- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Loubradou, G.
- Articles by Turcq, B.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Loubradou, G.
- Articles by Turcq, B.
MOD-D, a G
Subunit of the Fungus Podospora anserina, Is Involved in Both Regulation of Development and Vegetative Incompatibility
Gabriel Loubradoua,
Joël Béguereta, and
Béatrice Turcqa
a Laboratoire de Génétique Moléculaire des Champignons Filamenteux, Institut de Biochimie et de Génétique Cellulaires, CNRS UPR 9026, 33077 Bordeaux, France
Corresponding author: Béatrice Turcq, Laboratoire de Génétique Moléculaire des Champignons Filamenteux, Institut de Biochimie et de Génétique Cellulaires, CNRS UPR 9026, 1 rue Camille Saint-Saëns, 33077 Bordeaux cedex, France., beatrice.turcq{at}ibgc.u-bordeaux2.fr (E-mail)
Communicating editor: J. J. LOROS
| ABSTRACT |
|---|
Cell death via vegetative incompatibility is widespread in fungi but molecular mechanism and biological function of the process are poorly understood. One way to investigate this phenomenon was to study genes named mod that modified incompatibility reaction. In this study, we cloned the mod-D gene that encodes a G
protein. The mod-D mutant strains present developmental defects. Previously, we showed that the mod-E gene encodes an HSP90. The mod-E1 mutation suppresses both vegetative incompatibility and developmental defects due to the mod-D mutation. Moreover, we isolated the PaAC gene, which encodes an adenylate cyclase, as a partial suppressor of the mod-D1 mutation. Our previous results showed that the molecular mechanisms involved in vegetative incompatibility and developmental pathways are connected, suggesting that vegetative incompatibility may result from disorders in some developmental steps. Our new result corroborates the involvement of mod genes in signal transduction pathways. As expected, we showed that an increase in the cAMP level is able to suppress the defects in vegetative growth due to the mod-D1 mutation. However, cAMP increase has no influence on the suppressor effect of the mod-D1 mutation on vegetative incompatibility, suggesting that this suppressor effect is independent of the cAMP pathway.
IN filamentous fungi, formation of heterokaryotic cells by hyphal fusion is controlled through a mechanism of somatic or vegetative incompatibility (for reviews see ![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
An alternative approach to understanding mechanisms that regulate vegetative incompatibility is to study mutations that interfere with this phenomenon. Such mutations have been isolated in N. crassa (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
In P. anserina, coexpression of incompatible het genes leads to a growth arrest and a cell death by lytic reaction. Mutant strains that display only the lytic reaction were obtained. Using two different screening procedures, three mod-D mutations were selected via the ability to restore growth of these mutant strains. The mod-D1 mutant was selected from a het-C het-E mod-A1 mod-C1 genetic background in which het-C and het-E are incompatible (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
In a previous attempt to clone the mod-D gene by complementation of the mod-D1 mutation, PaAC, a gene encoding an adenylate cyclase, was isolated. An ectopic copy of PaAC is able to complement the disorders in vegetative growth of the mod-D1 mutant but not the defect in spore germination (![]()
![]()
![]()
![]()
![]()
![]()
Characterization of the mod-D gene is expected to provide additional information about pathways involving PaAC and mod-E. We report here the cloning of the mod-D gene and we show that it encodes an
subunit of a heterotrimeric G protein. The sites mutated in the three mod-D mutants were characterized. To further investigate the functional alteration caused by these mutations, a putative constitutively active allele was created by site-directed mutagenesis. The involvement of cAMP during the vegetative growth was demonstrated for mod-D1 and mod-D3 mutants. No effect was observed on the mod-D2 mutant strain.
To define precisely the function of mod-D in vegetative incompatibility, and also to test cAMP involvement in vegetative incompatibility, we investigated the ability of mod-D mutations to restore the growth of an incompatible strain in different concentrations of cAMP. The mod-D1 and mod-D2 mutations are able to partially restore the growth of this strain. An increase in the cAMP concentration does not interfere with this restoration of growth. It shows that the suppressor effect of mod-D mutations is not due to a decrease in cAMP concentration for this phenotype.
