y, P{FRT-I-SceI-y+-{Delta}(w)::XEN-I-SceI-FRT}/Y; +/+; P{ß2tubulin-3nls-I-SceI} males were crossed with FM7a, y homozygous virgin females, and their progeny were scored for yellow females. To demonstrate that the loss of the yellow+ marker was dependent on the expression of the I-SceI enzyme, we scored the progeny of y, P{FRT-I-SceI-y+-{Delta}(w)::XEN-I-SceI-FRT}/Y; +/+; TM2/+ males crossed with FM7a, y virgin females. We also determined the occurrence of DSB events using a reporter construct located on the second chromosome. In this experiment, progeny of single y; P{FRT-I-SceI-y+-{Delta}(w)::XEN-I-SceI-FRT}/CyO; P{ß2tubulin-3nls-ISce-I} males crossed to y w; CyO/Sco virgin females were analyzed and scored for CyO or Sco yellow progeny. (D) Percentage of yellow- progeny obtained in various experiments. Numbers on top of the bars indicate the number of flies scored in each cross. The results are given for different combinations of reporter and expression transgenes. A total of 4–10% of yellow- progeny (mean value, 6.47%) were recovered. In the absence of the P{ß2tubulin-3nls-I-SceI} expression transgene, no phenotypically yellow flies were recovered (1900 progeny scored in six independent experiments). ND, not determined.

Since I-SceI was expressed under the control of the male-specific ß2-tubulin promoter, we scored the progeny of males containing the 3nls-I-SceI-expressing construct and one copy of P{FRT-I-SceI-y+-{Delta}(w)::XEN-I-SceI-FRT} crossed with homozygous yellow females (Figure 2C). In this cross, we found that 4–10% of the progeny had lost the yellow+ marker (Figure 2D). In addition, we observed that the occurrence of phenotypically yellow mutant flies in the progeny is strictly dependent on the presence of the P{ß2-tubulin-3nls-I-SceI} transgene. Similar results were obtained using different combinations of P{ß2-tubulin-3nls-I-SceI} and P{FRT-I-SceI-y+-{Delta}(w)::XEN-I-SceI-FRT} transgenes. From these results, we conclude that the 3nls-I-SceI enzyme is functional and able to induce DSBs in spermatids.

Anatomy of the repaired DNA:
To characterize in more detail the molecular events following DSBs, we randomly selected 25 independent, phenotypically yellow lines generated in the previous experiments and analyzed them by Southern analysis. These lines fall into 2 major classes on the basis of analysis of the sequences present after induction of DSBs at the I-SceI sites (Figure 3). In class 1 events, which represent 22 cases, a complete deletion of the sequences encoding both the yellow and white sequences was observed. In class 2 events, which represent the other 3 cases, only partial deletion of the yellow gene was detected.



View larger version (86K):
In this window
In a new window
Download PPT slide
 
Figure 3. Southern blot analysis of the yellow- lines. (A) The genomic DNA was cut by XbaI and hybridized with the 9-kB {Delta}(white)::XEN fragment. (B) The genomic DNA was cut by HindIII and hybridized with the SalI yellow fragment from the Y.E.S. vector. In A and B, the circles indicate the position of the fragments associated with the endogenous white and yellow genes, respectively. (C and D) The genomic DNA was cut by XhoI and probed with either the 5' end of the P element (C, using a 500-bp fragment obtained by PCR; see MATERIALS AND METHODS for details) or with the 3' end of the P element (D, using a 300-bp fragment). Lane 1, FM7a stock; lane 2, reporter construct alone; lane 3, expression construct alone; lanes 4–6, yellow- lines with partial deletions of different sizes; lanes 7–10, four examples of complete deletion of the yellow and white sequences. In B, the 1.4- and 0.9-kb fragments of the yellow gene are not shown. C and D show the existence of another P element (circle on the left of the blot) in the FM7a, y and in the y, P{FRT-I-SceI-y+-{Delta}(w)::XEN-I-SceI-FRT} parental stocks. The nature of this P element is unknown, but this P element is clearly nonfunctional since we did not recover any yellow progeny in the control crosses: y, P{FRT-I-SceI-y+-{Delta}(w)::XEN-I-SceI-FRT}/Y; +/+; TM2/+ males crossed with FM7a, y virgin females. The arrowheads indicate the positions of bands associated with the original reporter construct. The approximate calculated sizes of the restriction DNA fragments are shown in kilobases on the right side of each blot.

