Genetics, Vol. 152, 519-528, June 1999, Copyright © 1999

MOD-D, a G{alpha} Subunit of the Fungus Podospora anserina, Is Involved in Both Regulation of Development and Vegetative Incompatibility

Gabriel Loubradoua, Joël Béguereta, and Béatrice Turcqa
a Laboratoire de Génétique Moléculaire des Champignons Filamenteux, Institut de Biochimie et de Génétique Cellulaires, CNRS UPR 9026, 33077 Bordeaux, France

Corresponding author: Béatrice Turcq, Laboratoire de Génétique Moléculaire des Champignons Filamenteux, Institut de Biochimie et de Génétique Cellulaires, CNRS UPR 9026, 1 rue Camille Saint-Saëns, 33077 Bordeaux cedex, France., beatrice.turcq{at}ibgc.u-bordeaux2.fr (E-mail)

Communicating editor: J. J. LOROS


*  ABSTRACT
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Cell death via vegetative incompatibility is widespread in fungi but molecular mechanism and biological function of the process are poorly understood. One way to investigate this phenomenon was to study genes named mod that modified incompatibility reaction. In this study, we cloned the mod-D gene that encodes a G{alpha} protein. The mod-D mutant strains present developmental defects. Previously, we showed that the mod-E gene encodes an HSP90. The mod-E1 mutation suppresses both vegetative incompatibility and developmental defects due to the mod-D mutation. Moreover, we isolated the PaAC gene, which encodes an adenylate cyclase, as a partial suppressor of the mod-D1 mutation. Our previous results showed that the molecular mechanisms involved in vegetative incompatibility and developmental pathways are connected, suggesting that vegetative incompatibility may result from disorders in some developmental steps. Our new result corroborates the involvement of mod genes in signal transduction pathways. As expected, we showed that an increase in the cAMP level is able to suppress the defects in vegetative growth due to the mod-D1 mutation. However, cAMP increase has no influence on the suppressor effect of the mod-D1 mutation on vegetative incompatibility, suggesting that this suppressor effect is independent of the cAMP pathway.


IN filamentous fungi, formation of heterokaryotic cells by hyphal fusion is controlled through a mechanism of somatic or vegetative incompatibility (for reviews see GLASS and KULDAU 1992 Down; BEGUERET et al. 1994 Down). Vegetative incompatibility is triggered by genetic differences at specific loci named het loci. Some het genes have been isolated and characterized in Podospora anserina (TURCQ et al. 1990 Down; SAUPE et al. 1994 Down, SAUPE et al. 1995 Down) and Neurospora crassa (GLASS et al. 1988 Down, GLASS et al. 1990 Down; STABEN and YANOFSKY 1990 Down; SAUPE et al. 1996 Down). However, information obtained from the molecular data did not suggest any common function among het genes. Vegetative incompatibility triggered by the coexpression of het genes is still not understood.

An alternative approach to understanding mechanisms that regulate vegetative incompatibility is to study mutations that interfere with this phenomenon. Such mutations have been isolated in N. crassa (NEWMEYER 1970 Down; ARGANOZA et al. 1994 Down; VELLANI et al. 1994 Down) and in P. anserina (BELCOUR and BERNET 1969 Down; BERNET 1971 Down; LABARERE and BERNET 1977 Down, LABARERE and BERNET 1979A Down; DURRENS 1982 Down, DURRENS 1984 Down). In P. anserina, these mutations occur in mod genes (modifiers of incompatibility reaction). Mutations in mod genes induce alterations in differentiation steps. In addition to being involved in vegetative incompatibility, mod and het genes may control some steps of the life cycle of the fungus (BOUCHERIE et al. 1976 Down).

In P. anserina, coexpression of incompatible het genes leads to a growth arrest and a cell death by lytic reaction. Mutant strains that display only the lytic reaction were obtained. Using two different screening procedures, three mod-D mutations were selected via the ability to restore growth of these mutant strains. The mod-D1 mutant was selected from a het-C het-E mod-A1 mod-C1 genetic background in which het-C and het-E are incompatible (LABARERE and BERNET 1979A Down). The mod-D2 and mod-D3 mutants were selected from the self-lytic mod-A1 mod-B11 strain (DURRENS et al. 1979 Down). None of these mod-D mutations is able, by itself, to suppress cell lysis and growth arrest due to vegetative incompatibility. Moreover, the three mod-D mutants are altered in the differentiation of secondary ramifications (i.e., distorted and slow-growing hyphae), aerial hyphae, and protoperithecia (DURRENS et al. 1979 Down; LABARERE and BERNET 1979A Down, LABARERE and BERNET 1979B Down). They also display a decrease in the renewal of growth from stationary cells and a defect in spore germination (DURRENS et al. 1979 Down; LABARERE and BERNET 1979A Down, LABARERE and BERNET 1979B Down). The mod-D2 strain exhibits the most altered phenotype and it is also deficient for pigmentation. P. Durrens and J. Bernet proposed that mod-D controls the escape from the stationary state. This state would be a prerequisite for the formation of differentiated structures (DURRENS and BERNET 1982 Down).

In a previous attempt to clone the mod-D gene by complementation of the mod-D1 mutation, PaAC, a gene encoding an adenylate cyclase, was isolated. An ectopic copy of PaAC is able to complement the disorders in vegetative growth of the mod-D1 mutant but not the defect in spore germination (LOUBRADOU et al. 1996 Down). In a parallel approach, we have identified a gene, mod-E, whose mutation suppressed developmental defects associated with mod-D2 mutation (DURRENS 1982 Down). The mod-E1 mutation is epistatic to the mod-D2 mutation for all developmental disorders (DURRENS 1982 Down). Moreover, the mod-E1 mutation can partly restore the growth of a self-incompatible het-R het-V strain (LOUBRADOU et al. 1997 Down). These results illustrate the tight connection existing between different pathways involved in development and in vegetative incompatibility. The mod-E gene encodes an HSP90 (LOUBRADOU et al. 1997 Down). Proteins of this family are known to be involved in signal transduction pathways in interaction with nuclear receptors or protein kinases (for review see CSERMELY et al. 1998 Down).

Characterization of the mod-D gene is expected to provide additional information about pathways involving PaAC and mod-E. We report here the cloning of the mod-D gene and we show that it encodes an {alpha} subunit of a heterotrimeric G protein. The sites mutated in the three mod-D mutants were characterized. To further investigate the functional alteration caused by these mutations, a putative constitutively active allele was created by site-directed mutagenesis. The involvement of cAMP during the vegetative growth was demonstrated for mod-D1 and mod-D3 mutants. No effect was observed on the mod-D2 mutant strain.