| MATERIALS AND METHODS |
|---|
P. anserina strains, growth conditions, and transformation:
P. anserina is a heterothallic ascomycete. Life cycle and general methods for genetic analysis have been described (![]()
![]()
![]()
D0 and synthetic medium have been previously described (![]()
Protoplasts were prepared and transformed as described in BARREAU and BERGÈS (1989). The pMOcosX vector containing the bacterial hygromycin resistance gene hph was used as a selectable marker (![]()
![]()
Cloning of the mod-D mutant alleles and mod-D1 cDNA:
Genomic DNA of the mod-D mutant strains was prepared using the rapid Petri dish-grown mycelia method (![]()
![]()
![]()
![]()
Plasmids, DNA sequencing, and site-directed mutagenesis:
All plasmids were constructed using standard methods (![]()
![]()
-35S]dATP as the label. Initially, pBluescript commercial primers were used and then the sequence was completed with 17-mer synthetic internal primers derived from the available sequence. The Transformer site-directed mutagenesis kit (Clontech, Palo Alto, CA) was used for site-directed mutagenesis with the following oligonucleotides: ARG201 5'GCTTCGGGCGTGCACGAAGACCAC3' (2125-2148) and MutSal 5'CACGGTCGGTAATCTGGTCCTCC3' (884-906).
Nucleotide sequence accession number:
The nucleotide sequence data reported in Figure 1 will appear in the GenBank/EMBL/DDBJ nucleotide sequence database under accession no. AF038122.
|
| RESULTS |
|---|
Cloning of the mod-D gene:
In a previous attempt to isolate the mod-D gene, PaAC, a gene encoding an adenylate cyclase, was cloned as a partial physiological suppressor of the mod-D1 mutation (![]()
![]()
![]()
MOD-D is an
subunit of a heterotrimeric G protein:
Ectopic integration of a 3057-bp PstI-KpnI fragment fully complements the defects due to the mod-D1 mutation. The sequence of the fragment encompassing mod-D revealed the presence of an open reading frame (ORF) of 1374 bp interrupted by five putative introns according to consensus sequences for filamentous fungi splicing sites (![]()
![]()
subunits of heterotrimeric G proteins. For example, 87.5, 87, 69, 69, and 65% identity were observed with magA from Magnaporthe grisea (![]()
![]()
![]()
![]()
![]()
![]()
subunit of a heterotrimeric G protein.
Different families have been defined for G
proteins from higher eucaryotes (![]()
![]()
![]()
proteins in fungi. The yeast Gpa2 proteins from Kluyveromyces lactis, Saccharomyces cerevisiae, and Schizosaccharomyces pombe could be related to this family since they belong to the same branch of the phylogenetic tree. Sequence comparisons show that MOD-D from P. anserina, magA from M. grisea, CPG-2 from C. parasitica, Gpa1 from C. neoformans, Fil1 from U. hordei, and Gpa3 from U. maydis share a very high level of identity in their C-terminal half. There is 84% identity among MOD-D, CPG-2, magA, Gpa3, Fil1, and Gpa1 within the last 56 amino acids, but only 40% identity within the same region if Gpa1 or Gpa2 from U. maydis is included in the comparison (![]()
proteins.
|
Identification of mutations in mod-D mutant alleles:
Relations between structure and function have been extensively studied for G
proteins (for reviews see ![]()
![]()
MOD-D1 could be unable to activate its effector:
cDNA was synthesized from mod-D1 mRNA and amplified by PCR using internal specific primers. These primers amplify a fragment corresponding to positions 1676-2857 in the genomic DNA (Figure 1). The fragment includes the last four introns of the gene. Two fragments with equal intensity were visualized after migration of the PCR products on agarose gel with ethidium bromide staining. Thus the amount of the two mRNA populations is equivalent. These fragments were cloned. Only one clone with the large fragment and six clones with the short fragment were partially sequenced to determine splicing junctions for the second and the fifth introns. In all cases, the fifth intron was absent, showing that all sequenced fragments were derived from mod-D1 cDNA and not from genomic DNA. The sequence of the large fragment showed that the second intron is still present, whereas in the short fragment, the second intron is absent but the splicing occurred at different positions. Five of the six clones were spliced using the first G downstream from the mutated position, whereas the last one was spliced using the first AG following the mutated position. Nevertheless, whether the splicing occurs at these alternative positions or not, as in the large fragment, in all cases a stop codon is present immediately downstream from the end of the second exon. A truncated protein of 155 aa should be synthesized.
Previous studies on G
subunits revealed that the sequences interacting with effectors are all located in the C-terminal half of the protein (for review see ![]()
The mod-D1 and mod-D3 mutant phenotypes can be partially restored by an increase of the level of cAMP:
A possible relation between the function of mod-D and cyclic AMP was suggested by the cloning of the PaAC gene as a partial suppressor of the mod-D1 mutant (![]()
![]()
|
These findings suggest that mod-D1 and mod-D3 mutations likely result in a decrease of cAMP concentration since an increase of the cAMP level partly restores the vegetative growth of these mutants. These results also support the idea that the suppressor effect on the mod-D1 mutant of an additional ectopic copy of PaAC is due to its adenylate cyclase activity and not to any side effect.
