- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Aguadé, M.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Aguadé, M.
Positive Selection Drives the Evolution of the Acp29AB Accessory Gland Protein in Drosophila
Montserrat Aguadéaa Departament de Genètica, Facultat de Biologia, Universitat de Barcelona, 08071 Barcelona, Spain
Corresponding author: Montserrat Aguadé, Facultat de Biologia, Universitat de Barcelona, Diagonal 645, 08071 Barcelona, Spain., aguade{at}porthos.bio.ub.es (E-mail)
Communicating editor: A. G. CLARK
| ABSTRACT |
|---|
Nucleotide sequence variation at the Acp29AB gene region has been surveyed in Drosophila melanogaster from Spain (12 lines), Ivory Coast (14 lines), and Malawi (13 lines) and in one line of D. simulans. The ~1.7-kb region studied encompasses the Acp29AB gene that codes for a male accessory gland protein and its flanking regions. Seventy-seven nucleotide and 8 length polymorphisms were detected. Nonsynonymous polymorphism was an order of magnitude lower than synonymous polymorphism, but still high relative to other non-sex-related genes. In D. melanogaster variation at this region revealed no major genetic differentiation between East and West African populations, while differentiation was highly significant between the European and the two African populations. Comparison of polymorphism and divergence at synonymous and nonsynonymous sites showed an excess of fixed nonsynonymous changes, which indicates that the evolution of the Acp29AB protein has been driven by directional selection at least after the split of the D. melanogaster and D. simulans lineages. The pattern of variation in extant populations of D. melanogaster favors a scenario where the fixation of advantageous replacement substitutions occurred in the early stages of speciation and balancing selection is maintaining variation in this species.
A ratio of nonsynonymous to synonymous divergence (Ka/Ks) significantly higher than one has been considered good evidence of positive selection driving protein evolution. The first genes for which such a pattern was found were those encoding proteins that mediate self vs. nonself recognition, such as some genes of the major histocompatibility complex (MHC) in mammals (![]()
![]()
![]()
![]()
![]()
In Drosophila some proteins involved in sexual reproduction, such as those mediating gamete recognition or sperm competition, seem to evolve relatively rapidly. ![]()
![]()
![]()
![]()
Comparison of polymorphism and divergence at nonsynonymous and synonymous sites (![]()
![]()
![]()
![]()
![]()
![]()
![]()
In the present study nucleotide polymorphism and divergence have been analyzed at the Acp29AB gene (![]()
![]()
![]()
The ~1.7-kb region studied includes the previously sequenced Acp29AB gene (![]()
![]()
| MATERIALS AND METHODS |
|---|
Drosophila stocks:
Twelve isofemale lines collected in Montblanc (Spain) in 1993 were isogenized for the second chromosome upon arrival in the laboratory by the corresponding series of crosses with a balancer stock. A subsample of 14 lines from Lamto (Ivory Coast) and 13 lines from Malawi, kindly provided by M. Veuille and V. Bénassi (see ![]()
![]()
![]()
DNA extraction, PCR amplification, and sequencing:
DNA from the mst319.5 plasmid that includes the Acp29AB gene (![]()
![]()
Primers T3 and T7 from the pBluescript (Stratagene, La Jolla, CA) vector polylinker were used to amplify by PCR the insert of plasmid mst319.5 (![]()
For each of the D. melanogaster lines, 20-nucleotide-long primers (5'AAAGAAGATGCCCTGGGATA3' and 5'GATGGCCGAGAGCAGAAGTT3') were used to amplify by PCR an ~1.8-kb region encompassing the Acp29AB gene and its 5' and 3' flanking regions. Primers (17 nucleotides long) spaced on average 350 nucleotides were used to sequence the purified PCR products as described above. The D. melanogaster primers were used to amplify by PCR the homologous region of D. simulans; in this case, however, the ~1.8-kb region was amplified in two overlapping fragments. The sequences newly reported in this article have been deposited in the EMBL sequence database library under accession nos. AJ240513AJ240552.