To define precisely the function of mod-D in vegetative incompatibility, and also to test cAMP involvement in vegetative incompatibility, we investigated the ability of mod-D mutations to restore the growth of an incompatible strain in different concentrations of cAMP. The mod-D1 and mod-D2 mutations are able to partially restore the growth of this strain. An increase in the cAMP concentration does not interfere with this restoration of growth. It shows that the suppressor effect of mod-D mutations is not due to a decrease in cAMP concentration for this phenotype.


*  MATERIALS AND METHODS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

P. anserina strains, growth conditions, and transformation:
P. anserina is a heterothallic ascomycete. Life cycle and general methods for genetic analysis have been described (RIZET and ENGELMAN 1949 Down; ESSER 1974 Down). The het-C het-E strain is an autolytic strain due to the coexpression of the two nonallelic incompatible genes het-C and het-E. The mod-A1 mutation has been isolated by its ability to modify the incompatibility reaction (BELCOUR and BERNET 1969 Down).

D0 and synthetic medium have been previously described (LOUBRADOU et al. 1997 Down). Theophylline (1,3-dimethylxanthine; Sigma, St. Louis) and dibutyril cAMP (N6,2'-O-dibutyryladenosine 3':5'-cyclic monophosphate; Sigma) were added to these media when indicated.

Protoplasts were prepared and transformed as described in BARREAU and BERGÈS (1989). The pMOcosX vector containing the bacterial hygromycin resistance gene hph was used as a selectable marker (ORBACH et al. 1991 Down), and transformants were screened on hygromycin B at 100 µg/ml. The library construction has been described elsewhere (LOUBRADOU et al. 1996 Down).

Cloning of the mod-D mutant alleles and mod-D1 cDNA:
Genomic DNA of the mod-D mutant strains was prepared using the rapid Petri dish-grown mycelia method (LECELLIER and SILAR 1994 Down). PCR amplification of DNA (SAIKI et al. 1988 Down) was achieved in the buffer III described in PONCE and MICOL 1992 Down, using 100 ng of each primer and 20 ng genomic DNA in a 50-µl mixture. Two pairs of primers were used: Mut-D3 5'AGGGAAGGAGCGACACAATAG3' (861-881) and Mut-D4 5'GGTTTTTGAACACGGTGGGTC3' (1775-1755), or Mut-D5 5'CTGCAGCTAGATTCCCCGATA3' (3057-3037) and Mut-D6 5'AGCGGCAAGTCAACTATTGTG3' (1676-1696). After 12 min at 95°, DNA was amplified for 35 cycles in a Perkin Elmer-Cetus (Norwalk, CT) thermocycler. The cycling parameters were as follows: 95° for 30 sec, 56° for 2 min for Mut-D3 and Mut-D4 primers, or 53° for 2 min for Mut-D5 and Mut-D6 primers, and 72° for 2 min. Synthesis of the mod-D1 cDNA and PCR amplification was performed using the Access RT-PCR system kit (Promega, Madison, WI). Total RNA was prepared as described previously (TURCQ and BEGUERET 1987 Down). The primers were Mut-D6 and RT1 5'CAACTCTGGAGGATGCATGAG3' (2857-2837). The cycling parameters were as follows: 94° for 30 sec, 52° for 1 min, and 72° for 2 min.

Plasmids, DNA sequencing, and site-directed mutagenesis:
All plasmids were constructed using standard methods (SAMBROOK et al. 1989 Down) and were propagated in Escherichia coli XL1blue. The mod-D gene was cloned into the pBluescript SK+ vector (Stratagene, La Jolla, CA). Subclones for sequencing were produced using restriction sites. Nucleotide sequencing was performed using the dideoxynucleotide chain termination method (SANGER et al. 1977 Down) with the Sequenase version 2.0 reagent kit (U.S. Biochemical Corp., Cleveland) and [{alpha}-35S]dATP as the label. Initially, pBluescript commercial primers were used and then the sequence was completed with 17-mer synthetic internal primers derived from the available sequence. The Transformer site-directed mutagenesis kit (Clontech, Palo Alto, CA) was used for site-directed mutagenesis with the following oligonucleotides: ARG201 5'GCTTCGGGCGTGCACGAAGACCAC3' (2125-2148) and MutSal 5'CACGGTCGGTAATCTGGTCCTCC3' (884-906).

Nucleotide sequence accession number:
The nucleotide sequence data reported in Figure 1 will appear in the GenBank/EMBL/DDBJ nucleotide sequence database under accession no. AF038122.




View larger version (148K):
In this window
In a new window
Download PPT slide
 
Figure 1. Nucleotide and predicted amino acid sequence of mod-D. Consensus regions for splicing sites are italicized (BALLANCE 1991 Down). Regions conserved among G proteins (G-1, G-2, G-3, G-4, and G-5) are underlined (BOURNE et al. 1991 Down). Base changes in mod-D1, mod-D2, and mod-D3 alleles are in boldface. The arginine residue of the G-2 region underlined by a double line was mutated to cysteine in the mod-DR180C allele.


*  RESULTS
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

Cloning of the mod-D gene:
In a previous attempt to isolate the mod-D gene, PaAC, a gene encoding an adenylate cyclase, was cloned as a partial physiological suppressor of the mod-D1 mutation (LOUBRADOU et al. 1996 Down). An additional ectopic copy of the PaAC gene is able to complement vegetative growth disorders due to the mod-D1 mutation but the spore germination defect caused by the mutation cannot be restored. To avoid reisolation of the PaAC gene, a two-step screening procedure was used to clone mod-D. Transformants were first screened on synthetic medium for the restoration of a wild-type phenotype of the mycelium, and the strains were afterwards examined for the restoration of spore germination. Sixteen pools of 192 clones each from a wild-type genomic DNA library constructed in the pMOcosX cosmid (LOUBRADOU et al. 1996 Down) were used to transform protoplasts of the mod-D1 strain. One strain out of the 2300 transformant strains displayed a wild-type phenotype on synthetic medium and a wild-type spore germination rate. The corresponding cosmid was isolated by SIB selection (AKINS and LAMBOWITZ 1985 Down). Genetic analysis of three transformants showed that for two of them the cosmid was integrated at the mod-D locus. The complementation was likely due to rescue of mod-D gene function and not to the cloning or creation of an unlinked suppressor. This result was confirmed by the characterization of the sites mutated in the mod-D mutant alleles (see below).