MOD-D2 mutant protein is not constitutively active:
The difference observed in response to cAMP suggests that the mod-D1 and mod-D2 mutations do not lead to the same functional defect. MOD-D1 would be defective in activating its effector. Is MOD-D2 constitutively activated? To answer the question, a mutation known to activate constitutively G
proteins (![]()
![]()
The suppressor effect of mod-D1 on vegetative incompatibility is not due to a decrease in the level of cAMP:
The mod-D1 mutation and the mod-B mutations were isolated as suppressors of the autolytic phenotype of the het-C het-E mod-A1 mod-C1 strain (![]()
![]()
![]()
![]()
|
This effect of the mod-D mutations on vegetative incompatibility led us to investigate a possible involvement of cAMP on vegetative incompatibility. The wild-type, het-C het-E mod-A1, and het-C het-E mod-A1 mod-D1 strains were grown at 11° on D0 medium supplemented or not with 10 mM dibutyryl cAMP. For all of the strains, the addition of dibutyryl cAMP stimulated growth independently of the presence of the mod-D1 mutation (data not shown). The growth restoration of the het-C het-E mod-A1 mod-D1 strain does not appear to be the consequence of a decreased level of cAMP. Therefore, this restoration is probably not linked to the defect in the cAMP pathway resulting from the mod-D1 mutation.
| DISCUSSION |
|---|
The characterization of previously described mod genes in the fungus P. anserina has been undertaken to elucidate the molecular mechanism of vegetative incompatibility and to understand the relationship between this process and some developmental steps in this species. Three mod-D mutants have been isolated using two distinct screening procedures. These two procedures were designed for selecting mutations in genes that would be involved in the control of the cell lysis reaction due to vegetative incompatibility (![]()
![]()
subunit of a heterotrimeric G protein. Two other genes, which display functional interactions with mod-D, have been previously characterized: mod-E and PaAC. They encode, respectively, an HSP90 (![]()
![]()
The mod-D2 phenotype may correspond to the loss of function of both MOD-D and Gß
-associated subunits:
All of the mod-D1 cDNAs analyzed encode a polypeptide lacking the C-terminal half of the wild-type protein. This part of the protein is known to be involved in the binding to the effectors (for review see ![]()
mutant proteins toward the ß
subunits. As the C-terminal end of G
proteins is important for the binding to the receptor (for review see ![]()
subunits activation. This hypothesis would also imply that both
and ß
subunits have effectors. Such a result has already been reported in Aspergillus nidulans. A strain, in which the fadA mutant gene encoding a G
subunit inhibits the release of Gß
subunits, exhibits a more-altered phenotype than the strain in which the fadA gene has been deleted (![]()
mod-D and vegetative incompatibility: evidence for a second pathway controlled by mod-D:
The effect of mod-D mutations on vegetative incompatibility was investigated on the cryosensitive het-C het-E mod-A1 incompatible strain. This strain is unable to grow at 11°. The mod-A1 mutant strain and the wild-type strain are able to grow at 11°. The growth inhibition is due to the presence of the two het-C and het-E incompatible genes. In the presence of either mod-D1 or mod-D2 mutations, the growth of the cryosensitive het-C het-E mod-A1 strain is partly restored at 11°. This result confirms the involvement of the mod-D gene in vegetative incompatibility. The het-C, het-E, and mod-A genes have been isolated and sequenced. They encode, respectively, a protein with identity to a glycolipid transfer protein (![]()
![]()
![]()
![]()
An increase of the cAMP level does not attenuate the growth restoration due to the mod-D1 mutation in the het-C het-E mod-A1 mod-D1 strain. This result seems to indicate that the growth restoration observed is not due to a decrease in the cAMP level resulting from the presence of the mod-D1 mutation. It also indicates that the mod-D1 mutation induces some defects in a signaling pathway distinct from the cAMP pathway. The characterization of this second pathway responsible for the mod-D1 effect on vegetative incompatibility is now under investigation.