We analyzed class 1 lines in more detail, and found that both the 3' and 5' P-element termini were present. These results suggest that the cut was not followed by extensive degradation of the broken DNA since the P-element termini are located within 100 bp from the cleavage site. To confirm these results, the genomic DNA located between the two P-element termini was cloned from nine independent, randomly selected lines. Interestingly, sequence analysis of these DNAs revealed that the repair of the DSBs had proceeded in different ways (Figure 4A). In six out of the nine cases, we could identify partial sequences from the FRT and/or I-SceI sites, suggesting that following the cut, the gap was enlarged and repaired by direct end joining. One of the nine lines was found to be associated with a reconstitution of a perfect I-SceI site. This event can be explained either by repair through direct ligation of the two DNA strands following cuts at the two I-SceI sites or by a single cut at one of the I-SceI sites followed by single-strand annealing (SSA) repair. Finally, sequence analysis of the remaining two DSB events revealed the presence of a unique FRT site. These two events can either be the result of two independent cuts at each I-SceI site or of a single cut at one of the I-SceI sites. In both cases, the repair would have then proceeded via SSA using the direct repeat from the FRT sites. The length of the FRT repeats is compatible with the length necessary for homologous pairing (HABER 1995 Down; KEELER and GLOOR 1997 Down).



View larger version (30K):
In this window
In a new window
Download PPT slide
 
Figure 4. Characterization of the events. (A) Sequences of the lines that were associated with complete deletions of both the yellow and white reporter sequences. The first sequence represents a perfect restoration of the I-SceI recognition site. The two last cases were recovered twice. (B) Interpretation of the partial deletions based on Figure 3 genomic Southern blots. The lengths of the deletions are approximate and are based on the size of the fragments detected by Southern analysis.

Southern blot analysis of class 2 events revealed that a partial deletion of the yellow sequence had occurred following the cut by I-SceI. In every case, consistent with the yellow phenotype, the coding sequence of the yellow gene was altered (Figure 4B). Since the white sequence appears intact, we interpret these events as the result of a single I-SceI cut at the I-SceI site located close to the 5'P-element end. In two cases, the DSB was slightly enlarged and appeared to leave the P-element terminus intact. In a final case, the 5' P-element end appeared to have been deleted. This suggests that after the cut at one I-SceI site, the cut was enlarged and the yellow sequence was altered. We could not determine whether a part of the yellow sequence was then copied from the other intact chromatid. We suspect that a number of similar events should have taken place at the I-SceI site located close to the 3' P-element end; however, such events would not have been recovered since the selection was based on the loss of the yellow marker.


*  DISCUSSION
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

I-SceI can induce DSBs at a specific position in the Drosophila genome:
We have demonstrated that the I-SceI endonuclease from yeast is able to induce DSBs in the Drosophila genome at positions that contain the 18-bp recognition site for this endonuclease. We found that ~6% of the progeny of males expressing I-SceI in their germ line lose a yellow gene that is flanked by two I-SceI sites. Most of the events resulted in complete deletion of the sequences located between the two I-SceI sites. These events are either the result of two independent cuts occurring at both I-SceI sites or a single cut at one of the I-SceI sites. Following the cut by I-SceI, the DSB was enlarged and then repaired by direct end joining or SSA. An enlargement of the DSB has also been proposed to occur for P-element-induced DSBs (reviewed in KEELER and GLOOR 1997 Down).

Development of a targeting system:
We developed the I-SceI system as a means to linearize a circular piece of DNA in vivo. This method represents one of the steps in a protocol to develop a general gene-targeting system in Drosophila (Figure 1). To test for homologous recombination events, we generated a line containing two P-element constructs expressing FLP-recombinase and I-SceI enzyme under the control of the ß2-tubulin promoter, and we conducted the screen described in Figure 1. Although we demonstrate that the 3nlsI-SceI enzyme, expressed under the control of the ß2-tubulin promoter, is able to induce DSBs, our attempts to recover homologous recombination events failed; i.e., analysis of >250,000 female progeny derived from Df(1)y-ac, P{ß2-tubulin-FLP}; P{FRT-I-Sce-I-y+-{Delta}(w)::XEN-I-Sce-I-FRT}; P{ß2-tubulin-3nls-I-SceI} males (see Figure 1B) failed to produce any white mutant females, indicating that no homologous recombination events had occurred.

