- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Beagley, C. T.
- Articles by Wolstenholme, D. R.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Beagley, C. T.
- Articles by Wolstenholme, D. R.
Mytilus Mitochondrial DNA Contains a Functional Gene for a tRNASer(UCN) With a Dihydrouridine Arm-Replacement Loop and a pseudo-tRNASer(UCN) Gene
C. Timothy Beagleya, Ronald Okimoto1,a, and David R. Wolstenholmeaa Department of Biology, University of Utah, Salt Lake City, Utah 84112
Corresponding author: David R. Wolstenholme, Department of Biology, University of Utah, 257 South 1400 East, Salt Lake City, UT 84112-0840., wolstenholme{at}biology.utah.edu (E-mail)
Communicating editor: G. B. GOLDING
| ABSTRACT |
|---|
A 2500-nucleotide pair (ntp) sequence of F-type mitochondrial (mt) DNA of the Pacific Rim mussel Mytilus californianus (class Bivalvia, phylum Mollusca) that contains two complete (ND2 and ND3) and two partial (COI and COIII) protein genes and nine tRNA genes is presented. Seven of the encoded tRNAs (Ala, Arg, His, Met(AUA), Pro, Ser(UCN), and Trp) have the potential to fold into the orthodox four-armed tRNA secondary structure, while two [tRNASer(AGN) and a second tRNASer(UCN)] will fold only into tRNAs with a dihydrouridine (DHU) arm-replacement loop. Comparison of these mt-tRNA gene sequences with previously published, corresponding M. edulis F-type mtDNA indicates that similarity between the four-armed tRNASer(UCN) genes is only 63.8% compared with an average of 92.1% (range 86.298.5%) for the remaining eight tRNA genes. Northern blot analysis indicated that mature tRNAs encoded by the DHU arm-replacement loop-containing tRNASer(UCN), tRNASer(AGN), tRNAMet(AUA), tRNATrp, and tRNAPro genes occur in M. californianus mitochondria, strengthening the view that all of these genes are functional. However, Northern blot and 5' RACE (rapid amplification of cDNA ends) analyses indicated that the four-armed tRNASer(UCN) gene is transcribed into a stable RNA that includes the downstream COI sequence and is not processed into a mature tRNA. On the basis of these observations the M. californianus and M. edulis four-armed tRNASer(UCN) sequences are interpreted as pseudo-tRNASer(UCN) genes.
THE mitochondrial (mt) genomes of almost all multicellular animals (metazoa) comprise a single circular molecule of 1442 kb (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Most metazoan mtDNAs contain the same set of genes for 13 energy-pathway proteins: cytochrome b (Cyt b); subunits IIII of cytochrome c oxidase (COICOIII); subunits 6 and 8 of FO ATP synthetase (ATPase6 and ATPase8); subunits 16 and 4L of the respiratory chain NADH dehydrogenase (ND1-ND6 and ND4L); and two RNAs that are homologous to the 16S and 23S ribosomal RNAs (rRNAs) of Escherichia coli (but smaller and usually referred to as s-rRNA and l-rRNA) and 22 transfer RNAs (tRNAs). The arrangement of genes within metazoan mtDNAs is very compact. Differences in gene arrangement occur among metazoan mtDNAs, and the extent of these differences appears to be a function of evolutionary distances (![]()
![]()
![]()
Metazoan mt-genomes are characterized by a number of unusual features. These include genetic code modifications, the use of unorthodox translation initiation codons, post-transcriptional generation of translation termination codons, translation by only 22 tRNAs that are mtDNA encoded and of diverse size and structural form, and replication by a unique asymmetrical mode (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Subsequent to the report of ![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
In this article we report the sequence of a 2500-nucleotide pair (ntp) segment of the F-type mtDNA molecule of M. californianus. From comparison of this latter sequence with the corresponding M. edulis sequence, and data obtained from Northern blot analysis, we show that Mytilus mtDNA molecules include a gene that encodes a functional dihydrouridine (DHU) arm-replacement loop-containing tRNASer (UCN), not identified by ![]()
![]()
| MATERIALS AND METHODS |
|---|
Animals and mitochondrial nucleic acid isolations:
Specimens of M. californianus were collected from Monterey Bay by Michael O. Morris, Sea Life Supply, Sand City, CA. Mitochondria were isolated from mechanically disrupted adductor muscles of 10 M. californianus and mtDNA was prepared by methods previously described (![]()