A family of fungal G
subunits involved in cAMP signal transduction pathway:
MOD-D from P. anserina, magA from M. grisea, CPG-2 from C. parasitica, Gpa3 from U. maydis, Fil1 from U. hordei, and Gpa1 from C. neoformans may define a new family of G
proteins. They are characterized by a highly conserved C-terminal region. The C-terminal region of G
proteins is involved in effector and receptor binding (for review see ![]()
proteins may interact with the same type of receptor and effector. The hypothesis of a conserved pathway for these G
proteins is not based only on sequence similarity but also on the positive regulatory role of MOD-D, CPG-2, Gpa3, Fil1, and Gpa1 on the level of cAMP. The disorders in mod-D1 and mod-D3 strains during vegetative growth can be restored by an increase of the cAMP level. In the same way, the strains deleted for gpa1, gpa3, Fil1, and cpg-2 are deficient in cAMP production (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
The MOD-D protein is involved in both the sexual cycle of P. anserina (by controlling key steps in protoperithecia formation and spore germination) and vegetative development (![]()
![]()
![]()
![]()
![]()
![]()
![]()
subunit characterized in C. parasitica (![]()
![]()
![]()
![]()
i family (![]()
![]()
From all of these data, it is difficult to propose a model for the function of the signal transduction cascade controlled by MOD-D family G
subunit proteins. This may be due to the natural environment diversity of these species. The signals dependent on these G
proteins may be very different for a fungus living in animal brains, on plant leaves, or on herbivore dungs.
The growing interest in fungi signal transduction and the key role of G
proteins in this family will certainly lead to a rapid increase of family members. The study of these genes in our laboratory and others will allow determination of the precise characteristics of this potentially conserved pathway. In this respect, P. anserina is an excellent paradigm since there is evidence for the existence of a second signaling transduction pathway regulated by mod-D and a possible active role for Gß
subunits.
| ACKNOWLEDGMENTS |
|---|
This work was supported by a grant from the Association pour la Recherche sur le Cancer. G.L. was supported by a fellowship from the Association pour la Recherche sur le Cancer.
Manuscript received June 5, 1998; Accepted for publication March 10, 1999.
| LITERATURE CITED |
|---|
AKINS, R. A. and A. M. LAMBOWITZ, 1985 General method for cloning Neurospora crassa nuclear genes by complementation of mutants. Mol. Cell. Biol. 5:2272-2278
ALSPAUGH, J. A., J. R. PERFECT, and J. HEITMAN, 1997 Cryptococcus neoformans mating and virulence are regulated by the G-protein
subunit GPA1 and cAMP. Genes Dev. 11:3206-3217
ARGANOZA, M. T., J. OHRNBERGER, J. MIN, and R. A. AKINS, 1994 Suppressor mutants of Neurospora crassa that tolerate allelic differences at single or at multiple heterokaryon incompatibility loci. Genetics 137:731-742[Abstract].
BALLANCE, D. J., 1991 Transformation systems for filamentous fungi and an overview of fungal gene structure, pp. 129, in Molecular Industrial Mycology, edited by S. A. LEONG and R. M. BERKA. Marcel Dekker Inc., New York.
BARREAU, C., M. ISKANDAR, G. LOUBRADOU, V. LEVALLOIS, and J. BÉGUERET, 1998 The mod-A suppressor of non-allelic heterokaryon incompatibility in Podospora anserina encodes a proline-rich polypeptide involved in female organs formation. Genetics 149:915-926
BÉGUERET, J., B. TURCQ, and C. CLAVÉ, 1994 Vegetative incompatibility in filamentous fungi: het genes begin to talk. Trends Genet. 10:441-446[Medline].
BELCOUR, L. and J. BERNET, 1969 Sur la mise en évidence d'un gène dont la mutation supprime spécifiquement certaines manifestations d'incompatibilité chez le Podospora anserina.. C. R. Acad. Sci. Paris 269:712-714.
BERGÈS, T. and C. BARREAU, 1989 Heat-shock at an elevated temperature improves transformation efficiency of protoplasts from Podospora anserina.. J. Gen. Microbiol. 135:601-604[Medline].
BERNET, J., 1971 Sur un cas de suppression de l'incompatibilité cellulaire chez le champignon Podospora anserina.. C. R. Acad. Sci. Paris 273:1120-1122.
BERNET, J., J. BÉGUERET, and J. LABARÈRE, 1973 Incompatibility in the fungus Podospora anserina. Are the mutations abolishing the incompatibility reaction ribosomal mutation? Mol. Gen. Genet. 124:35-50[Medline].
BOUCHERIE, H., 1979 L'incompatibilité protoplasmique chez Podospora anserina: caractérisation et regulation des variations physiologiques associées, relation avec la différenciation des organes reproducteurs femelles. Ph.D. Thesis, University of Bordeaux II, Bordeaux, France.
BOUCHERIE, H., J. BÉGUERET, and J. BERNET, 1976 The molecular mechanism of protoplasmic incompatibility and its relationship to the formation of protoperithecia in Podospora anserina.. J. Gen. Microbiol. 92:59-66
BOURNE, H. R., D. A. SANDERS, and F. MCCORMICK, 1991 The GTPase superfamily: conserved structure and molecular mechanism. Nature 349:117-127[Medline].