Two recently published studies may provide an explanation for our failure to induce homologous recombination using a single linear piece of DNA provided by excision. LEUNG et al. 1997 Down and NEGRITTO et al. 1997 Down have designed a similar system in yeast. This system is based on the release of a linear piece of DNA for the Leu2 or SAM2 genes using the HO endonuclease. The two studies show that the efficiency of homologous recombination is low in these systems and, at most, occurs once for every 20,000 excision events. LEUNG et al. 1997 Down proposed that this effect is due to the preferential correction of a DNA nick with the intact chromosomal DNA. This explanation has been suggested in a number of other assays as well (reviewed in LEUNG et al. 1997 Down). Interestingly, mutations in the mismatch repair genes PMS1 or Msh2 have been found to improve by 20- and 40-fold, respectively, the efficiency of homologous recombination. It will be interesting to repeat our homologous recombination screen in a PSM1 or Mhs2 mutant background when mutations in these genes become available.

Generalization of the SDSA model using the I-SceI enzyme:
Studies of DSBs in Drosophila have been carried out using P elements as a means to introduce DSBs at specific locations in the genome (KAUFMAN and RIO 1992 Down). These studies have led to the SDSA model to explain the repair mechanism following P-element excisions (FORMOSA and ALBERTS 1986 Down; NASSIF et al. 1994 Down; MUELLER et al. 1996 Down; KEELER and GLOOR 1997 Down). The most comprehensive study of DSB repair has been conducted at the white locus. In addition, a number of studies have been conducted at both the vestigial and the Broad Complex loci (reviewed in KEELER and GLOOR 1997 Down).

The generalization of the SDSA model to other induced DSB events represents an important step toward the understanding of DSB repair mechanisms. We believe that I-SceI can be used as a tool to further analyze the parameters of the SDSA model. For example, it will allow the determination of whether the binding of the IRBP protein on P-element termini influences the repair mechanism (see Introduction), as well as the testing of whether the high rate of imprecise P-element excisions is caused by the unusual 17-bp overhang left by the P-element transposase (ENGELS et al. 1990 Down; O'BROCHTA et al. 1991 Down, see Introduction; BEALL and RIO 1997 Down).

Further applications of I-SceI to dissect genetic pathways involved in the DSB repair:
The development of the I-SceI system will allow the characterization of molecules involved in DSB repair. In Drosophila, 15 loci associated with mus or mei repair defects have been isolated on the basis of their sensitivity to specific mutagenic agents (DUSENBERY and SMITH 1996 Down). Importantly, different studies have shown that this group of genes is involved in the DSB repair process (SEKELSKY et al. 1995 Down; ARAJ and SMITH 1996 Down; BEALL and RIO 1996 Down). To date, however, no methodology is available to classify these genes in epistatic or genetic groups. Studies in yeast have characterized in more details the function of radiation-sensitive genes (RAD) by comparing their effects on the repair of a DSB induced within a direct DNA repeat to a DSB induced outside of a direct repeat. For example, several studies have shown that RAD51, RAD54, RAD55, and RAD57 are required for mating-type switching, but not for the SSA repair of a DSB introduced between two direct repeats. These results have led to the proposal that these genes are required for gaining access to an intact, constrained region of the chromatid to facilitate the copying of information (SUGAWARA et al. 1995 Down). In addition, mutations in RAD1 and RAD10 have a slight effect on DSB gap repair at the mating-type locus (MAT). However, in RAD1 and RAD10 mutants, SSA between two direct repeats is completely blocked (FISHMAN-LOBELL and HABER 1992 Down). These results suggest that Rad1 is part of a complex that is necessary for removing nonhomologous sequences before SSA. It has been subsequently demonstrated that Rad1 and Rad10 form a complex that has a single-strand endonuclease activity (BARDWELL et al. 1994 Down). Our study shows that the I-SceI system allows the analysis of DSB repair between two direct repeats, an event that cannot be generated using P elements. Because these events occur at relatively high frequency, it should allow experiments similar to those conducted in yeast and permit the assignment of different mus Drosophila genes into epistatic groups.