![]()
Oligonucleotide probes:
Oligonucleotides were synthesized in an Applied Biosystem (Foster City, CA) Synthesizer 380B and used without further purification. Oligonucleotides complementary to the sense strand of various presumptive tRNA genes and the
tRNASer(UCN) gene (oligonucleotide F5) that were used in Northern blot experiments are shown in Figure 2. The sequence of an oligonucleotide complementary to E. coli tRNATyr and used as a size marker in one Northern experiment was 5'GGAAGGATTCGAACCTTCGAA. These oligonucleotides were 5'-end-labeled using T4 polynucleotide kinase (BRL) and [
-32P]ATP. The gene locations of all other oligonucleotides (F1F4) used in Northern blot experiments and/or as primers in PCR amplifications are shown in Figure 1B, and following are their nucleotide sequences together with their coordinates in the determined sequence (Figure 1A). Reverse-order numbers correspond to antisense sequences. Nonencoded restriction site-containing sequences are bracketed. F1: 130, 5' [TGGAATTC]TGGTACTGACTTTTGTAGATG; F2: 31953178 (not included in Figure 1A), 5' [AGGAATT]CCAGAACAATGCATAATTACC; F3: 20121992, 5' TAAATAGAAACCCTCTTGAGG; and F4: 24022383, 5' CTACTTCACCGTAACCGCCTC. Following are the nucleotide sequences of degenerate primers COI-11D and COI-12D (Figure 1B), which are based on highly conserved sequences in various metazoan COI genes. The coordinates shown are those of the Metridium senile intron-containing COI gene complex (![]()
|
|
PCR amplification of M. californianus mtDNA:
A 435-ntp segment of the M. californianus COI gene was PCR amplified using the degenerate primer pair COI-11D and COI-12D, and then sequenced. An oligonucleotide (F2) based on this COI sequence, which included an added 5' end EcoRI site, together with an oligonucleotide (F1) corresponding to a segment of the M. edulis COIII gene, and also including a 5' end EcoRI site, were used to PCR amplify a 3.2-kb segment of M. californianus mtDNA. This 3.2-kb sequence was cloned in the two reverse orientations into bacteriophage M13mp19 DNA, and amplified in E. coli JM101. The two reversely oriented, cloned sequences were designated MC412 and MC413. Except as described below, details regarding PCR amplification, electrophoresis, cloning, and purification of single-strand M13 DNA are given or referred to in ![]()
![]()
![]()
DNA sequencing and sequence analysis:
DNA sequences were obtained by the extension-dideoxy-termination procedure (![]()
![]()
Northern blotting:
For determination of approximate relative sizes of RNAs containing transcripts of some tRNA genes and the
tRNASer(UCN) gene, M. californianus whole mtRNA (3 µg/lane) was electrophoresed in a 2.2 M formaldehyde-containing 3% agarose gel, transferred to a nitrocellulose filter, and hydridized with 32P-labeled gene sequence-specific oligonucleotides. A similar procedure was used to determine and compare the sizes of RNAs containing transcripts of the ND3, COI, and
tRNASer(UCN) genes, except that electrophoresis was carried out in a 2.2 M formaldehyde-containing 1% agarose gel.
For precise determination of tRNA sizes, M. californianus mtRNA (10 µg/lane) was electrophoresed in polyacrylamide gels, electroblotted, and probed with gene sequence-specific oligonucleotides as described in ![]()
Location of the 5' end of the COI transcript:
5' RACE (rapid amplification of cDNA ends) analysis (![]()
![]()
| RESULTS AND DISCUSSION |
|---|
Complete 2500-ntp sequences were obtained from two reversely oriented inserts of a PCR-generated 3.2-kb M. californianus mtDNA segment, cloned in M13mp19. As the two 2500-ntp sequences obtained were identical, we concluded that they both originated from the same mtDNA type. That this was the F-type was determined by comparison of a portion of the COI gene sequence with the equivalent COI F-type and COI M-type sequences identified by ![]()
The entire, continuous 2500-ntp sequence of M. californianus F-type mtDNA is given in Figure 1A, and is compared with two sequences of M. edulis F-type mtDNA reported by ![]()
tRNASer(UCN); (see below), and COI (5' end region). The two M. edulis sequences, collectively, have the same gene content, but the sequence of a central region of the ND2 gene was not determined (Figure 1B).