BRUCHEZ, J. J. P., J. EBERLE, and V. E. A. RUSSO, 1993 Regulatory sequences in the transcription of Neurospora crassa genes: CAAT box, TATA box, introns, poly(A) tail formation sequences. Fungal Genet. Newsl. 40:89-96.
CHEN, B., S. GAO, G. H. CHOI, and D. L. NUSS, 1996 Extensive alteration of fungal gene transcript accumulation and elevation of G-protein-regulated cAMP levels by a virulence-attenuating hypovirus. Proc. Natl. Acad. Sci. USA 93:7996-8000
CHOI, G. H., B. CHEN, and D. L. NUSS, 1995 Virus-mediated or transgenic suppression of a G-protein
subunit and attenuation of fungal virulence. Proc. Natl. Acad. Sci. USA 92:305-309
CONKLIN, B. R. and H. R. BOURNE, 1993 Structural elements of G
subunits that interact with Gß
, receptors, and effectors. Cell 73:631-641[Medline].
CSERMELY, P., T. SCHNAIDER, C. SOTI, Z. PROHASZKA, and G. NARDAI, 1998 The 90-kDA molecular chaperone family: structure, function, and clinical applications. A comprehensive review. Pharmacol. Ther. 79:129-168[Medline].
DURRENS, P., 1982 Podospora anserina mutants defective in cell regeneration and ascospore germination: the presence of a possible lesion of the plasma membrane. Exp. Mycol. 6:216-224.
DURRENS, P., 1984 Podospora anserina mutation reducing cell survival under glucose starvation. Exp. Mycol. 8:342-348.
DURRENS, P. and J. BERNET, 1982 Podospora anserina mutations inhibiting several development alternatives and growth renewal. Curr. Genet. 5:181-186.
DURRENS, P., F. LAIGRET, J. LABARÈRE, and J. BERNET, 1979 Podospora anserina mutant defective in protoperithecium formation, ascospore germination, and cell regeneration. J. Bacteriol. 140:835-842
ESPAGNE, E., P. BALHADÈRE, J. BÉGUERET, and B. TURCQ, 1997 Reactivity in vegetative incompatibility of the HET-E protein of the fungus Podospora anserina is dependent on GTP-binding activity and WD40 repeated domain. Mol. Gen. Genet. 256:620-627[Medline].
ESSER, K., 1974 Podospora anserina, pp. 531551 in Handbook of Genetics, edited by R. C. KING. Plenum Press, New York.
FELSENSTEIN, J., 1993 PHYLIP (Phylogeny Inference Package) version 3.5c. Department of Genetics, University of Washington, Seattle.
GAO, S. and D. L. NUSS, 1996 Distinct roles for two G protein
subunits in fungal virulence, morphology, and reproduction revealed by targeted gene disruption. Proc. Natl. Acad. Sci. USA 93:14122-14127
GLASS, N. L. and G. A. KULDAU, 1992 Mating type and vegetative incompatibility in filamentous ascomycetes. Annu. Rev. Phytopathol. 30:201-224[Medline].
GLASS, N. L., S. J. VOLLMER, C. STABEN, J. GROTELUESCHEN, and R. L. METZENBERG et al., 1988 DNAs of the two mating-type alleles of Neurospora crassa are highly dissimilar. Science 241:570-573
GLASS, N. L., J. GROTELUESCHEN, and R. L. METZENBERG, 1990 Neurospora crassa A mating type region. Proc. Natl. Acad. Sci. USA 87:4912-4916
ISSHIKI, T., N. MOCHIZUKI, T. MAEDA, and M. YAMAMOTO, 1992 Characterization of a fission yeast gene gpa2, that encodes a G
subunit involved in the monitoring of nutrition. Genes Dev. 6:2455-2462
KAHMANN, R. and C. BASSE, 1997 Signaling and development in pathogenic funginew strategies for plant protection? Trends Plant Sci. 2:366-368.
KOZAK, K. R., L. M. FOSTER, and I. K. ROSS, 1995 Cloning and characterization of a G protein alpha-subunit-encoding gene from the basidiomycete, Coprinus congregatus.. Gene 163:133-137[Medline].
KÜBLER, E., H. U. MOSCH, S. RUPP, and M. P. LISANTI, 1997 Gpa2p, a G-protein alpha-subunit, regulates growth and pseudohyphal development in Saccharomyces cerevisiae via a cAMP-dependent mechanism. J. Biol. Chem. 272:20321-20323
LABARÈRE, J. and J. BERNET, 1977 Protoplasmic incompatibility and cell lysis in Podospora anserina. I. Genetic investigation on mutations of a novel modifier gene that suppresses cell destruction. Genetics 87:249-257
LABARÈRE, J. and J. BERNET, 1979a A pleiotropic mutation affecting protoperithecium formation and ascospore outgrowth in Podospora anserina.. J. Gen. Microbiol. 113:19-27.