Finally, we envisage that the I-SceI system could be used to engineer specific changes in the fly genome. For example, one can envisage using this system as a general means to induce a series of deficiencies. Following local duplication of a P element containing a single I-SceI site, the expression of the I-SceI enzyme should generate deletions between the two P elements. In contrast to other systems, such as the FRT/FLP system (GOLIC 1994 Down; GOLIC and GOLIC 1996 Down), the recovery of deletions between the two distant P elements should not be influenced by the distance between the insertion sites.


*  FOOTNOTES

1 These authors contributed equally to this work. Back


*  ACKNOWLEDGMENTS

We thank K. O'Hare, G. Struhl, M. Jasin, R. Renkawitz-Pohl, G. P. Donoho, and P. Geyer for reagents or strains; L. Perkins and one of the reviewers for comments on the manuscript; and W. Engels and J. Haber for interesting discussions on the work. Y.B. was supported for the work by the ENSL. V.M. was supported by Human Frontier Science Program Organization and the National Science Foundation (NSF). Part of this work was supported by a grant from the NSF. N.P. is a Howard Hughes Medical Institute (HHMI) investigator.

Manuscript received December 29, 1998; Accepted for publication April 5, 1999.


*  LITERATURE CITED
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

ARAJ, H. and P. D. SMITH, 1996  Positional cloning of the Drosophila melanogaster mei-9 gene, the putative homolog of the Saccharomyces cerevisiae RAD1 gene. Mutat. Res. 364:209-215[Medline].

ASHBURNER, M., 1989 Drosophila. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

BARDWELL, A. J., L. BARDWELL, A. E. TOMKINSON, and E. C. FRIEDBERG, 1994  Specific cleavage of model recombination and repair intermediates by the yeast Rad1-Rad10 DNA endonuclease. Science 265:2082-2085[Abstract/Free Full Text].

BEALL, E. L. and D. C. RIO, 1996  Drosophila IRBP/Ku p70 corresponds to the mutagen-sensitive mus309 gene and is involved in P-element excision in vivo. Genes Dev. 10:921-933[Abstract/Free Full Text].

BEALL, E. L. and D. C. RIO, 1997  Drosophila P-element transposase is a novel site-specific endonuclease. Genes Dev. 11:2137-2151[Abstract/Free Full Text].

BEALL, E. L., A. ADMON, and D. C. RIO, 1994  A Drosophila protein homologous to the human p70 Ku autoimmune antigen interacts with the P transposable element inverted repeats. Proc. Natl. Acad. Sci. USA 91:12681-12685[Abstract/Free Full Text].

COLLEAUX, L., L. D'AURIOL, F. GALIBERT, and B. DUJON, 1988  Recognition and cleavage site of the intron-encoded omega transposase. Proc. Natl. Acad. Sci. USA 85:6022-6026[Abstract/Free Full Text].

DONOHO, G. P., 1996 Targeting modifications to mammalian chromosomal loci via recombinational repair of double-strand breaks. Ph.D. Thesis, Stanford University, Stanford, CA.

DUJON, B., 1988  Group I introns as mobile genetic elements: facts and mechanistic speculations—a review. Gene 82:91-114.

DUSENBERY, R. L. and P. D. SMITH, 1996  Cellular responses to DNA damage in Drosophila melanogaster.. Mutat. Res. 364:113-145.

DYNAN, W. and S. YOO, 1998  Interaction of Ku protein and DNA-dependent protein kinase catalytic subunit with nucleic acids. Nucleic Acids Res. 26:1551-1559[Abstract/Free Full Text].

ENGELS, W. R., D. M. JOHNSON-SCHLITZ, W. B. EGGLESTON, and J. SVED, 1990  High-frequency P element loss in Drosophila is homolog dependent. Cell 62:515-525[Medline].

ENGELS, W. R., C. R. PRESTON, and D. M. JOHNSTON-SCHLITZ, 1994  Long-range cis preference in DNA homology search over the length of a Drosophila chromosome. Science 263:1623-1625[Abstract/Free Full Text].

FISHMAN-LOBELL, J. and J. E. HABER, 1992  Removal of nonhomologous DNA ends in double-strand break recombination: the role of the yeast ultraviolet repair gene RAD1.. Science 258:480-484[Abstract/Free Full Text].

FORMOSA, T. and B. M. ALBERTS, 1986  DNA synthesis dependent on genetic recombination: characterization of a reaction catalyzed by purified bacteriophage T4 proteins. Cell 47:793-806[Medline].