MOD-D is an {alpha} subunit of a heterotrimeric G protein:
Ectopic integration of a 3057-bp PstI-KpnI fragment fully complements the defects due to the mod-D1 mutation. The sequence of the fragment encompassing mod-D revealed the presence of an open reading frame (ORF) of 1374 bp interrupted by five putative introns according to consensus sequences for filamentous fungi splicing sites (BALLANCE 1991 Down; BRUCHEZ et al. 1993 Down; Figure 1). The gene has the ability to encode a 354-amino acid (aa) polypeptide. The comparison between the mod-D-encoded polypeptide, designated MOD-D, and the protein sequences in the GenBank database indicated strong similarities with all {alpha} subunits of heterotrimeric G proteins. For example, 87.5, 87, 69, 69, and 65% identity were observed with magA from Magnaporthe grisea (LIU and DEAN 1997 Down), CPG-2 from Cryphonectria parasitica (CHOI et al. 1995 Down), Gpa3 from Ustilago maydis (REGENFELDER et al. 1997 Down), Fil1 from Ustilago hordei (LICHTER and MILLS 1997 Down), and Gpa1 from Cryptococcus neoformans (TOLKACHEVA et al. 1994 Down), respectively. The consensus sequences for the GTP-binding site, sequences G-1, G-2, G-3, G-4, and G-5 (BOURNE et al. 1991 Down), are all present in the MOD-D sequence (Figure 1). These results show that MOD-D encodes an {alpha} subunit of a heterotrimeric G protein.

Different families have been defined for G{alpha} proteins from higher eucaryotes (SIMON et al. 1991 Down). In fungi, such classification has not been established before but a previous phylogenetic analysis indicates that several subgroups could be identified (REGENFELDER et al. 1997 Down). We did a similar analysis including MOD-D. This was performed by using the Phylogeny Inference package version 5.3c. (FELSENSTEIN 1993 Down; Figure 2). The results show that MOD-D, magA from M. grisea, CPG-2 from C. parasitica, Gpa1 from C. neoformans, Fil1 from U. hordei, and Gpa3 from U. maydis may define a family of G{alpha} proteins in fungi. The yeast Gpa2 proteins from Kluyveromyces lactis, Saccharomyces cerevisiae, and Schizosaccharomyces pombe could be related to this family since they belong to the same branch of the phylogenetic tree. Sequence comparisons show that MOD-D from P. anserina, magA from M. grisea, CPG-2 from C. parasitica, Gpa1 from C. neoformans, Fil1 from U. hordei, and Gpa3 from U. maydis share a very high level of identity in their C-terminal half. There is 84% identity among MOD-D, CPG-2, magA, Gpa3, Fil1, and Gpa1 within the last 56 amino acids, but only 40% identity within the same region if Gpa1 or Gpa2 from U. maydis is included in the comparison (REGENFELDER et al. 1997 Down; Figure 2). This strong sequence conservation is therefore specific for this particular family and not observed for all fungal G{alpha} proteins.



View larger version (30K):
In this window
In a new window
Download PPT slide
 
Figure 2. Comparison of fungal G protein {alpha} subunits. The initial sequence alignment was produced by CLUSTAL W (THOMPSON et al. 1994 Down) and the tree was then constructed using PROTDIST, FITCH, and DRAWTREE programs from the Phylogeny Inference package version 5.3c. (FELSENSTEIN 1993 Down). An-FadA is FadA from A. nidulans (YU et al. 1996 Down), Ca-Cag1 is Cag1 from Candida albicans (SADHU et al. 1992 Down), Cc-Gpa1 is Gpa1 from Coprinus congregatus (KOZAK et al. 1995 Down), Cn-Gpa1 is Gpa1 from C. neoformans (TOLKACHEVA et al. 1994 Down), Cp-CPG-1 and Cp-CPG-2 are CPG-1 and CPG-2 from C. parasitica (CHOI et al. 1995 Down), Kl-Gpa2 is Gpa2 from K. lactis (SAVINON-TEJEDA et al. 1996 Down), Mg-magA, Mg-magB, and Mg-magC are magA, magB, and magC from M. grisea (LIU and DEAN 1997 Down), Nc-GNA-1 and Nc-GNA-2 are GNA-1 and GNA-2 from N. crassa (TURNER and BORKOVICH 1993 Down), Pa-MOD-D is MOD-D from P. anserina, Pc-PCG1 is PCG1 from Pneumocistis carinii (SMULIAN et al. 1996 Down), Sc-Gpa1 and Sc-Gpa2 are Gpa1 and Gpa2 from S. cerevisiae (NAKAFUKU et al. 1987 Down, NAKAFUKU et al. 1988 Down), Sp-Gpa2 and Sp-Gpa1 are Gpa1 and Gpa2 from S. pombe (OBARA et al. 1991 Down; ISSHIKI et al. 1992 Down), Uh-Fil1 is Fil1 from U. hordei (LICHTER and MILLS 1997 Down), Um-Gpa1, Um-Gpa2, Um-Gpa3, and Um-Gpa4 are Gpa1, Gpa2, Gpa3, and Gpa4 from U. maydis (REGENFELDER et al. 1997 Down).

Identification of mutations in mod-D mutant alleles:
Relations between structure and function have been extensively studied for G{alpha} proteins (for reviews see CONKLIN and BOURNE 1993 Down; NEER 1995 Down). To obtain information on the functional defect of the mod-D mutant proteins, we identified the mutations present in mod-D mutant alleles. The three mod-D mutant genes were isolated from genomic DNA by PCR. Two clones from distinct PCR reactions were sequenced for each mutant and a unique mutation was identified for each allele (Figure 1). In mod-D1 and mod-D3, the mutation is located in the 3' acceptor site of the second and fourth introns, respectively. In the mod-D2 allele, the stop codon is mutated. The next stop codon in the sequence is located 62 codons downstream from the stop codon of the wild-type ORF. Therefore, the consequence of the mod-D2 mutation should be a protein with an additional C-terminal sequence of 62 aa. The consequences of mod-D1 and mod-D3 mutations on the function of the protein are difficult to predict because they depend on the splicing positions in the mutant mRNA. As mod-D1 and mod-D3 mutations induce similar phenotypes, the mutant proteins presumably share similar functional defects. We decided to analyze only the splicing of mod-D1 mRNA.

MOD-D1 could be unable to activate its effector:
cDNA was synthesized from mod-D1 mRNA and amplified by PCR using internal specific primers. These primers amplify a fragment corresponding to positions 1676-2857 in the genomic DNA (Figure 1). The fragment includes the last four introns of the gene. Two fragments with equal intensity were visualized after migration of the PCR products on agarose gel with ethidium bromide staining. Thus the amount of the two mRNA populations is equivalent. These fragments were cloned. Only one clone with the large fragment and six clones with the short fragment were partially sequenced to determine splicing junctions for the second and the fifth introns. In all cases, the fifth intron was absent, showing that all sequenced fragments were derived from mod-D1 cDNA and not from genomic DNA. The sequence of the large fragment showed that the second intron is still present, whereas in the short fragment, the second intron is absent but the splicing occurred at different positions. Five of the six clones were spliced using the first G downstream from the mutated position, whereas the last one was spliced using the first AG following the mutated position. Nevertheless, whether the splicing occurs at these alternative positions or not, as in the large fragment, in all cases a stop codon is present immediately downstream from the end of the second exon. A truncated protein of 155 aa should be synthesized.