LABARÈRE, J. and J. BERNET, 1979b Protoplasmic incompatibility in Podospora anserina: a possible role for its associated proteolytic activity. Genetics 93:525-537
LANDIS, C. A., S. B. MASTERS, A. SPADA, A. M. PACE, and H. R. BOURNE et al., 1989 GTPase inhibiting mutations activate the
chain of Gs and stimulate adenylyl cyclase in human pituitary tumors. Nature 340:692-696[Medline].
LECELLIER, G. and P. SILAR, 1994 Rapid methods for nucleic acids extraction from Petri dish-grown mycelia. Curr. Genet. 25:122-123[Medline].
LICHTER, A. and D. MILLS, 1997 Fil1, a G-protein
-subunit that acts upstream of cAMP and is essential for dimorphic switching in haploid cells of Ustilago hordei.. Mol. Gen. Genet. 256:426-435[Medline].
LIU, S. and R. A. DEAN, 1997 G protein alpha subunit genes control growth, development, and pathogenicity of Magnaporthe grisea.. Mol. Plant-Microbe Interact. 10:1075-1086[Medline].
LORENZ, M. C. and J. HEITMAN, 1997 Yeast pseudohyphal growth is regulated by GPA2, a G protein alpha homolog. EMBO J. 16:7008-7018[Medline].
LOUBRADOU, G., J. BÉGUERET, and B. TURCQ, 1996 An additional copy of the adenylate cyclase gene relieves developmental defects produced by a mutation in a gene involved in vegetative incompatibility in Podospora anserina.. Gene 170:119-123[Medline].
LOUBRADOU, G., J. BÉGUERET, and B. TURCQ, 1997 A mutation in an HSP90 gene affects the sexual cycle and suppresses vegetative incompatibility in the fungus Podospora anserina.. Genetics 147:581-588[Abstract].
LYONS, J., C. A. LANDIS, G. HARSH, L. VALLAR, and K. GRÜNEWALD et al., 1990 Two G protein oncogenes in human endocrine tumors. Science 249:655-659
MILLS, D., J. AGNAN and K. MCCLUSTER, 1996 Cyclic AMP controls dimorphic switching of Ustilago hordei, pp. 8392 in Molecular Aspect of Pathogenicity and Resistance: Requirement for Signal Trans-jyduction, edited by D. MILLS, H. KUNOH, N. T. KEENAND and S. MAYAMA. APS Press, St. Paul.
NAKAFUKU, M., H. ITOH, S. NAKAMURA, and Y. KAZIRO, 1987 Occurrence in Saccharomyces cerevisiae of a gene homologous to the cDNA coding for the alpha-subunit of mammalian G proteins. Proc. Natl. Acad. Sci. USA 84:2140-2144
NAKAFUKU, M., T. OBARA, K. KAIBUCHI, I. MIYAJIMA, and A. MIYAJIMA et al., 1988 Isolation of a second yeast Saccharomyces cerevisiae gene (GPA2) coding for guanine nucleotide-binding regulatory protein: studies on its structure and possible functions. Proc. Natl. Acad. Sci. USA 85:1374-1378
NEER, E. J., 1995 Heterotrimeric G proteins: organizers of transmembrane signals. Cell 80:249-257[Medline].
NEWMEYER, D., 1970 A suppressor of the heterokaryon-incompatibility associated with mating type in Neurospora crassa.. Can. J. Genet. Cytol. 12:914-926[Medline].
OBARA, T., M. NAKAFUKU, M. YAMAMOTO, and Y. KAZIRO, 1991 Isolation and characterization of a gene encoding a G-protein alpha subunit from Schizosaccharomyces pombe: involvement in mating and sporulation pathways. Proc. Natl. Acad. Sci. USA 88:5877-5881
ORBACH, M. J., A. SWEIGARD, A. WALTER, L. FARRAL, and F. G. CHUMLEY et al., 1991 Strategies for the isolation of the avirulence genes from the rice blast Magnaporthe grisea.. Fungal Genet. Newsl. 38:16.
PONCE, M. R. and J. L. MICOL, 1992 PCR amplification of long DNA fragments. Nucleic Acids Res. 20:663.
REGENFELDER, E., T. SPELLIG, A. HARTMANN, S. LAUENSTEIN, and M. BÖLKER et al., 1997 G proteins in Ustilago maydis: transmission of multiple signals? EMBO J. 16:1934-1942[Medline].