Sequence analysis:
The SeqEd program (Perkin-Elmer) was used to assemble and align the sequences and also to check all variable sites. The MacClade version 3.0.6 program was used to edit the sequences for further analyses (![]()
![]()
| RESULTS |
|---|
Sequencing of the 5' and 3' flanking regions of the Acp29AB gene:
Sequencing of the 5' flanking region revealed that the Acp29AB gene lacks a consensus TATA box. Also, the promoter region of this gene did not present either the decamer (AATGCAAAAT) or the octamer (ATTGCAAT) motifs described for other genes expressed in male accessory glands (![]()
![]()
Nucleotide polymorphism:
In the Ivory Coast population, unlike in the other two studied populations, the In(2L)t inversion is present at a very high frequency (73% as reported in ![]()
![]()
![]()
Figure 1 summarizes the distribution of nucleotide sequence variation in the 1664-nucleotide region studied (excluding alignment gaps), including only 244 nucleotides of the detected 3' open reading frame. A total of 77 nucleotide and 8 length polymorphisms were detected. All length polymorphisms (not shown) were in noncoding regions. Four of these polymorphisms were single-base indels associated with runs of at least eight T's or eight A's and could be an artefact of the Taq polymerase; however, no such variation was detected in two similar runs of A's present in the coding region. Two other single-base indels can be considered part of complex mutations: TAAT to GAGTG and GTT to TAAA, starting at positions -117 and -71, respectively. The remaining two indels were 11 (see DISCUSSION) and 3 bp long.
|
Table 1 gives the estimates of nucleotide variation for the whole region studied and for its different functional parts. The level of synonymous variation was generally higher than that of silent variation in the flanking regions. Nonsynonymous variation was an order of magnitude lower than synonymous variation, but still rather high as compared to that in other genes whose expression is not sex-related (![]()
![]()
![]()
|
Population differentiation as revealed by variation at the Acp29AB region was analyzed, considering the complete region and its different functional parts (Table 2). The comparison between the two African populations showed the lowest Fst estimates, and although there was generally marginal statistical significance, in one case there was greater statistical support for differentiation (P = 0.014). However, the sample from Montblanc showed in all cases a significant differentiation from the African samples.
|
The Acp29AB gene is located in a region of high recombination (![]()
![]()
2 test were 28, 16, and 8% for Montblanc, Lamto, and Malawi, respectively. Only in the sample from Montblanc was there some clustering of linkage disequilibria.
Silent nucleotide polymorphism and divergence:
Table 1 gives a summary of silent and/or synonymous nucleotide divergence. As in the case of polymorphism, the highest estimate corresponds to synonymous divergence and the lowest to the 3' flanking region. As shown in Figure 2, levels of silent polymorphism and divergence seem to vary concordantly along the region studied. The Hudson, Kreitman, and Aguadé (HKA) test (![]()
![]()
![]()
|
Amino acid replacement polymorphism and divergence:
Six replacement polymorphisms were detected in the Acp26AB protein (Figure 3). Three polymorphisms (at residues 59, 113, and 153) segregated in the three populations. Although they were all present at intermediate frequencies in the combined sample, only the two variants at residue 153 (Met/Lys) were present at similar frequencies in the three population samples: 0.33, 0.29, and 0.38 for the less frequent variant in Montblanc, Lamto, and Malawi, respectively. The two putative glycosylation sites (![]()
![]()
|
According to neutral predictions the ratio of nonsynonymous to synonymous changes should be the same within and between species. The McDonald and Kreitman (MK) test (![]()
|
| DISCUSSION |
|---|
Nucleotide polymorphism and divergence:
As in previous studies of nucleotide variation that included African samples of D. melanogaster (![]()
![]()
![]()
![]()
![]()
![]()
The levels of silent polymorphism and divergence vary along the region studied (Figure 2). As reported for other genes, variation at synonymous sites of the Acp29AB gene was higher than in its flanking regions, which indicates stronger selective constraints in those regions. The 3' flanking region showed the lowest estimates even when only the 185 nucleotides between the Acp29AB coding region and the detected open reading frame were considered:
= 0.0072 and K = 0.103. If this open reading frame was a functional gene, the intergenic region would not only contain the Acp29AB trailer but also some regulatory sequences of this new gene, which would also contribute to constraining variation at this region.