FULLER, M. T., 1995 Spermatogenesis, pp. 71–147 in The Development of Drosophila melanogaster, edited by M. BATE and A. MARTINEZ ARIAS. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

GLOOR, G. B., N. A. NASSIF, D. M. JOHNSON-SCHLITZ, C. R. PRESTON, and W. R. ENGELS, 1991  Targeted gene replacement in Drosophila via P element-induced gap repair. Science 253:1110-1117[Abstract/Free Full Text].

GOLIC, K. G., 1994  Local transposition of P elements in Drosophila melanogaster and recombination between duplicated elements using a site-specific recombinase. Genetics 137:551-563[Abstract].

GOLIC, K. G. and M. M. GOLIC, 1996  Engineering the Drosophila genome: chromosome rearrangements by design. Genetics 144:1693-1711[Abstract].

HABER, J. E., 1995  In vivo biochemistry: physical monitoring of recombination induced by site-specific endonucleases. Bioessays 17:609-620[Medline].

JACKSON, S. P. and P. A. JEGGO, 1995  DNA double-strand break repair and V(D)J recombination: involvement of DNA-PK. Trends Biochem. Sci. 20:412-415[Medline].

JASIN, M., 1996  Genetic manipulation of genomes with rare-cutting endonucleases. Trends Genet. 12:224-228[Medline].

KAUFMAN, P. D. and D. C. RIO, 1992  P element transposition in vitro proceeds by a cut-and-paste mechanism and uses GTP as a cofactor. Cell 69:27-39[Medline].

KEELER, K. J. and G. B. GLOOR, 1997  Efficient gap repair in Drosophila melanogaster requires a maximum of 31 nucleotides of homologous sequence at the searching ends. Mol. Cell. Biol. 17:627-634[Abstract/Free Full Text].

KLAR, A. J. S., 1989 The interconversion of yeast mating-type: Saccharomyces cerevisiae and Schizosaccharomyces pombe, pp. 671–691 in Mobile DNA, edited by D. BERG and M. HOWE. American Society for Microbiology, Washington, DC.

LEUNG, W., A. MALKOVA, and J. E. HABER, 1997  Gene targeting by linear duplex DNA frequently occurs by assimilation of a single strand that is subject to preferential mismatch correction. Proc. Natl. Acad. Sci. USA 94:6851-6856[Abstract/Free Full Text].

LINDSLEY, D. L., and G. G. ZIMM, 1992 The Genome of Drosophila melanogaster. Academic Press, San Diego.

MICHIELS, F., D. BUTTERGEIT, and R. RENKAWITZ-POHL, 1993  An 18-bp element in the 5' untranslated region of the Drosophila beta2 tubulin mRNA regulates the mRNA level during postmeiotic stages of spermatogenesis. Eur. J. Cell. Biol. 62:66-74[Medline].

MUELLER, J. E., J. CLYMAN, Y. J. HUANG, M. M. PARKER, and M. BELFORT, 1996  Intron mobility in phage T4 occurs in the context of recombination-dependent DNA replication by way of multiple pathways. Genes Dev. 10:351-364[Abstract/Free Full Text].

NASSIF, N., J. PENNEY, S. PAL, W. R. ENGELS, and G. B. GLOOR, 1994  Efficient copying of nonhomologous sequences from ectopic sites via P-element-induced gap repair. Mol. Cell. Biol. 14:1613-1625[Abstract/Free Full Text].

NEGRITTO, M. T., X. WU, T. KUO, S. CHU, and A. M. BAILIS, 1997  Influence of DNA sequence identity on efficiency of targeted gene replacement. Mol. Cell. Biol. 17:278-286[Abstract/Free Full Text].

O'BROCHTA, D. A., S. P. GOMEZ, and A. M. HANDLER, 1991  P element excision in Drosophila melanogaster and related Drosophilids. Mol. Gen. Genet. 225:387-394[Medline].

O'HARE, K., C. MURPHY, R. LEVIS, and G. M. RUBIN, 1984  DNA sequence of the white locus of Drosophila melanogaster. J. Mol. Biol. 180:437-455[Medline].

PATTON, J. S., X. V. GOMES, and P. K. GEYER, 1992  Position-independent germline transformation in Drosophila using a cuticle pigmentation gene as a selectable marker. Nucleic Acids Res. 20:5859-5860[Free Full Text].