RIZET, G. and C. ENGELMAN, 1949 Contribution à l'étude d'un ascomycète tétrasporé: Podospora anserina. Rev. Cytol. et Biol Veg. 11:201-304.
SADHU, C., D. HOEKSTRA, M. J. MCEACHERN, S. I. REED, and J. B. HICKS, 1992 A G-protein alpha subunit from asexual Candida albicans functions in the mating signal transduction pathway of Saccharomyces cerevisiae and is regulated by the a1-alpha-2 repressor. Mol. Cell. Biol. 12:1977-1985
SAIKI, R. K., D. H. GELFAND, S. STOFFEL, S. J. SCHARF, and R. HIGUSHI et al., 1988 Primed-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239:487-491
SAMBROOK, J., E. F. FRITSCH and T. MANIATIS, 1989 Molecular Cloning: A Laboratory Manual, Ed. 2. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
SANGER, F., S. NICKLEN, and A. R. COULSON, 1977 DNA sequencing with chain terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463-5467
SAUPE, S., C. DESCAMPS, B. TURCQ, and J. BÉGUERET, 1994 Inactivation of the Podospora anserina vegetative incompatibility locus het-c, whose product resembles a glycolipid transfer protein, drastically impairs ascospore production. Proc. Natl. Acad. Sci. USA 91:5927-5931
SAUPE, S., B. TURCQ, and J. BÉGUERET, 1995 A gene responsible for vegetative incompatibility in the fungus Podospora anserina encodes a protein with a GTP-binding motif and Gß homologous domain. Gene 162:135-139[Medline].
SAUPE, S. J., G. A. KULDAU, M. L. SMITH, and N. L. GLASS, 1996 The product of the het-C heterokaryon incompatibility gene of Neurospora crassa has characteristics of a glycine-rich cell wall protein. Genetics 143:1589-1600[Abstract].
SAVINON-TEJEDA, A. L., L. ONGAY-LARIOS, J. RAMIREZ, and R. CORIA, 1996 Isolation of a gene encoding a G protein alpha subunit involved in the regulation of cAMP levels in the yeast Kluyveromyces lactis.. Yeast 12:1125-1133[Medline].
SIMON, M. I., M. P. STRATHMANN, and N. GAUTAM, 1991 Diversity of G proteins in signal transduction. Science 252:802-808
SMULIAN, A. G., M. RYAN, C. STABEN, and M. CUSHION, 1996 Signal transduction in Pneumocystis carinii: characterization of the genes (pcg1) encoding the alpha subunit of the G protein (PCG1) of Pneumocystis carinii carinii and Pneumocystis carinii ratti.. Infect. Immun. 64:691-701[Abstract].
STABEN, C. and C. YANOFSKY, 1990 Neurospora crassa a mating type region. Proc. Natl. Acad. Sci. USA 87:4917-4921
THOMPSON, J. D., D. G. HIGGINS, and T. J. GIBSON, 1994 CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673-4680
TOLKACHEVA, T., P. MCNAMARA, E. PIEKARZ, and W. COURCHESNE, 1994 Cloning of a Cryptococcus neoformans gene, GPA1, encoding a G-protein
-subunit homolog. Infect. Immun. 62:2849-2856
TURCQ, B. and J. BÉGUERET, 1987 The ura5 gene of the filamentous fungus Podospora anserina: nucleotide sequence and expression in transformed strains. Gene 53:201-209[Medline].
TURCQ, B., M. DENAYROLLES, and J. BÉGUERET, 1990 Isolation of the two allelic incompatibility genes s and S of the fungus Podospora anserina.. Curr. Genet. 17:297-303.
TURNER, G. E. and K. A. BORKOVICH, 1993 Identification of a G protein
subunit from Neurospora crassa that is a member of the Gi family. J. Biol. Chem. 268:14805-14811
VELLANI, T. S., A. J. GRIFFITHS, and N. L. GLASS, 1994 New mutations that suppress mating-type vegetative incompatibility in Neurospora crassa.. Genome 37:249-255[Medline].
YU, J.-H., J. WEISER, and T. H. ADAMS, 1996 The Aspergillus FlbA RGS domain protein antagonizes G protein signaling to block proliferation and allow development. EMBO J. 15:5184-5190[Medline].