Nucleotide sequence variation and function:
Although function can only be established experimentally, studies of nucleotide sequence variation have been often used to implicate selection and functional constraint. Generally, those studies have involved comparison of distantly related species, and the presence of highly conserved sequences has been considered an indication of functional constraint and, therefore, of purifying selection acting on those regions. Here, we have compared sequences from the same species and from a very closely related species. Consequently, our approach was different, and we looked specifically for variation at putative functional sequences. Figure 4 shows three different sequences of the Acp29AB trailer region found in our survey. D. melanogaster populations segregate for an 11-bp deletion that includes the previously described polyadenylation signal (![]()
![]()
|
Some amino acid replacement changes affect putative peptidase cleavage sites both within and between species. Corresponding to the sites segregating in D. melanogaster (at residues 29 and 113), D. simulans has the less frequent variant in D. melanogaster, which at residue 29 is characterized by the loss of a peptidase cleavage sequence. In the case of residue 29, the loss-of-site variant is present only once in the sample from Malawi. In contrast, at residue 113 it segregates in all three populations and in the complete sample it is present at high frequency (61.5%). As D. simulans has lost the putative cleavage site at residue 112, it is tempting to speculate that in this species the cleavage site at residue 113 might be functional. On the other hand, in D. melanogaster the gain of function at residue 112 might compensate for the loss-of-function variant segregating at residue 113. Also, two of the changes fixed between species might be compensatory. In fact, in both D. melanogaster and D. simulans there is one additional but different putative cleavage site close to the conserved sites at residues 202 and 203: at residue 204 in D. melanogaster and at residue 201 in D. simulans. If these additional sites were functional and sites 202 and 203 were not, the loss in D. simulans of site 204 might compensate the gain of site 201.
Nonsynonymous variation and selection:
Unlike the case of the Acp26Aa gene where the Ka/Ks ratio was close to one in the D. melanogaster vs. D. simulans comparison, for the Acp29AB gene this ratio is lower than one. This would indicate that Acp29AB, like Acp26Ab and Acp70A, has more constraints on its variation than Acp26Aa. However, in the case of the Acp29AB gene the Ka/Ks ratio was threefold higher than the
a/
s ratio for the complete data set 0.327 and 0.09, respectively. As previously mentioned (see RESULTS), if variation in this region were neutral, one would expect this ratio to be the same. Meanwhile, the fixation of advantageous amino acid replacement changes would cause a deviation of this ratio from constancy due to a higher than expected nonsynonymous divergence. Similarly to synonymous polymorphism, the estimated synonymous divergence (Ks) between D. melanogaster and D. simulans lies on the upper part of the range of estimates for other genes, which indicates that the deviation from a constant ratio is due to a higher than expected nonsynonymous divergence (Ka). In fact, application of the MK test to the different populations surveyed and to the complete D. melanogaster sample revealed a significant or marginally significant excess of nonsynonymous fixed differences between D. melanogaster and D. simulans (Table 3). This indicates that at least after the split of the D. melanogaster and D. simulans lineages the evolution of the Acp29AB protein was driven by directional selection.
The Acp29AB gene is not, however, depauperate of genetic variation as would be expected a priori for a region having suffered the fixation of advantageous amino acid replacements. Different scenarios would be compatible with this observation. If as proposed by ![]()
![]()
![]()
![]()
There is one last scenario to be discussed, which complements the scenario proposed by ![]()
![]()
![]()
![]()
![]()
![]()
The possible involvement of Acp29AB in sperm displacement will have to be assessed by functional studies. If variation at this protein affected this or some other component of fitness, any of the three amino acid replacement polymorphisms that segregate in the three populations surveyed might be candidates for being the targets of selection. It is easy to speculate how changes in those residues might affect the function of the Acp29AB protein and, therefore, contribute to the detected differences of fitness. For example, residues 131214 in the C-terminal part of the Acp29AB protein show similarity at the primary sequence and predicted tertiary structure levels with carbohydrate recognition domains (CRDs; W. SWANSON, personal communication). Two of the amino acids reported here as variable, residues 153 and 214, would map within this CRD. Perhaps changes at these positions are functionally important, modifying the CRD's carbohydrate recognition specificity. Interestingly, variants at residue 153 segregate at rather similar frequencies in the three populations, which might also suggest that this residue is a candidate for contributing to putative fitness differences.