Previous studies on G{alpha} subunits revealed that the sequences interacting with effectors are all located in the C-terminal half of the protein (for review see CONKLIN and BOURNE 1993 Down). This part of the protein should be absent in the MOD-D1 polypeptide, suggesting that the mutant protein would be unable to activate its effector.

The mod-D1 and mod-D3 mutant phenotypes can be partially restored by an increase of the level of cAMP:
A possible relation between the function of mod-D and cyclic AMP was suggested by the cloning of the PaAC gene as a partial suppressor of the mod-D1 mutant (LOUBRADOU et al. 1996 Down). To verify this relationship, the wild-type and mod-D mutant strains were grown under conditions that increase the cAMP level. The growth of the wild-type strain and of the three mod-D mutant strains was examined on synthetic medium supplemented with 10 mM dibutyryl cAMP, an analog of cAMP (Figure 3). On this medium, mod-D1 and mod-D3 mutant strains, filament network, and aerial filament density were clearly increased but no effect was observed on the phenotype of the mod-D2 mutant. We noted an unexpected slight effect of the dibutyryl cAMP on the wild-type strain. In this case, unlike mutant strains, density of filament network and aerial filaments situated in the center of the colony was decreased. Nevertheless, on synthetic medium supplemented with 10 mM dibutyryl cAMP, the wild-type strain is less damaged than mutant strains. The dibutyryl cAMP effect does not seem to be an indirect effect unrelated to mod-D mutation since it has no effect on the mod-D2 mutant strain. To confirm this, an inhibitor of phosphodiesterase, theophylline, was used to decrease cAMP hydrolysis. In C. parasitica, a close relative of P. anserina, this drug can induce an eightfold increase of the cAMP level, and this is a more efficient phosphodiesterase inhibitor than other xanthine derivatives such as caffeine or IBMX (3-isobutyl-1-methylxanthine; CHEN et al. 1996 Down). As for dibutyryl cAMP, partial restoration of a wild-type phenotype was obtained for mod-D1 and mod-D3 mutants when synthetic medium was supplemented with 4 mM theophylline (data not shown). Once again, no restoration of mod-D2 mutant growth was obtained in this medium.



View larger version (87K):
In this window
In a new window
Download PPT slide
 
Figure 3. Vegetative growth of the wild-type, mod-D1, mod-D2, and mod-D3 strains on synthetic medium and synthetic medium supplemented with 10 mM dibutyryl cAMP.

These findings suggest that mod-D1 and mod-D3 mutations likely result in a decrease of cAMP concentration since an increase of the cAMP level partly restores the vegetative growth of these mutants. These results also support the idea that the suppressor effect on the mod-D1 mutant of an additional ectopic copy of PaAC is due to its adenylate cyclase activity and not to any side effect.

MOD-D2 mutant protein is not constitutively active:
The difference observed in response to cAMP suggests that the mod-D1 and mod-D2 mutations do not lead to the same functional defect. MOD-D1 would be defective in activating its effector. Is MOD-D2 constitutively activated? To answer the question, a mutation known to activate constitutively G{alpha} proteins (LANDIS et al. 1989 Down; LYONS et al. 1990 Down) was generated using site-directed mutagenesis. The arginine residue at position 180 was replaced by a cysteine (Figure 1). The mutant allele was named mod-DR180C. Protoplasts from wild-type strain were transformed with mod-DR180C and the phenotype of the transformants was analyzed on synthetic medium. Strains containing this mod-D mutant allele display a very dense mycelial network with aerial filaments and exhibit an intense and premature pigmentation. This phenotype is the opposite of the mod-D2 phenotype, which is characterized by a defect in secondary and aerial hyphae formation and a lack of pigmentation. Therefore, it is unlikely that mod-D2 encodes a constitutively activated protein. The phenotype due to mod-DR180C also confirms the involvement of mod-D in the production of these differentiated mycelial structures since it is possible to obtain mod-D mutations that either strongly enhance or drastically reduce their formation.

The suppressor effect of mod-D1 on vegetative incompatibility is not due to a decrease in the level of cAMP:
The mod-D1 mutation and the mod-B mutations were isolated as suppressors of the autolytic phenotype of the het-C het-E mod-A1 mod-C1 strain (LABARERE and BERNET 1979A Down). The mod-D2 and mod-D3 mutations were selected to inhibit the autolysis due to the mod-B11 mutation (DURRENS et al. 1979 Down). These functional relations between mod-D and mod-B led us to test if the mod-D mutations, like the mod-B mutations, would suppress the cryosensitivity of the het-C het-E mod-A1 strain (BERNET et al. 1973 Down). The radial growth of the het-C het-E mod-A1, het-C het-E mod-A1 mod-D1, and het-C het-E mod-A1 mod-D2 strains was compared at 11° (Figure 4). A restoration of growth is observed at this temperature for both mod-D mutations. However, this effect is less pronounced than the one noticed in the presence of the mod-B1 mutation. The het-C het-E mod-A1 mod-B1 strain exhibits after 25 days a radial growth that is ~80% of that of wild type at 11° (BOUCHERIE 1979 Down), but the rate is only 30% of wild-type growth for a het-C het-E mod-A1 mod-D1 strain.



View larger version (17K):
In this window
In a new window
Download PPT slide
 
Figure 4. Partial suppression of the cold sensitivity of the het-C het-E mod-A1 strain by mod-D1 and mod-D2 mutations. The radial growth at 11° on D0 medium of the WT, het-C het-E mod-A1, het-C het-E mod-A1 mod-D1, and het-C het-E mod-A1 mod-D2 strains was measured on a time basis. Each point corresponds to the average of four independent measures. Bars mark standard errors.

This effect of the mod-D mutations on vegetative incompatibility led us to investigate a possible involvement of cAMP on vegetative incompatibility. The wild-type, het-C het-E mod-A1, and het-C het-E mod-A1 mod-D1 strains were grown at 11° on D0 medium supplemented or not with 10 mM dibutyryl cAMP. For all of the strains, the addition of dibutyryl cAMP stimulated growth independently of the presence of the mod-D1 mutation (data not shown). The growth restoration of the het-C het-E mod-A1 mod-D1 strain does not appear to be the consequence of a decreased level of cAMP. Therefore, this restoration is probably not linked to the defect in the cAMP pathway resulting from the mod-D1 mutation.


