- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Magrath, C.
- Articles by Hyman, L. E.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Magrath, C.
- Articles by Hyman, L. E.
A Mutation in GRS1, a Glycyl-tRNA Synthetase, Affects 3'-End Formation in Saccharomyces cerevisiae
Christi Magrath1,a and Linda E. Hymanba Interdisciplinary Program in Molecular and Cellular Biology, Tulane University, New Orleans, Louisiana 70112
b Department of Biochemistry, Tulane University Medical School, New Orleans, Louisiana 70112
Corresponding author: Linda E. Hyman, Department of Biochemistry, Tulane University Medical School, New Orleans, LA 70112., lhyman{at}mailhost.tcs.tulane.edu (E-mail)
Communicating editor: F. WINSTON
| ABSTRACT |
|---|
3'-end formation is a complex and incompletely understood process involving both cis-acting and trans-acting factors. As part of an effort to examine the mechanisms of transcription termination by RNA polymerase II, a mutant hunt for strains defective in 3'-end formation was conducted. Following random mutagenesis, a temperature-sensitive strain exhibiting several phenotypes consistent with a role in transcription termination was isolated. First, readthrough of a terminator increases significantly in the mutant strain. Accordingly, RNA analysis indicates a decrease in the level of terminated transcripts, both in vivo and in vitro. Moreover, a plasmid stability assay in which high levels of readthrough lead to high levels of plasmid loss and transcription run-on analysis also demonstrate defective termination of transcription. Examination of polyadenylation and cleavage by the mutant strain indicates these processes are not affected. These results represent the first example of a transcription termination factor in Saccharomyces cerevisiae that affects transcription termination independent of 3'-end processing of mRNA. Complementation studies identified GRS1, an aminoacyl-tRNA synthetase, as the complementing gene. Sequence analysis of grs1-1 in the mutant strain revealed that nucleotides 1656 and 1657 were both C to T transitions, resulting in a single amino acid change of proline to phenylalanine. Further studies revealed GRS1 is essential, and the grs1-1 allele confers the temperature-sensitive growth defect associated with the mutant strain. Finally, we observed structures with some similarity to tRNA molecules within the 3'-end of various yeast genes. On the basis of our results, we suggest Grs1p is a transcription termination factor that may interact with the 3'-end of pre-mRNA to promote 3'-end formation.
TRANSCRIPTION termination requires the dissociation of the tertiary complex formed by the DNA template, the transcribing RNA polymerase, and the nascent RNA. Accurate termination is required for wild-type levels of gene expression as readthrough transcription into an adjacent gene results in reduced expression of the downstream transcriptional unit (![]()
![]()
![]()
![]()
![]()
![]()
The investigation of transcription termination by RNA polymerase II is complicated by the 3'-end processing of the pre-mRNA, which is coupled to the termination of transcription (![]()
![]()
![]()
![]()
![]()
![]()
Numerous trans-acting factors have been identified in yeast as having roles in 3'-end formation, including the ~20 gene products that have direct roles in the biochemical processing of pre-mRNAs in vitro (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
| MATERIALS AND METHODS |
|---|
Reagents:
Culture media components were obtained from Difco (Detroit). Amino acids, 5-bromo-4-chloro-3-indolyl-ß-D-galactopyranoside (X-Gal) and o-nitrophenyl-ß-D-galactosidase (ONPG), as well as most other chemicals, were from Sigma (St. Louis). T4 DNA ligase was obtained from New England Biolabs (Beverly, MA). Most restriction enzymes, T3, SP6, and T7 polymerases, RNasin, calf intestine alkaline phosphatase, and Taq DNA polymerase were obtained from Promega (Madison, WI). All reagents were used according to manufacturer's specifications. Radiolabeled nucleotides were obtained from Dupont/NEN (Boston). Sequenase enzyme was obtained from Amersham (Arlington Heights, IL). Nylon transfer membrane was from Micron Separations (Westborough, MA).