If selection were acting to maintain an amino acid polymorphism, one would expect that variants surrounding that site were at linkage disequilibrium. Also, if selection were maintaining the same alleles in the whole distribution area of the species, the same clustering of linkage disequilibria would be expected in the different populations surveyed. However, the extent of the region exhibiting linkage disequilibrium might be rather short in a region of high recombination like the Acp29AB region (see above). This, together with the distribution of polymorphisms, might have hindered the detection of linkage disequilibrium in all three populations. Balancing selection leaves a characteristic footprint at linked neutral sites, causing a deviation in the frequency spectrum toward an excess of polymorphic sites with variants at intermediate frequencies. Also, an excess of synonymous polymorphism is expected to result from an old balanced polymorphism. Neither the HKA test nor the McDonald heterogeneity tests detected any excess of synonymous polymorphism in the Acp29AB coding region. The Tajima test and the Fu and Li tests, which contrast the frequency and distribution of variants, respectively, did not detect any deviation from neutral expectations when the whole region studied was considered. However, the test statistics presented negative nonsignificant values for the two flanking regions, while values for the coding region (both in Lamto and Malawi) were positive and in some cases significantly different from zero, an indication of variants maintained at intermediate frequencies. The scenario that combines positive selection at the early stages of speciation and balancing selection (either overdominant selection or frequency-dependent selection) would better explain most of the characteristics revealed by the present data on nucleotide variation at the Acp29AB region in conjunction with those by ![]()
All Acp genes surveyed to date for nucleotide variation in populations of D. melanogaster (Acp26Aa and Acp26Ab, ![]()
![]()
![]()
![]()
![]()
| ACKNOWLEDGMENTS |
|---|
I thank Michel Veuille and Véronique Bénassi for the African lines and for sharing unpublished information on the chromosomal polymorphism of these lines, Julio Rozas for sharing version 2.92 of the DnaSP program, W. Swanson for comments on the manuscript and for sharing unpublished results, the Bowling Green Stock Center for the Df(2L)TE29Aa-11/CyO line, and Serveis Científico-Tècnics from Universitat de Barcelona for automated sequencing facilities. Special thanks are given to M. F. Wolfner for the mst319.5 plasmid and for sharing the Acp29AB gene sequence before publication, but mainly for her insightful comments on the manuscript; and to D. Salguero for his excellent technical assistance. This work was supported by grants PB94-0923 from Dirección General de Investigación Científica y Técnica, Spain, and 1997SGR-59 from Comissió Interdepartamental de Recerca i Tecnologia, Generalitat de Catalunya.
Manuscript received November 10, 1998; Accepted for publication February 22, 1999.
| LITERATURE CITED |
|---|
AGUADÉ, M., 1998 Different forces drive the evolution of the Acp26Aa and Acp26Ab genes in the melanogaster species complex. Genetics 150:1079-1089
AGUADÉ, M., N. MIYASHITA, and C. H. LANGLEY, 1992 Polymorphism and divergence in the Mst26A male accessory gland gene region in Drosophila. Genetics 132:755-770[Abstract].
ASHBURNER, M., 1989 Drosophila, A Laboratory Handbook. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
BEGUN, D. J. and C. F. AQUADRO, 1993 African and North American populations of Drosophila melanogaster are very different at the DNA level. Nature 356:519-520.
BEGUN, D. J. and C. F. AQUADRO, 1995 Molecular variation at the vermillion locus in geographically diverse populations of Drosophila melanogaster and D. simulans.. Genetics 140:1019-1032[Abstract].