*  DISCUSSION
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

The characterization of previously described mod genes in the fungus P. anserina has been undertaken to elucidate the molecular mechanism of vegetative incompatibility and to understand the relationship between this process and some developmental steps in this species. Three mod-D mutants have been isolated using two distinct screening procedures. These two procedures were designed for selecting mutations in genes that would be involved in the control of the cell lysis reaction due to vegetative incompatibility (DURRENS et al. 1979 Down; LABARERE and BERNET 1979A Down). In this article, we report the cloning of the mod-D gene. The MOD-D protein is a G{alpha} subunit of a heterotrimeric G protein. Two other genes, which display functional interactions with mod-D, have been previously characterized: mod-E and PaAC. They encode, respectively, an HSP90 (LOUBRADOU et al. 1997 Down) and an adenylate cyclase (LOUBRADOU et al. 1996 Down), indicating that proteins encoded by mod genes belong to signal transduction pathways.

The mod-D2 phenotype may correspond to the loss of function of both MOD-D and Gß{gamma}-associated subunits:
All of the mod-D1 cDNAs analyzed encode a polypeptide lacking the C-terminal half of the wild-type protein. This part of the protein is known to be involved in the binding to the effectors (for review see CONKLIN and BOURNE 1993 Down), suggesting that the MOD-D1 protein would have lost this property. The mod-D2 mutant displays more altered defects in development than a mod-D1 strain. Unlike mod-D1, none of the defects displayed by the mod-D2 mutant strain can be restored by an increase of the cAMP level. Furthermore, a constitutively active MOD-D mutant protein induces a phenotype that is opposite to the mod-D2 mutant phenotype; thus, the mod-D2 mutant does not correspond to a constitutive activation of the G protein. The differences observed as the consequence of mod-D1 and mod-D2 mutations could then be explained by a different behavior of the G{alpha} mutant proteins toward the ß{gamma} subunits. As the C-terminal end of G{alpha} proteins is important for the binding to the receptor (for review see CONKLIN and BOURNE 1993 Down), a hypothesis could be that the MOD-D2 protein is unable to bind to the receptor. The additional amino acids present in the C-terminal part of MOD-D2, due to the suppression of the stop codon by the mutation, could induce some structural modifications preventing the binding. In this hypothesis, the mod-D2 phenotype would correspond to both loss of MOD-D activation and loss of Gß{gamma} subunits activation. This hypothesis would also imply that both {alpha} and ß{gamma} subunits have effectors. Such a result has already been reported in Aspergillus nidulans. A strain, in which the fadA mutant gene encoding a G{alpha} subunit inhibits the release of Gß{gamma} subunits, exhibits a more-altered phenotype than the strain in which the fadA gene has been deleted (YU et al. 1996 Down).

mod-D and vegetative incompatibility: evidence for a second pathway controlled by mod-D:
The effect of mod-D mutations on vegetative incompatibility was investigated on the cryosensitive het-C het-E mod-A1 incompatible strain. This strain is unable to grow at 11°. The mod-A1 mutant strain and the wild-type strain are able to grow at 11°. The growth inhibition is due to the presence of the two het-C and het-E incompatible genes. In the presence of either mod-D1 or mod-D2 mutations, the growth of the cryosensitive het-C het-E mod-A1 strain is partly restored at 11°. This result confirms the involvement of the mod-D gene in vegetative incompatibility. The het-C, het-E, and mod-A genes have been isolated and sequenced. They encode, respectively, a protein with identity to a glycolipid transfer protein (SAUPE et al. 1994 Down), a protein with a functional GTP-binding site and WD40 repeats (SAUPE et al. 1995 Down; ESPAGNE et al. 1997 Down), and a protein that contains potential SH3-binding sites (BARREAU et al. 1998 Down). The functional interactions between these genes remain unclear but their sequences reveal a probable involvement in signal transduction in agreement with our results.

An increase of the cAMP level does not attenuate the growth restoration due to the mod-D1 mutation in the het-C het-E mod-A1 mod-D1 strain. This result seems to indicate that the growth restoration observed is not due to a decrease in the cAMP level resulting from the presence of the mod-D1 mutation. It also indicates that the mod-D1 mutation induces some defects in a signaling pathway distinct from the cAMP pathway. The characterization of this second pathway responsible for the mod-D1 effect on vegetative incompatibility is now under investigation.

A family of fungal G{alpha} subunits involved in cAMP signal transduction pathway:
MOD-D from P. anserina, magA from M. grisea, CPG-2 from C. parasitica, Gpa3 from U. maydis, Fil1 from U. hordei, and Gpa1 from C. neoformans may define a new family of G{alpha} proteins. They are characterized by a highly conserved C-terminal region. The C-terminal region of G{alpha} proteins is involved in effector and receptor binding (for review see CONKLIN and BOURNE 1993 Down). This family of G{alpha} proteins may interact with the same type of receptor and effector. The hypothesis of a conserved pathway for these G{alpha} proteins is not based only on sequence similarity but also on the positive regulatory role of MOD-D, CPG-2, Gpa3, Fil1, and Gpa1 on the level of cAMP. The disorders in mod-D1 and mod-D3 strains during vegetative growth can be restored by an increase of the cAMP level. In the same way, the strains deleted for gpa1, gpa3, Fil1, and cpg-2 are deficient in cAMP production (CHOI et al. 1995 Down; GAO and NUSS 1996 Down; MILLS et al. 1996 Down; ALSPAUGH et al. 1997 Down; KAHMANN and BASSE 1997 Down). It is also interesting to note that the most closely related proteins to this family are proteins encoded by GPA2 genes from the yeasts S. cerevisiae, S. pombe, and K. lactis; the function of these proteins is to regulate positively the cAMP level (ISSHIKI et al. 1992 Down; SAVINON-TEJEDA et al. 1996 Down; KUBLER et al. 1997 Down; LORENZ and HEITMAN 1997 Down).

The MOD-D protein is involved in both the sexual cycle of P. anserina (by controlling key steps in protoperithecia formation and spore germination) and vegetative development (DURRENS et al. 1979 Down; LABARERE and BERNET 1979A Down, LABARERE and BERNET 1979B Down). The involvement of Gpa3 from U. maydis and GPA1 from C. neoformans in pathogenicity and in the mating reaction has been demonstrated (ALSPAUGH et al. 1997 Down; REGENFELDER et al. 1997 Down). This mating function is linked to the cAMP pathway in C. neoformans (ALSPAUGH et al. 1997 Down). The phenotype described for the strain deleted for Fil1 is in accordance with such functions, and this gene also interferes with the dimorphic switch in U. hordei (LICHTER and MILLS 1997 Down). No clear information is available so far on the physiological function of cpg-2. Surprisingly, it seems to be dispensable for virulence and both sexual and asexual reproduction. These steps are controlled by cpg-1, the other G{alpha} subunit characterized in C. parasitica (CHOI et al. 1995 Down; CHEN et al. 1996 Down; GAO and NUSS 1996 Down). A similar situation is observed in M. grisea. The magA protein appears to be necessary only for ascospore maturation and/or germination, while the magB polypeptide that shares 99% identity with CPG-1 seems to control many aspects of the life cycle, including a well-defined cAMP-dependent step involving appressorium formation (LIU and DEAN 1997 Down). CPG-1 negatively regulates the adenylate cyclase, as expected from a protein that belongs to the fungal G{alpha}i family (GAO and NUSS 1996 Down), but unexpectedly, magB deletion seems to induce a decrease of the cAMP level. A strain in which magB has been inactivated can recover appressorium formation if external cAMP or phospodiesterase inhibitor is added (LIU and DEAN 1997 Down). This result is in contradiction with the results of the phylogenetic analysis but it may be due to an indirect effect of the mutation. For example, the cells containing the magB mutation may need a higher level of cAMP than the wild type to undergo appressorium formation.