Plasmids:
The plasmids, pL101 and pT7T3ADH2 (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
pGTP and pGTM were constructed by amplifying an ADH2 3'-end fragment by PCR of pT7T3ADH2 with primers (5'GAAGATCTGACACTTCTAAATAAGCGG and 5'GAAGATCTGGCATGCGAAGGAAAATGAG) that created BglII sites (in boldface) on both ends of the PCR fragment. Following digestion with BglII, the fragment was cloned into the BamHI site of pBM272, creating pBM272 derivatives with the ADH2 3'-end downstream of the GAL1 promoter in both orientations (plus and minus relative to the GAL1 promoter). These GAL1/ADH2 3'-end fusions (+ and -) were used as templates for PCR with primers (5'GAAGATCTTCGCCCCATTATCTTAGCC and 5'GCCAGCAACCGCACC), which created a BglII site (in boldface) on the 5'-end of the PCR fragment. Following digestion of the PCR product with BglII and HindIII and the vector, YCpMM3, with BamHI and HindIII, the fragments were ligated to generate pGTP and pGTM. pGTP contains the plus orientation of ADH2 and pGTM contains the minus orientation.
YCplac111/TFC1 was obtained by digesting the genomic library clone, p366/711, with NsiI and ligating the 3212-bp gel-purified restriction fragment into the PstI site of YCplac111. Digesting YCp111/TFC1 with XmnI and SmaI and ligating the resulting fragment into the SmaI site of YCp111 generated YCp111/YBR124W. YCp111/MRPL36 was constructed by digesting p366/57 with EcoRV and ligating the 1479-bp product into the SmaI site of YCp111. p366/57
tfc1 was generated by digesting the genomic library clone, p366/57, with SacI and religating the plasmid to delete the region of TFC1 between the two SacI sites. p366/76
GRS1 was generated by digestion of the genomic library clone, p366/76, with MscI and religating the plasmid to delete the region of GRS1 between the two MscI sites that flank GRS1. A third MscI site, located within the vector p366, is blocked by dam methylation. To construct YCp111/grs1-1, the GRS1 gene was cloned from genomic DNA preparations of both the wild-type (YPH499) and mutant (2-1-1) strains after introducing flanking BamHI and XbaI restriction sites (in boldface) by PCR, using the primers LEH285 (5' CGGGATCCAGTGTAGAAGATATC) and LEH286 (5' GCTCTAGAGATTTCCGCACTTC). For each independent PCR reaction (four or more reactions from both strains), the PCR fragments and vectors were digested with BamHI and XbaI and cloned into the XbaI and BamHI site of the centromeric vectors YCplac111 and pT7T319U. The PCR-derived GRS1-containing plasmids were transformed into 2-1-1 and temperature sensitivity at 37° was assessed. Strains that contained plasmid derivatives that did not complement the temperature sensitivity were identified, and plasmid YCp111/grs1-1 isolated from the strains. The grs1-1 allele was excised from YCp111/grs1-1 as a PstI/EcoRI fragment and cloned into PstI/EcoRI cut YIplac211, creating YIp211/grs1-1. As a control, an identical protocol was used to remove a wild-type version of GRS1 from the genome of W303a creating the plasmids YCp111/GRS1 and YIp211/GRS1. All plasmids used in the genetic study are shown in Table 1.
|
UV mutagenesis and screening strategy:
YPH499 was transformed with the reporter plasmid, pL101, using the lithium acetate method (![]()
![]()
Elimination of plasmid-based mutations:
Candidate strains were cured and retransformed with the pL101 plasmid using a scaled down lithium acetate protocol (![]()
![]()
Northern analysis:
Cells were grown to saturation in complete minimal dextrose media without uracil and the saturated cultures were used to inoculate complete minimal galactose media without uracil. These induced cells were grown to saturation (OD600 of 1.52.0), reinoculated, and harvested when the OD600 was 0.51.0. For temperature-shift studies, cells were grown to an OD600 between 0.15 and 0.5, split, and grown at the appropriate temperatures for 724 hr. Total RNA was prepared using the hot phenol/glass beads method. Samples were electrophoresed on 1.5%-agarose/formaldehyde gel, and Northern analysis performed. [
-32P]UTP-labeled ADH2 and URA3 probes were made and hybridization was completed. All procedures for RNA analysis were as previously described (![]()
![]()
![]()
Plasmid loss analysis:
Strains transformed with either plasmid pGTP or pGTM were grown in complete minimal dextrose media without uracil and inoculated into YPD or YPGal (![]()
Random spore analysis:
Strain 2-1-1 transformed with pL101 was mated to YPH500 transformed with YCplac211, and diploids (2-1-1/500) were selected on complete minimal dextrose plates without uracil or leucine. Sporulation was induced by growth on plates supplemented with histidine, adenine, lysine, and tryptophan (![]()
![]()
Yeast extracts and in vitro transcription:
Yeast nuclear extracts were prepared from 2-1-1 and BJ926 by the methods of ![]()
![]()
![]()
![]()
![]()
Polyadenylation and cleavage extracts:
Yeast whole-cell extracts were prepared according to published procedures (![]()
![]()
Transcription run-on:
Examination of transcription run-on was completed as described in ![]()
Complementation:
Strain 2-1-1 was transformed with 0.5 µg of yeast genomic library ATCC 77162, plated to complete minimal dextrose plates without uracil, and incubated at 37°. Eight independent transformations were completed and at least 20 genome equivalents of library DNA were screened. The transformants that appeared at the restrictive temperature were selected and the recovery of growth at 37° was confirmed. Plasmids were recovered from strains with restored growth and amplified in Escherichia coli (DH5
; ![]()
![]()
![]()
Generation and analysis of GRS1 null strain:
Generation of a grs1
/GRS1 derivative of W303a/
was completed using the kan/lox method (![]()
![]()
Generation of integrant:
YIP211/grs1-1 and YIP211/GRS1 were transformed into yeast, and potential integrants were selected on the basis of the ability to grow on complete minimal dextrose media without uracil (![]()
![]()
![]()
transformed with p366, and diploids were selected on complete minimal dextrose plates without uracil or leucine. The resulting diploids were dissected and the phenotypes of the resulting segregants were examined on YPD, complete minimal dextrose plates without uracil and X-gal indicator plates at the permissive (30°) and nonpermissive (37°) temperatures.
DNA sequencing:
The T7T319U derivatives constructed from the mutant background (above) were used for DNA sequencing. Independently derived clones were sequenced and compared to clones derived from the wild-type strain. DNA was sequenced by the double-stranded dideoxy sequencing technique with Sequenase (USB/Amersham).
Yeast strains and methods:
All mutant strains are derivatives of the S. cerevisiae strain YPH499 or W303 (Table 2). Yeast cells were cultured by standard techniques (![]()
![]()
![]()
|
| RESULTS |
|---|
Mutagenesis of YPH499 to create defects in trans-acting factors involved in transcription termination:
As part of an effort to examine the mechanisms of transcription termination by RNA polymerase II, a mutant hunt for strains defective in 3'-end formation was conducted. The reporter plasmid pL101 was used as the primary indicator of increased readthrough transcription (Figure 1A). pL101 contains a galactose inducible promoter that drives transcription into an intron-imbedded transcription termination signal placed upstream of the lacZ gene. Consequently, ß-galactosidase production serves as an indication of the efficiency of transcription termination (![]()
|
Using this reporter in an analysis of ~46,000 UV-mutagenized S. cerevisiae cells, we sought to identify mutations that give poor 3'-end formation at a permissive temperature (24°) but are nonviable at a nonpermissive temperature (16° or 37°). Approximately 300 ß-galactosidase-producing strains were identified and analyzed.
Additional screening of potential mutants to eliminate false positives:
To eliminate false positives that were expected to arise because of plasmid-borne mutations (i.e., cis-mutations of the ADH2 3'-end signal), each putative mutant strain was cured of the original plasmid, retransformed with pL101, and retested for ß-galactosidase production. Subsequently, to reduce the pool of the 120 remaining strains, only those candidates that exhibited a temperature-sensitive phenotype in addition to increased ß-galactosidase production were selected for continued investigation, leaving 20 strains for RNA analysis.