BÉNASSI, V. and M. VEUILLE, 1995 Comparative population structuring of molecular and allozyme variation of Drosophila melanogaster Adh between Europe, West Africa and East Africa. Genet. Res. 65:95-103[Medline].
BÉNASSI, V., S. AULARD, S. MAZEAU, and M. VEUILLE, 1993 Molecular variation of Adh and P6 genes in African populations of Drosophila melanogaster and its relation to chromosomal inversions. Genetics 134:789-799[Abstract].
BERRY, A. and M. KREITMAN, 1993 Molecular analysis of an allozyme cline: alcohol dehydrogenase in Drosophila melanogaster on the east coast of North America. Genetics 134:869-893[Abstract].
CIRERA, S. and M. AGUADÉ, 1997 Evolutionary history of the sex-peptide (Acp70A) gene region in Drosophila melanogaster.. Genetics 147:189-197[Abstract].
CIVETTA, A. and R. S. SINGH, 1998 Sex-related genes, directional sexual selection, and speciation. Mol. Biol. Evol. 15:901-909[Abstract].
CLARK, A. G. and T.-U. KAO, 1991 Excess nonsynonymous substitutions at shared sites among self-incompatibility alleles of Solanaceae. Proc. Natl. Acad. Sci. USA 88:9823-9827
CLARK, A. G., M. AGUADÉ, T. PROUT, L. HARSHMAN, and C. H. LANGLEY, 1995 Variation in sperm displacement and its association with accessory gland protein loci in Drosophila melanogaster.. Genetics 139:189-201[Abstract].
DIBENEDETTO, A. J., H. A. HARADA, and M. F. WOLFNER, 1990 Structure, cell specific expression, and mating-induced regulation of a Drosophila melanogaster male accessory gland gene. Dev. Biol. 139:134-148[Medline].
EANES, W. F., M. KIRCHNER, J. YOON, C. H. BIERMANN, and I-N. WANG et al., 1996 Historical selection, amino acid polymorphism and lineage-specific divergence at the G6pd locus in Drosophila melanogaster and D. simulans.. Genetics 144:1027-1041[Abstract].
FU, Y. X. and W-S. LI, 1993 Statistical tests of neutrality of mutations. Genetics 133:693-709[Abstract].
HERNDORN, L. A. and M. F. WOLFNER, 1995 A Drosophila seminal fluid protein, Acp26Aa, stimulates egg-laying in females for one day after mating. Proc. Natl. Acad. Sci. USA 92:10114-10118
HUDSON, R. R. and N. L. KAPLAN, 1985 Statistical properties of the number of recombination events in the history of a sample of DNA sequences. Genetics 111:147-164
HUDSON, R. R., M. KREITMAN, and M. AGUADÉ, 1987 A test of neutral molecular evolution based on nucleotide data. Genetics 116:153-159
HUDSON, R. R., M. SLATKIN, and W. P. MADDISON, 1992a Estimation of levels of gene flow from DNA sequence data. Genetics 132:583-589[Abstract].
HUDSON, R. R., D. D. BOOS, and N. L. KAPLAN, 1992b A statistical test for detecting geographic subdivision. Mol. Biol. Evol. 9:138-151[Abstract].
HUGHES, A. L. and M. NEI, 1988 Pattern of nucleotide substitution at major histocompatibility complex class I loci reveals overdominant selection. Nature 335:167-170[Medline].
HUGHES, A. L. and M. NEI, 1990 Positive darwinian selection promotes charge profile diversity in the antigen-binding cleft of Class I major-histocompatibility-complex molecules. Mol. Biol. Evol. 7:515-524[Abstract].
JUKES, T. H., and C. R. CANTOR, 1969 Evolution of protein molecules, pp. 21120 in Mammalian Protein Metabolism, edited by H. M. MUNRO. Academic Press, New York.
KAROTAM, J., A. C. DELVES, and J. G. OAKESHOTT, 1993 Conservation and change in structural and 5' flanking sequences of esterase 6 in sibling species of Drosophila. Genetica 88:11-28[Medline].