From all of these data, it is difficult to propose a model for the function of the signal transduction cascade controlled by MOD-D family G{alpha} subunit proteins. This may be due to the natural environment diversity of these species. The signals dependent on these G{alpha} proteins may be very different for a fungus living in animal brains, on plant leaves, or on herbivore dungs.

The growing interest in fungi signal transduction and the key role of G{alpha} proteins in this family will certainly lead to a rapid increase of family members. The study of these genes in our laboratory and others will allow determination of the precise characteristics of this potentially conserved pathway. In this respect, P. anserina is an excellent paradigm since there is evidence for the existence of a second signaling transduction pathway regulated by mod-D and a possible active role for Gß{gamma} subunits.


*  ACKNOWLEDGMENTS

This work was supported by a grant from the Association pour la Recherche sur le Cancer. G.L. was supported by a fellowship from the Association pour la Recherche sur le Cancer.

Manuscript received June 5, 1998; Accepted for publication March 10, 1999.


*  LITERATURE CITED
*TOP
*ABSTRACT
*MATERIALS AND METHODS
*RESULTS
*DISCUSSION
*LITERATURE CITED

AKINS, R. A. and A. M. LAMBOWITZ, 1985  General method for cloning Neurospora crassa nuclear genes by complementation of mutants. Mol. Cell. Biol. 5:2272-2278[Abstract/Free Full Text].

ALSPAUGH, J. A., J. R. PERFECT, and J. HEITMAN, 1997  Cryptococcus neoformans mating and virulence are regulated by the G-protein {alpha} subunit GPA1 and cAMP. Genes Dev. 11:3206-3217[Abstract/Free Full Text].

ARGANOZA, M. T., J. OHRNBERGER, J. MIN, and R. A. AKINS, 1994  Suppressor mutants of Neurospora crassa that tolerate allelic differences at single or at multiple heterokaryon incompatibility loci. Genetics 137:731-742[Abstract].

BALLANCE, D. J., 1991 Transformation systems for filamentous fungi and an overview of fungal gene structure, pp. 1–29, in Molecular Industrial Mycology, edited by S. A. LEONG and R. M. BERKA. Marcel Dekker Inc., New York.

BARREAU, C., M. ISKANDAR, G. LOUBRADOU, V. LEVALLOIS, and J. BÉGUERET, 1998  The mod-A suppressor of non-allelic heterokaryon incompatibility in Podospora anserina encodes a proline-rich polypeptide involved in female organs formation. Genetics 149:915-926[Abstract/Free Full Text].

GUERET, J., B. TURCQ, and C. CLAVÉ, 1994  Vegetative incompatibility in filamentous fungi: het genes begin to talk. Trends Genet. 10:441-446[Medline].

BELCOUR, L. and J. BERNET, 1969  Sur la mise en évidence d'un gène dont la mutation supprime spécifiquement certaines manifestations d'incompatibilité chez le Podospora anserina.. C. R. Acad. Sci. Paris 269:712-714.

BERGÈS, T. and C. BARREAU, 1989  Heat-shock at an elevated temperature improves transformation efficiency of protoplasts from Podospora anserina.. J. Gen. Microbiol. 135:601-604[Medline].

BERNET, J., 1971  Sur un cas de suppression de l'incompatibilité cellulaire chez le champignon Podospora anserina.. C. R. Acad. Sci. Paris 273:1120-1122.

BERNET, J., J. BÉGUERET, and J. LABARÈRE, 1973  Incompatibility in the fungus Podospora anserina. Are the mutations abolishing the incompatibility reaction ribosomal mutation? Mol. Gen. Genet. 124:35-50[Medline].

BOUCHERIE, H., 1979 L'incompatibilité protoplasmique chez Podospora anserina: caractérisation et regulation des variations physiologiques associées, relation avec la différenciation des organes reproducteurs femelles. Ph.D. Thesis, University of Bordeaux II, Bordeaux, France.

BOUCHERIE, H., J. BÉGUERET, and J. BERNET, 1976  The molecular mechanism of protoplasmic incompatibility and its relationship to the formation of protoperithecia in Podospora anserina.. J. Gen. Microbiol. 92:59-66[Medline].

BOURNE, H. R., D. A. SANDERS, and F. MCCORMICK, 1991  The GTPase superfamily: conserved structure and molecular mechanism. Nature 349:117-127[Medline].

BRUCHEZ, J. J. P., J. EBERLE, and V. E. A. RUSSO, 1993  Regulatory sequences in the transcription of Neurospora crassa genes: CAAT box, TATA box, introns, poly(A) tail formation sequences. Fungal Genet. Newsl. 40:89-96.

CHEN, B., S. GAO, G. H. CHOI, and D. L. NUSS, 1996  Extensive alteration of fungal gene transcript accumulation and elevation of G-protein-regulated cAMP levels by a virulence-attenuating hypovirus. Proc. Natl. Acad. Sci. USA 93:7996-8000[Abstract/Free Full Text].

CHOI, G. H., B. CHEN, and D. L. NUSS, 1995  Virus-mediated or transgenic suppression of a G-protein {alpha} subunit and attenuation of fungal virulence. Proc. Natl. Acad. Sci. USA 92:305-309[Abstract/Free Full Text].

CONKLIN, B. R. and H. R. BOURNE, 1993  Structural elements of G{alpha} subunits that interact with Gß{gamma}, receptors, and effectors. Cell 73:631-641[Medline].

CSERMELY, P., T. SCHNAIDER, C. SOTI, Z. PROHASZKA, and G. NARDAI, 1998  The 90-kDA molecular chaperone family: structure, function, and clinical applications. A comprehensive review. Pharmacol. Ther. 79:129-168[Medline].

DURRENS, P., 1982  Podospora anserina mutants defective in cell regeneration and ascospore germination: the presence of a possible lesion of the plasma membrane. Exp. Mycol. 6:216-224.