Protein genes:
![]()
Data from nucleotide and amino acid sequence comparisons of the complete M. californianus and M. edulis ND3 genes, corresponding segments of the complete M. californianus ND2 gene and the two sequences of the M. edulis ND2 gene, and the portions of the M. californianus and M. edulis COIII genes that extend 3' relative to other metazoan COIII genes are given in Table 1. For the ND3 and ND2 genes, nucleotide and amino acid sequence similarities are 80.2 and 73.2%, and 94 and 80.7%, respectively. The corresponding values for comparisons of the M. californianus and M. edulis COIII 3' extensions are intermediate to those obtained for the ND3 and ND2 genes: 79.9 and 91.7%, respectively. Between the ND3 and ND2 genes of the two species, silent substitutions are in excess of replacement substitutions, and in silent positions, transitions exceed transversions, as has been reported for mt-protein genes of closely related species of other invertebrates and vertebrates (![]()
![]()
![]()
![]()
|
Transfer RNA genes:
Comparisons of the sequences of the M. californianus and M. edulis tRNA genes are given in Figure 2 and Table 2. The sequences of eight of the tRNA genes [Ala, Arg, His, Met, Pro, Trp, Ser(AGN), and Ser(UCN)] are highly conserved in regard to primary structure (mean, 92.1%; range, 86.298.5%; Table 2) and their potential to fold into secondary structures with features characteristic of mt-tRNAs (Figure 2). Compared with the M. edulis sequences, the M. californianus sequences have an average of only 4.5 nucleotide substitutions (range 19), 0.4 nucleotide deletions (range 01), and 0.3 nucleotide insertions (range 02; Table 2). These data clearly support the interpretation of each of these sequences as an mt-tRNA gene. The tRNASer(UCN) gene, located between the COIII and tRNAMet(AUA) genes, contains an 8 nucleotide (nt)-loop that replaces the DHU arm. A similar secondary structure is predicted for the tRNASer(AGN) gene (Figure 2). Although a similarly located sequence [between the COIII and tRNAMet(AUA) genes] in M. edulis mtDNA was noted to have stable secondary structure potential, it was not identified as a tRNASer(UCN) gene by ![]()
C arm and the 3' strand of the aminoacyl stem are not colinear in the mt-tRNA-like structures of the two species. Also, relative to the sequence contained in the M. californianus tRNA-like structure, there are 23 nucleotide substitutions in the corresponding M. edulis sequence. This degree of divergence contrasts with the highly conserved sequences of the other eight mt-tRNA genes of the two species (mean divergence = 5.1 nucleotides/tRNA; Figure 2, Table 2) and strongly supports the interpretation of this region of the two mt-tRNAs as a pseudogene that we designate
tRNASer(UCN).
|
Experiments were carried out to test for the presence in M. californianus mitochondria of RNAs corresponding to the tRNASer(UCN), tRNASer(AGN), tRNATrp, and tRNAPro genes and the
tRNASer(UCN) sequence. Oligonucleotides complementary to each of these genes and the
tRNASer(UCN) sequence (Figure 2) were synthesized, 32P-labeled, and hybridized to a nitrocellulose blot of whole mtRNA that had been electrophoresed in a 3% denaturing agarose gel. Examination of an autoradiograph of the product (Figure 3) revealed that the probes for each of the tRNA genes, but not that for the
tRNASer(UCN) sequence, had hybridized to an RNA of an approximate size (70 nt) expected for a tRNA. In contrast, the
tRNASer(UCN) probe hybridized to RNA molecules averaging ~2500 nt, indicating that although the
tRNASer(UCN) sequence is transcribed, it is rarely or never processed into a tRNA-sized molecule.