Northern analysis:
Total RNA was prepared from these 20 candidates containing pL101 and examined by Northern blotting using the ADH2 3'-end sequence as a probe. The amount of hybridization to this probe correlates to the level of correctly terminated transcripts produced by the reporter plasmid. Readthrough transcripts do not contain the ADH2 3'-end sequence, as this sequence is located within a functional intron. Consequently, the readthrough transcripts are not detected by the ADH2 3'-end specific probe (![]()
Analysis of mutants by plasmid loss assay:
To increase the rigor of the screen and eliminate mutations that are due to indirect effects, a second complementary reporter system based on a plasmid instability assay (![]()
![]()
![]()
|
In vitro transcription termination:
We focused on the 2-1-1 strain because it displayed defects in growth at the permissive temperature that were exacerbated at higher temperatures, ß-galactosidase production, and RNA expression. Additionally, this strain exhibited equal rates of plasmid loss regardless of the presence of a functional terminator in the plasmid loss assay (Figure 2B). To confirm the 3'-end formation defect, we extended this analysis to include a more direct assay that examines transcription termination in vitro by nuclear extracts prepared from 2-1-1. The plasmid pBEVY (![]()
|
Genetic analysis of 2-1-1:
On the basis of the evidence of a termination defect in strain 2-1-1, genetic studies were initiated. After 2-1-1 was mated to the wild-type strain, YPH500, the resulting strain was able to grow at 37°, thus demonstrating the 2-1-1 mutation is recessive. Unfortunately genetic analysis of strain 2-1-1 has been hampered by poor sporulation efficiency of the diploid and low spore viability. Consequently, random spore analysis was completed to establish linkage between the temperature-sensitive growth phenotype and overproduction of ß-galactosidase from the pL101 reporter. Temperature sensitivity was present in approximately half of the >100 segregants examined, indicating 2:2 segregation of this phenotype. In addition, ß-galactosidase production from pL101 at 30° was evident in all segregants that were temperature sensitive but none of these segregants were wild type for growth at 37°. Thus the data indicate that the termination defect and the growth defect are closely linked and that these phenotypes resulted from mutation in a single gene.
Cloning of the gene responsible for the mutant phenotypes of 2-1-1:
A centromere-based library was used to identify the wild-type gene corresponding to the 2-1-1 mutation. We recovered 13 transformants that grew at the nonpermissive temperature in a screen of ~20 genome-equivalents of DNA. Restriction analysis and sequencing of the complementing plasmids from these strains demonstrated that 12 were overlapping members of one of three identical plasmid clones (p366/57, p366/76, and p366/711; Figure 4). These plasmids restored the wild-type growth phenotype (Figure 5A), wild-type levels of ß-galactosidase phenotype (Figure 5B), and a wild-type RNA phenotype (Figure 5, C). Thus, a single segment of DNA complemented all three phenotypes, supporting our genetic evidence that the phenotypes resulted from mutation of a single gene. A search of the yeast database (BLAST) revealed that all three complementing fragments were from a region of chromosome II containing four potential genes: GRS1, a putative glycyl-tRNA synthetase; MRPL36, a mitochondrial ribosomal protein; TFC1, the 95-kD subunit of TFIIIC, a RNA polymerase III transcription factor; and YBR124w, an open reading frame of unidentified function (Figure 4).
|
|
The GRS1 gene complements the temperature sensitivity and transcription termination defects of strain 2-1-1:
The four genes contained in the overlapping fragment were individually cloned into a yeast centromeric vector, creating YCp111/TFC1, YCp111/MRPL36, YCp111/YBR124w, and YCp111/GRS1 (Figure 4). Of these, YCp111/GRS1 was able to support growth at 37° (Figure 4 and Figure 6A), whereas the other three plasmids could not do so. In a complementing approach, we constructed deletions of single genes from the original complementing clones yielding the plasmids p366/76
GRS1 and p366/57
TFC1 (Figure 4). Deletion of the GRS1 gene from the genomic library fragment in p366 resulted in a plasmid that could not support growth of the 2-1-1 strain at 37°; deletion of the TFC1 gene, by contrast, did not affect the complementing activity of p366/57 (Figure 6A). Thus, upon subcloning of the original plasmids, as well as deletion analysis, we determined that the GRS1 gene, which codes for the probable glycyl-tRNA synthetase (![]()
![]()
|
The grs1-1 allele confers the temperature-sensitive growth defect associated with 2-1-1:
Two approaches were used to demonstrate that GRS1 is responsible for the mutant phenotypes observed in strain 2-1-1. First, we cloned the GRS1 gene from genomic DNA from wild-type and mutant strains into a centromeric plasmid. Eight clones from independent PCR reactions were obtained. The ability of the plasmid versions of GRS1 to complement the temperature-sensitive phenotype of strain 2-1-1 was determined and the results showed that the GRS1-containing clones derived from the wild-type strain were able to complement the temperature sensitivity, whereas the eight clones derived from the mutant strain were unable to do so (data not shown). This demonstrates that the 2-1-1 strain contains a mutant allele of the GRS1 locus, grs1-1.