KLIMAN, R. M. and J. HEY, 1993 Reduced natural selection associated with low recombination in Drosophila melanogaster.. Mol. Biol. Evol. 10:1239-1258[Abstract].
KREITMAN, M. and M. AGUADÉ, 1986 Excess polymorphism at the Adh locus in Drosophila melanogaster.. Genetics 114:93-110
KREITMAN, M. and R. R. HUDSON, 1991 Inferring the evolutionary histories of the Adh and Adh-dup loci in Drosophila melanogaster from patterns of polymorphism and divergence. Genetics 127:565-582[Abstract].
LEE, Y. and V. D. VACQUIER, 1995 Positive selection is a general phenomenon in the evolution of abalone sperm lysin. Mol. Biol. Evol. 12:231-238[Abstract].
MADDISON, W. P., and D. R. MADDISON, 1992 MacClade: Analysis of Phylogeny and Character Evolution, version 3.0. Sinauer Associates, Sunderland, MA.
MCDONALD, J. H., 1996 Detecting nonneutral heterogeneity across a region of DNA sequence in the ratio of polymorphism to divergence. Mol. Biol. Evol. 13:253-260[Abstract].
MCDONALD, J. H., 1998 Improved tests for heterogeneity across a region of DNA sequence in the ratio of polymorphism to divergence. Mol. Biol. Evol. 15:377-384[Abstract].
MCDONALD, J. H. and M. KREITMAN, 1991 Adaptative protein evolution at the Adh locus in Drosophila. Nature 351:652-654[Medline].
METZ, E. C. and S. R. PALUMBI, 1996 Positive selection and sequence rearrangements generate extensive polymorphism in the gamete recognition protein bindin. Mol. Biol. Evol. 13:397-406[Abstract].
NEI, M., 1987 Molecular Evolutionary Genetics. Columbia University Press, New York.
ROZAS, J. and R. ROZAS, 1997 DnaSP version 2.0: a novel software package for extensive molecular population genetics analysis. Comput. Appl. Biosci. 13:307-311.
SIMMERL, E., M. SCHAFER, and U. SCHAFER, 1995 Structure and regulation of a gene cluster for male accessory gland transcripts in Drosophila melanogaster.. Insect. Biochem. Mol. Biol. 25:127-137[Medline].
TAJIMA, F., 1989 Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics 123:585-595
TSAUR, S.-H. and C.-I. WU, 1997 Positive selection and the molecular evolution of a gene of male reproduction, Acp26Aa, of Drosophila. Mol. Biol. Evol. 14:544-549[Abstract].
TSAUR, S.-H., C.-T. TING, and C.-I. WU, 1998 Positive selection driving the evolution of a gene of male reproduction, Acp26Aa, of Drosophila. II. Divergence versus polymorphism. Mol. Biol. Evol. 15:1040-1046[Abstract].
VEUILLE, M., V. BÉNASSI, S. AULARD, and F. DEPAULIS, 1998 Allele-specific population structure of Drosophila melanogaster at the molecular level. Genetics 149:971-981
WATTERSON, G. A., 1975 On the number of segregating sites in genetic models without recombination. Theor. Popul. Biol. 7:256-276[Medline].
WOLFNER, M. F., H. A. HARADA, M. J. BERTRAM, T. J. STELICK, and K. W. KRAUS et al., 1997 New genes for male accessory gland proteins in Drosophila melanogaster.. Insect. Biochem. Mol. Biol. 27:825-834[Medline].