|
Two further Northern hybridization experiments were carried out to determine the absolute sizes of the various M. californianus mt-tRNAs. Both experiments involved hybridizing 32P-labeled tRNA gene-specific oligonucleotides (Figure 2) to blots of mtRNA electrophoretically separated on 15% acrylamide gels (![]()
|
tRNASer(UCN)-containing transcripts:
The observation that an oligonucleotide complementary to the
tRNASer(UCN) gene sequence hybridized only to RNAs of ~2500 nt indicates that the
tRNASer(UCN) transcript remains linked to a transcript that includes the downstream COI gene and/or the upstream ND3 gene. To resolve the relationship of the
tRNASer(UCN) transcript and adjacent gene transcripts, Northern blot hybridizations were carried out using M. californianus whole mtRNA and probes consisting of an oligonucleotide complementary to the 3' end of the ND3 gene (F3, Figure 2 and Figure 5A), an oligonucleotide complementary to the
tRNASer(UCN) gene (F5, Figure 2 and Figure 5A), and an oligonucleotide complementary to the 5' end region of the COI gene (F4, Figure 2 and Figure 5A). The results are shown in Figure 5B. The ND3 probe hybridized to a single band of RNA of ~350 nt, the size (351 nt) expected for an RNA containing only a transcript of this gene. However, the
tRNASer(UCN) probe and the COI probe both hybridized to RNA of ~2400 nt. Therefore, these data indicate that transcripts of the
tRNASer (UCN) sequence and the COI gene, and probably the downstream ATPase6 gene (assuming identical gene order in this region of M. californianus and M. edulis mtDNAs), are contained in the same RNA molecule.
|
5' RACE analysis was used to locate the 5' terminus of the M. californianus COI gene-containing transcript. cDNAs were generated from whole mtRNA using random hexamers and reverse transcriptase. A poly(A) sequence was added to the 3' end of the cDNAs using terminal deoxynucleotidyl transferase, and cDNA complementary strands were synthesized from a 35-nt primer (TB 17-1) containing a 19-nt sequence that includes BglII, BamHI, and PstI sites followed by 16 T's (![]()
|
These data indicate that the entire
tRNASer(UCN) transcript [which is separated from the 5' terminus of the COI gene by 126 nt (Figure 1 and Figure 5A)] remains linked to the COI transcript. The finding that the 5' end of the COI-gene-containing transcript is 81 nt upstream from the 5' end of the
tRNASer(UCN) sequence makes it unlikely that there has been selection for retention of the tRNASer(UCN) sequence so that its secondary structure can act as a transcript processing site, a role suggested for interprotein gene tRNA sequences in mammalian multicistronic mtDNA transcripts (![]()
![]()
![]()
![]()
![]()
tRNASer(UCN) genes and the sequence between the
tRNASer(UCN) and COI genes in M. edulis mtDNA, but they concluded that the secondary structure of the first of these sequences was nonsignificant.
|
| CONCLUDING REMARKS |
|---|
In metazoan mtDNAs, although most adjacent genes are separated by few or no nucleotides, there is a single region of apparently noncoding nucleotides that varies in size between 125 ntp and ~8000 ntp. As this region in both mammalian and Drosophila mtDNAs has been shown to contain the molecule's replication origin, and also in mammalian mtDNAs to contain promoters for transcription of multicistronic RNAs, it has been designated the control region (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
The single functional tRNASer(UCN) gene of the two Mytilus species appears to be a 63-nt sequence located between the COIII and tRNAMet(AUA) genes, which encodes a highly conserved DHU-replacement loop-containing tRNA. The interrelationship of the functional tRNASer(UCN) gene and the
tRNASer(UCN) gene remains unclear. Sequence comparisons do not suggest that one is a duplicate of the other. As there is considerable divergence between the M. californianus and M. edulis mt-
tRNASer(UCN) gene sequences it remains possible that these sequences are the remnants of a gene for a tRNA other than one that recognizes UCN codons. However, this is not supported by sequence comparisons to other M. edulis mt-tRNA genes. It has been suggested that the tRNASer(UCN) genes of the gastropods Euhadra herklotsi and Cepaea nemoralis (but not Albineria coerulea), the polyplacophoran mollusk Katherina tunicata, and the annelid Lumbricus terrestris encode DHU arm-replacement loop-containing structures (![]()
![]()
![]()
![]()
![]()
C stems, 3/5 ntp in the anticodon stems, and 7/7 nt in the anticodon loops.