Second, we asked whether the mutant phenotype of the 2-1-1 strain could be conferred by the grs1-1 allele that was recovered. We integrated the grs1-1 allele from 2-1-1 into a wild-type strain (W303a) at the GRS1 locus, creating YCM102, and selected for recombination events that deleted the wild-type URA3 gene located between the two alleles. The strains harboring the grs1-1 allele (YCM101) were identified by screening for temperature sensitivity at 37° (Figure 6B). To further confirm that grs1-1 is the mutant allele, YCM101 was mated to W303
, diploids were selected, and tetrad dissection was completed. The resulting segregants were transformed with the ß-galactosidase reporter plasmid, pL101, and examined at both permissive and nonpermissive temperatures. In all eight segregants examined, the spore products that were temperature sensitive on YPD at 37° also expressed increased levels of ß-galactosidase at 30°, and the spore products that grew at the nonpermissive temperature did not express increased ß-galactosidase. Given that previous random spore analysis demonstrated linkage between the temperature sensitivity and the RNA defect, this firmly establishes grs1-1 as the mutation in 2-1-1.
GRS1 is an essential gene:
We also created a heterozygote containing a grs1 null allele by inserting the kanamycin resistance gene into the GRS1 locus of a wild-type diploid (W303a/
). Upon sporulation and dissection of this diploid, we determined that GRS1 is an essential gene in that, of the 20 viable spore products, only kanamycin-sensitive strains (GRS1 gene present) were recovered. No spore product was recovered that was kanamycin resistant (GRS1 gene knocked out).
Identification of the grs1-1 mutation:
Finally, sequence analysis of the grs1-1 mutation revealed that nucleotides 1656 and 1657 were both C to T transitions that result in a single amino acid change of proline at position 552 to a phenylalanine (P552F). Two independently derived clones derived from the mutant strain (2-1-1) contained this mutant allele, whereas a clone derived from the wild-type strain (YPH499) did not harbor the transition mutation.
Examination of polyadenylation and cleavage:
To determine if defects in 3' RNA processing are evident in the grs1-1 mutant strain, whole cell extracts were prepared and in vitro cleavage and polyadenylation examined. A radiolabeled CYC1 3'-end substrate was synthesized in vitro and incubated in the presence of yeast extracts made from wild-type or 2-1-1 cells. As the grs1-1 allele is temperature sensitive, extracts were prepared from cells grown at 24°, but reactions were performed with extracts heat-treated at 37° for 5 min (Figure 7, lanes 58) or non-heat-treated extracts (Figure 7, lanes 14). In addition, a set of reactions was performed with dATP substituting for ATP to demonstrate accumulation of the upstream cleavage product (Figure 7, lanes 912). These results indicate that the primary defect in strain 2-1-1 and YCM101 does not affect polyadenylation or cleavage.
|
Transcription run-on:
To assess the localization of active polymerases to the regions downstream of normal transcription termination sites in the mutant strain YCM101, transcriptional run-on experiments were completed. We anticipated polymerases would localize to regions downstream from the normal transcription termination site. Data from a representative result from the transcription run-on experiment are shown in Figure 8B, and a graphic representation is shown in Figure 8C. Using the pGCYC plasmid as a template for the transcription run-on reaction (Figure 8A), we observed wild-type transcriptional patterns in the mutant strain at the permissive temperature (30°; Figure 8C, compare YCM101 at 30° to W303 at 30°). However, mutant cells shifted to the nonpermissive temperature (37°) demonstrated high polymerase density downstream from the polyadenylation site (Figure 8B). This pattern resembles the polymerase density observed in cells harboring a transcription template with a defective transcription termination site (pGcyc1-512; Figure 8C, compare cyc1-512 at 30° to CYC1 37°). Thus, increased levels of polymerase density were found in the regions downstream of the normal transcriptional termination site in the mutant strain YCM101, providing additional evidence of a defect in transcription termination in strains harboring the grs1-1 allele.