DURRENS, P., 1984  Podospora anserina mutation reducing cell survival under glucose starvation. Exp. Mycol. 8:342-348.

DURRENS, P. and J. BERNET, 1982  Podospora anserina mutations inhibiting several development alternatives and growth renewal. Curr. Genet. 5:181-186.

DURRENS, P., F. LAIGRET, J. LABARÈRE, and J. BERNET, 1979  Podospora anserina mutant defective in protoperithecium formation, ascospore germination, and cell regeneration. J. Bacteriol. 140:835-842[Abstract/Free Full Text].

ESPAGNE, E., P. BALHADÈRE, J. BÉGUERET, and B. TURCQ, 1997  Reactivity in vegetative incompatibility of the HET-E protein of the fungus Podospora anserina is dependent on GTP-binding activity and WD40 repeated domain. Mol. Gen. Genet. 256:620-627[Medline].

ESSER, K., 1974 Podospora anserina, pp. 531–551 in Handbook of Genetics, edited by R. C. KING. Plenum Press, New York.

FELSENSTEIN, J., 1993 PHYLIP (Phylogeny Inference Package) version 3.5c. Department of Genetics, University of Washington, Seattle.

GAO, S. and D. L. NUSS, 1996  Distinct roles for two G protein {alpha} subunits in fungal virulence, morphology, and reproduction revealed by targeted gene disruption. Proc. Natl. Acad. Sci. USA 93:14122-14127[Abstract/Free Full Text].

GLASS, N. L. and G. A. KULDAU, 1992  Mating type and vegetative incompatibility in filamentous ascomycetes. Annu. Rev. Phytopathol. 30:201-224[Medline].

GLASS, N. L., S. J. VOLLMER, C. STABEN, J. GROTELUESCHEN, and R. L. METZENBERG et al., 1988  DNAs of the two mating-type alleles of Neurospora crassa are highly dissimilar. Science 241:570-573[Abstract/Free Full Text].

GLASS, N. L., J. GROTELUESCHEN, and R. L. METZENBERG, 1990  Neurospora crassa A mating type region. Proc. Natl. Acad. Sci. USA 87:4912-4916[Abstract/Free Full Text].

ISSHIKI, T., N. MOCHIZUKI, T. MAEDA, and M. YAMAMOTO, 1992  Characterization of a fission yeast gene gpa2, that encodes a G{alpha} subunit involved in the monitoring of nutrition. Genes Dev. 6:2455-2462[Abstract/Free Full Text].

KAHMANN, R. and C. BASSE, 1997  Signaling and development in pathogenic fungi—new strategies for plant protection? Trends Plant Sci. 2:366-368.

KOZAK, K. R., L. M. FOSTER, and I. K. ROSS, 1995  Cloning and characterization of a G protein alpha-subunit-encoding gene from the basidiomycete, Coprinus congregatus.. Gene 163:133-137[Medline].

BLER, E., H. U. MOSCH, S. RUPP, and M. P. LISANTI, 1997  Gpa2p, a G-protein alpha-subunit, regulates growth and pseudohyphal development in Saccharomyces cerevisiae via a cAMP-dependent mechanism. J. Biol. Chem. 272:20321-20323[Abstract/Free Full Text].

LABARÈRE, J. and J. BERNET, 1977  Protoplasmic incompatibility and cell lysis in Podospora anserina. I. Genetic investigation on mutations of a novel modifier gene that suppresses cell destruction. Genetics 87:249-257[Abstract/Free Full Text].

LABARÈRE, J. and J. BERNET, 1979a  A pleiotropic mutation affecting protoperithecium formation and ascospore outgrowth in Podospora anserina.. J. Gen. Microbiol. 113:19-27.

LABARÈRE, J. and J. BERNET, 1979b  Protoplasmic incompatibility in Podospora anserina: a possible role for its associated proteolytic activity. Genetics 93:525-537[Abstract/Free Full Text].

LANDIS, C. A., S. B. MASTERS, A. SPADA, A. M. PACE, and H. R. BOURNE et al., 1989  GTPase inhibiting mutations activate the {alpha} chain of Gs and stimulate adenylyl cyclase in human pituitary tumors. Nature 340:692-696[Medline].

LECELLIER, G. and P. SILAR, 1994  Rapid methods for nucleic acids extraction from Petri dish-grown mycelia. Curr. Genet. 25:122-123[Medline].

LICHTER, A. and D. MILLS, 1997  Fil1, a G-protein {alpha}-subunit that acts upstream of cAMP and is essential for dimorphic switching in haploid cells of Ustilago hordei.. Mol. Gen. Genet. 256:426-435[Medline].

LIU, S. and R. A. DEAN, 1997  G protein alpha subunit genes control growth, development, and pathogenicity of Magnaporthe grisea.. Mol. Plant-Microbe Interact. 10:1075-1086[Medline].

LORENZ, M. C. and J. HEITMAN, 1997  Yeast pseudohyphal growth is regulated by GPA2, a G protein alpha homolog. EMBO J. 16:7008-7018[Medline].

LOUBRADOU, G., J. BÉGUERET, and B. TURCQ, 1996  An additional copy of the adenylate cyclase gene relieves developmental defects produced by a mutation in a gene involved in vegetative incompatibility in Podospora anserina.. Gene 170:119-123[Medline].

LOUBRADOU, G., J. BÉGUERET, and B. TURCQ, 1997  A mutation in an HSP90 gene affects the sexual cycle and suppresses vegetative incompatibility in the fungus Podospora anserina.. Genetics 147:581-588[Abstract].

LYONS, J., C. A. LANDIS, G. HARSH, L. VALLAR, and K. GRÜNEWALD et al., 1990  Two G protein oncogenes in human endocrine tumors. Science 249:655-659[Abstract/Free Full Text].

MILLS, D., J. AGNAN and K. MCCLUSTER, 1996 Cyclic AMP controls dimorphic switching of Ustilago hordei, pp. 83–92 in Molecular Aspect of Pathogenicity and Resistance: Requirement for Signal Trans-jyduction, edited by D. MILLS, H. KUNOH, N. T. KEENAND and S. MAYAMA. APS Press, St. Paul.

NAKAFUKU, M., H. ITOH, S. NAKAMURA, and Y. KAZIRO, 1987  Occurrence in Saccharomyces cerevisiae of a gene homologous to the cDNA coding for the alpha-subunit of mammalian G proteins. Proc. Natl. Acad. Sci. USA 84:2140-2144[Abstract/Free Full Text].