The mt-tRNASer(UCN) genes of arthropods, echinoderms, and chordates so far examined encode a four-armed tRNA and the primary sequences of these tRNAs of the latter two phyla are close to those of standard tRNAs. However, as in mtDNAs of mollusks and an annelid, genes for tRNAs expected to recognize UCN codons that have a DHU arm-replacement loop have also been found in nematode mtDNAs (![]()
![]()
![]()
![]()
![]()
The mtDNA sequence interpreted by ![]()
![]()
![]()
![]()
![]()
It is uncertain why Mytilus alone among Metzoa examined to date should utilize two tRNAs to recognize methionine codons. In M. edulis, the tRNAMet(AUG) would be expected to recognize the AUG initiation codons of 10 of the 12 mt-protein genes and internal AUG codons. In regard to its initiation function it is noteworthy that the predicted tRNA would have three consecutive G-C base pairs at the base of the anticodon stem. This is a characteristic feature of the E. coli initiator tRNAMet and it has been shown that these three G-C base pairs are essential to initiation function (![]()
![]()
![]()
![]()
![]()
| FOOTNOTES |
|---|
1 Present address: Department of Poultry Science, University of Arkansas, Fayetteville, AK 72701. ![]()
| ACKNOWLEDGMENTS |
|---|
We thank Jane L. Macfarlane for excellent technical assistance and for discussions, and Robert Schackmann for oligonucleotides [partially subsidized by National Institutes of Health (NIH) grant CA-42014]. This work was supported by NIH grant GM-18375.
Manuscript received September 21, 1998; Accepted for publication March 5, 1999.
| LITERATURE CITED |
|---|
ANDERSON, S., A. T. BANKIER, B. G. BARRELL, M. H. L. DEBRUIJN, A. R. COULSON et al., 1982 Comparison of the human and bovine mitochondrial genomes, pp. 543 in Mitochondrial Genes, edited by P. SLONIMSKI, P. BORST and G. ATTARDI. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
ARNASON, U., X. XU, and A. GULLBERG, 1996 Comparison between the complete mitochondrial DNA sequences of Homo and the common chimpanzee based on nonchimeric sequences. J. Mol. Evol. 42:145-152[Medline].
ASAKAWA, S., H. HIMENO, K.-I. MIURA, and K. WATANABE, 1995 Nucleotide sequence and gene organization of the starfish Asterina pectinifera mitochondrial genome. Genetics 140:1047-1060[Abstract].
BEAGLEY, C. T., J. L. MACFARLANE, G. A. PONT-KINGDON, R. OKIMOTO, N. A. OKADA et al., 1995 Mitochondrial genomes of Anthozoa (Cnidaria), pp. 149153 in Progress in Cell Research: Symposium on "Thirty Years of Progress in Mitochondrial Bioenergetics and Molecular Biology," edited by F. PALMIERI, S. PAPA, C. SACCONE and N. GADALETA. Elsevier Science BV, Amsterdam, The Netherlands.
BEAGLEY, C. T., N. A. OKADA, and D. R. WOLSTENHOLME, 1996 Two mitochondrial group I introns in a metazoan, the sea anemone Metridium senile: one intron contains genes for subunits 1 and 3 of NADH dehydrogenase. Proc. Natl. Acad. Sci. USA 93:5619-5623
BEAGLEY, C. T., K. A. TAYLOR, and D. R. WOLSTENHOLME, 1997 Gender-associated diverse mitochondrial DNA molecules of the mussel Mytilus californianus.. Curr. Genet. 31:318-324[Medline].
BEAGLEY, C. T., R. OKIMOTO, and D. R. WOLSTENHOLME, 1998 The mitochondrial genome of the sea anemone Metridium senile (Cnidaria): introns, a paucity of tRNA genes, and a near standard genetic code. Genetics 148:1091-1108
BIBB, M. J., R. A. VAN ETTEN, C. T. WRIGHT, M. W. WALBERG, and D. A. CLAYTON, 1981 Sequence and gene organization of mouse mitochondrial DNA. Cell 26:167-180[Medline].
BOORE, J. L. and W. M. BROWN, 1994 Complete DNA sequence of the mitochondrial genome of the black chiton Katharina tunicata.. Genetics 138:423-443[Abstract].
BOORE, J. L. and W. M. BROWN, 1995 Complete sequence of the mitochondrial DNA of the annelid worm Lumbricus terrestris.. Genetics 141:305-319[Abstract].
BROWN, G. G. and M. V. SIMPSON, 1982 Novel features of animal mtDNA evolution as shown by sequences of two rat cytochrome oxidase subunit II genes. Proc. Natl. Acad. Sci. USA 79:3246-3250
BROWN, W. M., E. M. PRAGER, and W. A. WILSON, 1982 Mitochondrial DNA sequences of primates: tempo and mode of evolution. J. Mol. Evol. 18:225-239[Medline].