This article has been cited by other articles:
![]() |
L. A. McGraw, A. G. Clark, and M. F. Wolfner Post-mating Gene Expression Profiles of Female Drosophila melanogaster in Response to Time and to Four Male Accessory Gland Proteins Genetics, July 1, 2008; 179(3): 1395 - 1408. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Llopart and J. M. Comeron Recurrent Events of Positive Selection in Independent Drosophila Lineages at the Spermatogenesis Gene roughex Genetics, June 1, 2008; 179(2): 1009 - 1020. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Wong, M. C. Turchin, M. F. Wolfner, and C. F. Aquadro Evidence for Positive Selection on Drosophila melanogaster Seminal Fluid Protease Homologs Mol. Biol. Evol., March 1, 2008; 25(3): 497 - 506. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. Dean, J. M. Good, and M. W. Nachman Adaptive Evolution of Proteins Secreted during Sperm Maturation: An Analysis of the Mouse Epididymal Transcriptome Mol. Biol. Evol., February 1, 2008; 25(2): 383 - 392. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Haerty, S. Jagadeeshan, R. J. Kulathinal, A. Wong, K. Ravi Ram, L. K. Sirot, L. Levesque, C. G. Artieri, M. F. Wolfner, A. Civetta, et al. Evolution in the Fast Lane: Rapidly Evolving Sex-Related Genes in Drosophila Genetics, November 1, 2007; 177(3): 1321 - 1335. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. J. Wagstaff and D. J. Begun Adaptive Evolution of Recently Duplicated Accessory Gland Protein Genes in Desert Drosophila Genetics, October 1, 2007; 177(2): 1023 - 1030. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. K. N. Lawniczak and D. J. Begun Molecular population genetics of female-expressed mating-induced serine proteases in Drosophila melanogaster Mol. Biol. Evol., September 1, 2007; 24(9): 1944 - 1951. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. C. Fiumera, B. L. Dumont, and A. G. Clark Associations Between Sperm Competition and Natural Variation in Male Reproductive Genes on the Third Chromosome of Drosophila melanogaster Genetics, June 1, 2007; 176(2): 1245 - 1260. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Sanchez-Gracia and J. Rozas Unusual Pattern of Nucleotide Sequence Variation at the OS-E and OS-F Genomic Regions of Drosophila simulans Genetics, April 1, 2007; 175(4): 1923 - 1935. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Proschel, Z. Zhang, and J. Parsch Widespread Adaptive Evolution of Drosophila Genes With Sex-Biased Expression Genetics, October 1, 2006; 174(2): 893 - 900. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. M. Turner and H. E. Hoekstra Adaptive Evolution of Fertilization Proteins within a Genus: Variation in ZP2 and ZP3 in Deer Mice (Peromyscus) Mol. Biol. Evol., September 1, 2006; 23(9): 1656 - 1669. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Andres, L. S. Maroja, S. M. Bogdanowicz, W. J. Swanson, and R. G. Harrison Molecular Evolution of Seminal Proteins in Field Crickets Mol. Biol. Evol., August 1, 2006; 23(8): 1574 - 1584. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Begun, H. A. Lindfors, M. E. Thompson, and A. K. Holloway Recently Evolved Genes Identified From Drosophila yakuba and D. erecta Accessory Gland Expressed Sequence Tags Genetics, March 1, 2006; 172(3): 1675 - 1681. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. J. Wagstaff and D. J. Begun Molecular Population Genetics of Accessory Gland Protein Genes and Testis-Expressed Genes in Drosophila mojavensis and D. arizonae Genetics, November 1, 2005; 171(3): 1083 - 1101. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Begun and H. A. Lindfors Rapid Evolution of Genomic Acp Complement in the melanogaster Subgroup of Drosophila Mol. Biol. Evol., October 1, 2005; 22(10): 2010 - 2021. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Mueller, K. R. Ram, L. A. McGraw, M. C. Bloch Qazi, E. D. Siggia, A. G. Clark, C. F. Aquadro, and M. F. Wolfner Cross-Species Comparison of Drosophila Male Accessory Gland Protein Genes Genetics, September 1, 2005; 171(1): 131 - 143. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. M. Hambuch and J. Parsch Patterns of Synonymous Codon Usage in Drosophila melanogaster Genes With Sex-Biased Expression Genetics, August 1, 2005; 170(4): 1691 - 1700. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. J. Wagstaff and D. J. Begun Comparative Genomics of Accessory Gland Protein Genes in Drosophila melanogaster and D. pseudoobscura Mol. Biol. Evol., April 1, 2005; 22(4): 818 - 832. [Abstract] [Full Text] [PDF] |
||||
|
|