RIO, D. C. and G. M. RUBIN, 1988  Identification and purification of a Drosophila protein that binds to the terminal 31-base-pair inverted repeats of the P transposable element. Proc. Natl. Acad. Sci. USA 85:8929-8933[Abstract/Free Full Text].

SAMBROOK, J., E. F. FRITSCH and T. MANIATIS, 1989 Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

SEKELSKY, J. J., K. S. MCKIM, G. M. CHIN, and R. S. HAWLEY, 1995  The Drosophila meiotic recombination gene mei-9 encodes a homologue of the yeast excision repair protein Rad1. Genetics 141:619-627[Abstract].

STAVELEY, B. E., T. R. HESLIP, R. B. HODGETTS, and J. B. BELL, 1995  Protected P-element termini suggest a role for inverted-repeat-binding protein in transposase-induced gap repair in Drosophila melanogaster.. Genetics 139:1321-1329[Abstract].

STRUHL, G. and K. BASLER, 1993  Organizing activity of wingless protein in Drosophila.. Cell 72:527-540[Medline].

SUGAWARA, N., E. L. IVANOV, J. FISHMAN-LOBELL, B. L. RAY, and X. WU et al., 1995  DNA structure-dependent requirements for yeast RAD genes in gene conversion. Nature 373:84-86[Medline].

WEAVER, D. T., 1995  What to do at an end: DNA double-strand-break repair. Trends Genet. 11:388-392[Medline].




This article has been cited by other articles:


Home page
GeneticsHome page
S. W. A. Titen and K. G. Golic
Telomere Loss Provokes Multiple Pathways to Apoptosis and Produces Genomic Instability in Drosophila melanogaster
Genetics, December 1, 2008; 180(4): 1821 - 1832.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
J. Huang, W. Zhou, A. M. Watson, Y.-N. Jan, and Y. Hong
Efficient Ends-Out Gene Targeting In Drosophila
Genetics, September 1, 2008; 180(1): 703 - 707.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
C. M. Moure, F. S. Gimble, and F. A. Quiocho
Crystal structures of I-SceI complexed to nicked DNA substrates: snapshots of intermediates along the DNA cleavage reaction pathway
Nucleic Acids Res., June 1, 2008; 36(10): 3287 - 3296.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
N. Windbichler, P. A. Papathanos, F. Catteruccia, H. Ranson, A. Burt, and A. Crisanti
Homing endonuclease mediated gene targeting in Anopheles gambiae cells and embryos
Nucleic Acids Res., September 27, 2007; 35(17): 5922 - 5933.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
D. S. Wei and Y. S. Rong
A Genetic Screen For DNA Double-Strand Break Repair Mutations in Drosophila
Genetics, September 1, 2007; 177(1): 63 - 77.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
C. R. Preston, C. C. Flores, and W. R. Engels
Differential Usage of Alternative Pathways of Double-Strand Break Repair in Drosophila
Genetics, February 1, 2006; 172(2): 1055 - 1068.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
Y. S. Rong and K. G. Golic
The Homologous Chromosome Is an Effective Template for the Repair of Mitotic DNA Double-Strand Breaks in Drosophila
Genetics, December 1, 2003; 165(4): 1831 - 1842.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
W. J. Gong and K. G. Golic
Ends-out, or replacement, gene targeting in Drosophila
PNAS, March 4, 2003; 100(5): 2556 - 2561.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
A. Piccin, A. Salameh, C. Benna, F. Sandrelli, G. Mazzotta, M. Zordan, E. Rosato, C. P. Kyriacou, and R. Costa
Efficient and heritable functional knock-out of an adult phenotype in Drosophila using a GAL4-driven hairpin RNA incorporating a heterologous spacer
Nucleic Acids Res., June 15, 2001; 29(12): e55 - e55.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
Y. S. Rong and K. G. Golic
Gene Targeting by Homologous Recombination in Drosophila
Science, June 16, 2000; 288(5473): 2013 - 2018.
[Abstract] [Full Text]


Home page
Mol. Cell. Biol.Home page
D. G. Eickbush, D. D. Luan, and T. H. Eickbush
Integration of Bombyx mori R2 Sequences into the 28S Ribosomal RNA Genes of Drosophila melanogaster
Mol. Cell. Biol., January 1, 2000; 20(1): 213 - 223.
[Abstract] [Full Text] [PDF]