CANTATORE, P., M. ROBERTI, G. RAINALDI, M. N. GADALETA, and C. SACCONE, 1989 The complete nucleotide sequence, gene organization, and genetic code of mitochondrial genome of Paracentrotus lividus.. J. Biol. Chem. 264:10965-10975
CLARY, D. O. and D. R. WOLSTENHOLME, 1985 The mitochondrial DNA molecule of Drosophila yakuba: nucleotide sequence, gene organization, and genetic code. J. Mol. Evol. 22:252-271[Medline].
CLARY, D. O., J. M. GODDARD, S. C. MARTIN, C. M-R. FAURON, and D. R. WOLSTENHOLME, 1982 Drosophila mitochondrial DNA: a novel gene order. Nucleic Acids Res. 10:6619-6637
CLAYTON, D. A., 1982 Replication of animal mitochondrial DNA. Cell 28:693-705[Medline].
CLAYTON, D. A., 1992 Transcription and replication of animal mitochondrial DNAs, pp. 217232 in International Review of Cytology, Vol. 141, edited by D. R. WOLSTENHOLME and K. W. JEON. Academic Press, New York.
CROZIER, R. H. and Y. C. CROZIER, 1993 The mitochondrial genome of the honey bee Apis melifera: complete sequence and genome organization. Genetics 133:97-117[Abstract].
DALE, R. M. K., B. MCCLURE, and J. P. HOUGHINS, 1985 A rapid single-stranded cloning strategy for producing overlapping clones for use in DNA sequencing: application to sequencing the corn mitochondrial 18S rDNA. Plasmid 13:31-40[Medline].
DESALLE, R., T. FREEDMAN, E. M. PRAGER, and A. C. WILSON, 1987 Tempo and mode of sequence evolution in mitochondrial DNA of Hawaiian Drosophila.. J. Mol. Evol. 26:157-164[Medline].
FISHER, C., and D. O. F. SKIBINSKI, 1990 Sex-biased mitochondrial DNA heteroplasmy in the marine mussel Mytilus. Proc. R. Soc. Lond. Ser B 149156.
FREIER, S. M., R. KIERZEK, J. A. JAEGER, N. SUGIMOTO, and M. H. CARUTHERS et al., 1986 Improved free-energy parameters for predictions of RNA duplex stability. Proc. Natl. Acad. Sci. USA 83:9373-9377
FROHMAN, M. A., 1990 RACE: rapid amplification of cDNA ends, pp.2838 in PCR Protocols, a Guide to Methods and Applications, edited by M. A. INNIS, D. H. GELFAND, J. J. SNINSKY and T. J. WHITE. Academic Press, San Diego.
GAREY, J. R. and D. R. WOLSTENHOLME, 1989 Platyhelminth mitochondrial DNA: evidence for early evolutionary origin of a tRNA-ser(AGN) that contains a dihydrouridine arm replacement-loop, and of serine-specifying AGA and AGG codons. J. Mol. Evol. 28:374-387[Medline].
HATZOGLOU, E., G. C. RODAKIS, and R. LECANIDOU, 1995 Complete sequence and gene organization of the mitochondrial genome of the land snail Albinaria coerulea.. Genetics 140:1353-1366[Abstract].
HOFFMANN, R. J., J. L. BOORE, and W. M. BROWN, 1992 A novel mitochondrial genome organization for the blue mussell, Mytilus edulis.. Genetics 131:397-412[Abstract].
HYMAN, B. C., J. L. BECK, and K. C. WEISS, 1988 Sequence amplification and gene rearrangement in parasitic nematode mitochondrial DNA. Genetics 120:707-712
JACOBS, H. T., D. J. ELLIOT, V. B. MATH, and A. FARQUHARSON, 1988 Nucleotide sequence and gene organization of sea urchin mitochondrial DNA. J. Mol. Biol. 202:185-217[Medline].
KRETTEK, A., A. GULLBERG, and U. ARNASON, 1995 Sequence analysis of the complete mitochondrial DNA molecule of the hedgehog, Erinaceus europaeus, and the phylogenetic position of the Lipotyphla. J. Mol. Evol. 441:952-957.