NAKAFUKU, M., T. OBARA, K. KAIBUCHI, I. MIYAJIMA, and A. MIYAJIMA et al., 1988  Isolation of a second yeast Saccharomyces cerevisiae gene (GPA2) coding for guanine nucleotide-binding regulatory protein: studies on its structure and possible functions. Proc. Natl. Acad. Sci. USA 85:1374-1378[Abstract/Free Full Text].

NEER, E. J., 1995  Heterotrimeric G proteins: organizers of transmembrane signals. Cell 80:249-257[Medline].

NEWMEYER, D., 1970  A suppressor of the heterokaryon-incompatibility associated with mating type in Neurospora crassa.. Can. J. Genet. Cytol. 12:914-926[Medline].

OBARA, T., M. NAKAFUKU, M. YAMAMOTO, and Y. KAZIRO, 1991  Isolation and characterization of a gene encoding a G-protein alpha subunit from Schizosaccharomyces pombe: involvement in mating and sporulation pathways. Proc. Natl. Acad. Sci. USA 88:5877-5881[Abstract/Free Full Text].

ORBACH, M. J., A. SWEIGARD, A. WALTER, L. FARRAL, and F. G. CHUMLEY et al., 1991  Strategies for the isolation of the avirulence genes from the rice blast Magnaporthe grisea.. Fungal Genet. Newsl. 38:16.

PONCE, M. R. and J. L. MICOL, 1992  PCR amplification of long DNA fragments. Nucleic Acids Res. 20:663.

REGENFELDER, E., T. SPELLIG, A. HARTMANN, S. LAUENSTEIN, and M. BÖLKER et al., 1997  G proteins in Ustilago maydis: transmission of multiple signals? EMBO J. 16:1934-1942[Medline].

RIZET, G. and C. ENGELMAN, 1949  Contribution à l'étude d'un ascomycète tétrasporé: Podospora anserina. Rev. Cytol. et Biol Veg. 11:201-304.

SADHU, C., D. HOEKSTRA, M. J. MCEACHERN, S. I. REED, and J. B. HICKS, 1992  A G-protein alpha subunit from asexual Candida albicans functions in the mating signal transduction pathway of Saccharomyces cerevisiae and is regulated by the a1-alpha-2 repressor. Mol. Cell. Biol. 12:1977-1985[Abstract/Free Full Text].

SAIKI, R. K., D. H. GELFAND, S. STOFFEL, S. J. SCHARF, and R. HIGUSHI et al., 1988  Primed-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239:487-491[Abstract/Free Full Text].

SAMBROOK, J., E. F. FRITSCH and T. MANIATIS, 1989 Molecular Cloning: A Laboratory Manual, Ed. 2. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

SANGER, F., S. NICKLEN, and A. R. COULSON, 1977  DNA sequencing with chain terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463-5467[Abstract/Free Full Text].

SAUPE, S., C. DESCAMPS, B. TURCQ, and J. BÉGUERET, 1994  Inactivation of the Podospora anserina vegetative incompatibility locus het-c, whose product resembles a glycolipid transfer protein, drastically impairs ascospore production. Proc. Natl. Acad. Sci. USA 91:5927-5931[Abstract/Free Full Text].

SAUPE, S., B. TURCQ, and J. BÉGUERET, 1995  A gene responsible for vegetative incompatibility in the fungus Podospora anserina encodes a protein with a GTP-binding motif and Gß homologous domain. Gene 162:135-139[Medline].

SAUPE, S. J., G. A. KULDAU, M. L. SMITH, and N. L. GLASS, 1996  The product of the het-C heterokaryon incompatibility gene of Neurospora crassa has characteristics of a glycine-rich cell wall protein. Genetics 143:1589-1600[Abstract].

SAVINON-TEJEDA, A. L., L. ONGAY-LARIOS, J. RAMIREZ, and R. CORIA, 1996  Isolation of a gene encoding a G protein alpha subunit involved in the regulation of cAMP levels in the yeast Kluyveromyces lactis.. Yeast 12:1125-1133[Medline].

SIMON, M. I., M. P. STRATHMANN, and N. GAUTAM, 1991  Diversity of G proteins in signal transduction. Science 252:802-808[Abstract/Free Full Text].

SMULIAN, A. G., M. RYAN, C. STABEN, and M. CUSHION, 1996  Signal transduction in Pneumocystis carinii: characterization of the genes (pcg1) encoding the alpha subunit of the G protein (PCG1) of Pneumocystis carinii carinii and Pneumocystis carinii ratti.. Infect. Immun. 64:691-701[Abstract].

STABEN, C. and C. YANOFSKY, 1990  Neurospora crassa a mating type region. Proc. Natl. Acad. Sci. USA 87:4917-4921[Abstract/Free Full Text].

THOMPSON, J. D., D. G. HIGGINS, and T. J. GIBSON, 1994  CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673-4680[Abstract/Free Full Text].

TOLKACHEVA, T., P. MCNAMARA, E. PIEKARZ, and W. COURCHESNE, 1994  Cloning of a Cryptococcus neoformans gene, GPA1, encoding a G-protein {alpha}-subunit homolog. Infect. Immun. 62:2849-2856[Abstract/Free Full Text].

TURCQ, B. and J. BÉGUERET, 1987  The ura5 gene of the filamentous fungus Podospora anserina: nucleotide sequence and expression in transformed strains. Gene 53:201-209[Medline].

TURCQ, B., M. DENAYROLLES, and J. BÉGUERET, 1990  Isolation of the two allelic incompatibility genes s and S of the fungus Podospora anserina.. Curr. Genet. 17:297-303.

TURNER, G. E. and K. A. BORKOVICH, 1993  Identification of a G protein {alpha} subunit from Neurospora crassa that is a member of the Gi family. J. Biol. Chem. 268:14805-14811[Abstract/Free Full Text].

VELLANI, T. S., A. J. GRIFFITHS, and N. L. GLASS, 1994  New mutations that suppress mating-type vegetative incompatibility in Neurospora crassa.. Genome 37:249-255[Medline].

YU, J.-H., J. WEISER, and T. H. ADAMS, 1996  The Aspergillus FlbA RGS domain protein antagonizes G protein signaling to block proliferation and allow development. EMBO J. 15:5184-5190[Medline].




This article has been cited by other articles:


Home page
SIMHome page
K. Pal, A.D. van Diepeningen, J. Varga, R.F. Hoekstra, P.S. Dyer, and A.J.M. Debets
Sexual and vegetative compatibility genes in the aspergilli
Stud Mycol, January 1, 2007; 59(1): 19 - 30.
[Abstract] [Full Text] [PDF]


Home page
MicrobiologyHome page
C. Wang, T. M. Butt, and R. J. S. Leger
Colony sectorization of Metarhizium anisopliae is a sign of ageing
Microbiology, October 1, 2005; 151(10): 3223 - 3236.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
C. Wang and R. J. St. Leger
Developmental and Transcripti