This article has been cited by other articles:
![]() |
K. Pal, A.D. van Diepeningen, J. Varga, R.F. Hoekstra, P.S. Dyer, and A.J.M. Debets Sexual and vegetative compatibility genes in the aspergilli Stud Mycol, January 1, 2007; 59(1): 19 - 30. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Wang, T. M. Butt, and R. J. S. Leger Colony sectorization of Metarhizium anisopliae is a sign of ageing Microbiology, October 1, 2005; 151(10): 3223 - 3236. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Wang and R. J. St. Leger Developmental and Transcriptional Responses to Host and Nonhost Cuticles by the Specific Locust Pathogen Metarhizium anisopliae var. acridum Eukaryot. Cell, May 1, 2005; 4(5): 937 - 947. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Zeilinger, B. Reithner, V. Scala, I. Peissl, M. Lorito, and R. L. Mach Signal Transduction by Tga3, a Novel G Protein {alpha} Subunit of Trichoderma atroviride Appl. Envir. Microbiol., March 1, 2005; 71(3): 1591 - 1597. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. L. Dawe, V. C. McMains, M. Panglao, S. Kasahara, B. Chen, and D. L. Nuss An ordered collection of expressed sequences from Cryphonectria parasitica and evidence of genomic microsynteny with Neurospora crassa and Magnaporthe grisea Microbiology, September 1, 2003; 149(9): 2373 - 2384. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. L. Glass and I. Kaneko Fatal Attraction: Nonself Recognition and Heterokaryon Incompatibility in Filamentous Fungi Eukaryot. Cell, February 1, 2003; 2(1): 1 - 8. [Full Text] [PDF] |
||||
![]() |
Q. Xiang and N. L. Glass Identification of vib-1, a Locus Involved in Vegetative Incompatibility Mediated by het-c in Neurospora crassa Genetics, September 1, 2002; 162(1): 89 - 101. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Rocha-Ramirez, C. Omero, I. Chet, B. A. Horwitz, and A. Herrera-Estrella Trichoderma atroviride G-Protein {alpha}-Subunit Gene tga1 Is Involved in Mycoparasitic Coiling and Conidiation Eukaryot. Cell, August 1, 2002; 1(4): 594 - 605. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. D. Ivey, A. M. Kays, and K. A. Borkovich Shared and Independent Roles for a G{alpha}i Protein and Adenylyl Cyclase in Regulating Development and Stress Responses in Neurospora crassa Eukaryot. Cell, August 1, 2002; 1(4): 634 - 642. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. D'Souza, J. A. Alspaugh, C. Yue, T. Harashima, G. M. Cox, J. R. Perfect, and J. Heitman Cyclic AMP-Dependent Protein Kinase Controls Virulence of the Fungal Pathogen Cryptococcus neoformans Mol. Cell. Biol., May 1, 2001; 21(9): 3179 - 3191. [Abstract] [Full Text] |
||||
![]() |
K.-W. Tzung, R. M. Williams, S. Scherer, N. Federspiel, T. Jones, N. Hansen, V. Bivolarevic, L. Huizar, C. Komp, R. Surzycki, et al. Genomic evidence for a complete sexual cycle in Candida albicans PNAS, March 13, 2001; 98(6): 3249 - 3253. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. B. Lengeler, R. C. Davidson, C. D'souza, T. Harashima, W.-C. Shen, P. Wang, X. Pan, M. Waugh, and J. Heitman Signal Transduction Cascades Regulating Fungal Development and Virulence Microbiol. Mol. Biol. Rev., December 1, 2000; 64(4): 746 - 785. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Kays, P. S. Rowley, R. A. Baasiri, and K. A. Borkovich Regulation of Conidiation and Adenylyl Cyclase Levels by the Galpha Protein GNA-3 in Neurospora crassa Mol. Cell. Biol., October 15, 2000; 20(20): 7693 - 7705. [Abstract] [Full Text] |
||||
![]() |
S. J. Saupe Molecular Genetics of Heterokaryon Incompatibility in Filamentous Ascomycetes Microbiol. Mol. Biol. Rev., September 1, 2000; 64(3): 489 - 502. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. Lorenz, X. Pan, T. Harashima, M. E. Cardenas, Y. Xue, J. P. Hirsch, and J. Heitman The G Protein-Coupled Receptor Gpr1 Is a Nutrient Sensor That Regulates Pseudohyphal Differentiation in Saccharomyces cerevisiae Genetics, February 1, 2000; 154(2): 609 - 622. [Abstract] [Full Text] |
||||
![]() |
S. Lev, A. Sharon, R. Hadar, H. Ma, and B. A. Horwitz A mitogen-activated protein kinase of the corn leaf pathogen Cochliobolus heterostrophus is involved in conidiation, appressorium formation, and pathogenicity: Diverse roles for mitogen-activated protein kinase homologs in foliar pathogens PNAS, November 9, 1999; 96(23): 13542 - 13547. [Abstract] [Full Text] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Loubradou, G.
- Articles by Turcq, B.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Loubradou, G.
- Articles by Turcq, B.