MONTOYA, J., D. OJALA, and G. ATTARDI, 1981 Distinctive features of the 5' terminal sequences of the human mitochondrial mRNAs. Nature 290:465-470[Medline].
MORITZ, C., 1991 Evolutionary dynamics of mitochondrial DNA duplication in parthenogenetic geckos, Heteronotia binoei.. Genetics 129:221-230[Abstract].
MORITZ, C. and W. M. BROWN, 1986 Tandem duplication of D-loop and ribosomal RNA sequences in lizard mitochondrial DNA. Science 233:1425-1427
MORITZ, C. and W. M. BROWN, 1987 Tandem duplications in animal mitochondrial DNAs: variation in incidence and gene content among lizards. Proc. Natl. Acad. Sci. USA 84:7183-7187
NIELSEN, C., 1995 Animal Evolution: Interrelationships of Living Phyla. Oxford University Press, Oxford.
OJALA, D., J. MONTOYA, and G. ATTARDI, 1981 tRNA punctuation model of RNA processing in human mitochondria. Nature 290:470-474[Medline].
OKIMOTO, R. and D. R. WOLSTENHOLME, 1990 A set of tRNAs that lack either the T
C arm or the dihydrouridine arm: towards a minimal tRNA adaptor. EMBO J. 9:3405-3411[Medline].
OKIMOTO, R., H. M. CHAMBERLIN, J. L. MACFARLANE, and D. R. WOLSTENHOLME, 1991 Repeated sequence sets in mitochondrial DNA molecules of root knot nematodes (Meloidogyne): nucleotide sequences, genome location and potential for host-race identification. Nucleic Acids Res. 19:1619-1626
OKIMOTO, R., J. L. MACFARLANE, and D. R. WOLSTENHOLME, 1992 The mitochondrial genomes of two nematodes, Caenorhabditis elegans and Ascaris suum.. Genetics 130:471-498[Abstract].
PONT-KINGDON, G. A., C. T. BEAGLEY, R. OKIMOTO, and D. R. WOLSTENHOLME, 1994 Mitochondrial DNA of the sea anemone, Metridium senile (Cnidaria): prokaryote-like genes for tRNAf-Met and small subunit ribosomal RNA, and standard genetic code specificities for AGR and ATA codons. J. Mol. Evol. 39:387-399[Medline].
RAJBHANDARY, U., and M. C. CHOW, 1995 Initiator tRNAs and initiation of protein synthesis, pp. 511528 in tRNA Structure, Biosynthesis and Function, edited by D. SÖLL and U. RAJBHANDARY. American Society of Microbiology, Washington, DC.
SANGER, F., S. NICKLEN, and A. R. COULSON, 1977 DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463-5467
SHADEL, G. S. and D. A. CLAYTON, 1997 Mitochondrial DNA maintenance in vertebrates. Annu. Rev. Biochem. 66:409-435[Medline].
SKIBINSKI, D. O. F., C. GALLAGHER, and C. M. BEYNON, 1994a Mitochondrial DNA inheritance. Nature 368:817-818[Medline].
SKIBINSKI, D. O. F., C. GALLAGHER, and C. M. BEYNON, 1994b Sex-limited mitochondrial DNA transmission in the marine mussel Mytilus edulis.. Genetics 138:801-809[Abstract].
TERRETT, J. A., S. MILES, and R. H. THOMAS, 1996 Complete DNA sequence of the mitochondrial genome of Cepaea nemoralis (Gastropoda: Pulmonata). J. Mol. Evol. 242:160-168.
WAHLEITHNER, J. A. and D. R. WOLSTENHOLME, 1987 Mitochondrial plasmid DNAs of broad bean: nucleotide sequences, complex secondary structures, and transcription. Curr. Genet. 12:55-67[Medline].
WALLIS, M. J., 1987 Mitochondrial DNA insertion polymorphism and germline heteroplasmy in the Triturus cristatus complex. Heredity 58:229-238.
WILSON, E. O., T. EISNER, W. R. BRIGTS, R. E. DICKERSON, R. L. METZENBERG et al., 1978 Life on Earth, Ed. 2. Sinauer, Sunderland, Mass.
WOLSTENHOLME, D. R., 1992a Animal mitochondrial DNA: structure and evolution, pp. 173&