|
| DISCUSSION |
|---|
RNA defects associated with the grs1-1 mutation:
The observation that an enzyme traditionally associated with the aminoacylation of tRNA affects 3'-end formation is unexpected. Because of the role of tRNA synthetases in translation, an indirect role for Grs1p may be predicted in that translation of a factor essential for 3'-end formation might be adversely affected in the absence of a pool of correctly aminoacylated tRNAgly. Yet, we clearly observe defects in RNA processing and metabolism consistent with a defect in 3'-end formation using multiple assays. First, Northern analysis demonstrates a defect in transcription termination. We observe a decrease in the level of terminated transcripts as the temperature is increased in our mutant strains (2-1-1 and YCM101) compared to the wild-type strain. Examination of the expression of a control gene (URA3) indicates a correlated general decrease in transcription is not observed. Second, the plasmid loss assay demonstrates the mutant strain (2-1-1) produces increased levels of readthrough transcripts, relative to wild type. Third, in vitro analysis of the terminated RNA products shows a clear defect in accumulation of terminated products. Fourth, polyadenylation and cleavage are normal in the mutant strain. Fifth, transcription run-on results demonstrate increased polymerase density in regions downstream from a normal transcription termination site. The observed phenotypes are consistent with a general defect that affects the transcription termination reaction. A failure to demonstrate a role for GRS1 in polyadenylation is not surprising in that the polyadenylation reaction has been functionally reconstituted, and GRS1 is not a required component of the reaction (![]()
rst example of a transcription termination factor in S. cerevisiae that affects transcription termination independent of 3'-end processing of mRNA.
Roles of tRNA synthetases independent from aminoacylation:
Although tRNA synthetases are traditionally thought to be responsible for charging tRNA, several lines of evidence, including what is presented in this article, demonstrate that tRNA synthetases can be multi-functional proteins. Notable is the observation that tRNA synthetases are involved in a variety of cellular functions, unlinked to their roles in protein synthesis (![]()
![]()
![]()
![]()
![]()
![]()
![]()
Identification of tRNA-like structures in the 3'-ends of yeast genes:
As part of the specificity of the aminoacylation reaction, synthetases generally recognize the anticodon region, the acceptor arm, and additional nucleotides within the cognate tRNA. The exact mechanisms used by synthetases to bind to tRNA vary among the different synthetases and no single region of the tRNA or single domain of the synthetases is exclusively responsible for this RNA:protein interaction (![]()
![]()
![]()
![]()
![]()
![]()
An examination of the 3'-ends of several yeast mRNAs revealed the presence of a sequence that appears conserved in the 3'-end of several RNA polymerase II transcripts. The semiconserved sequence (GUUCGANYC) corresponds to the T
C loop of tRNA, a critical structural feature of tRNAs (Figure 9A). Thus, the tRNA-like sequence element could potentially play a role in mediating the Grs1p interaction with 3'-ends of yeast genes transcribed by RNA polymerase II and transcription termination.
|
Are there tRNA-like structures found at the 3'-ends of mRNA? A structure is traditionally defined as tRNA-like "on account of its ability to react efficiently with one or more tRNA-specific enzymes" (![]()
C loop; a GG sequence in a region that is a potential D-loop; an anticodon that would not charge any amino acid to the RNA (UUA); and, in two of three examples, an acceptor arm that contains the polyadenylation site (![]()
![]()
![]()
C loop (reviewed in ![]()
C-like element of the ADH2 3'-end did increase the level of readthrough in our reporter construct (data not shown).
The presence of a potential tRNA-like structure allows one to envision a role for tRNA processing components, such as tRNA synthetases, in the mRNA 3'-end formation reaction. Furthermore, the grs1-1 mutation may affect some aspect of the synthetase involved in charging tRNA may be a mutation that is exclusively involved in 3'-end formation, demonstrating a role for the protein distinct from its role in protein synthesis. As noted, tRNA synthetases recognize tRNA as a part of the aminoacylation reaction; yet, some have been observed to bind to or interact with other RNAs, including rRNA and mRNA (![]()
![]()
![]()
![]()
DNA sequencing of the grs1-1 gene predicts a single amino acid change from proline to phenylalanine at position 552. Importantly, the crystal structure of the glycyl-tRNA synthetase from Thermus thermophilus has been solved and the C-terminal domain that contains the mutation in Grs1p is thought to constitute the domain that recognizes and binds to the tRNA at the anticodon loop (![]()
Other 3'-end formation effectors with roles in tRNA metabolism:
Grs1p is not the only trans-acting factor implicated in 3'-end formation with roles in tRNA metabolism. PTA1 has been described both as an effector of pre-tRNA processing (![]()
![]()
![]()
![]()
![]()
| FOOTNOTES |
|---|
1 Present address: Department of Biology, Troy State University, Troy, AL 36081. ![]()
| ACKNOWLEDGMENTS |
|---|
We thank Dr. M. Clancy, S. Chen, S. Gross, K. Johanson, R. Boumil, D. Nemergut, and M. Magrath for their expert technical assistance and Drs. C. Moore, N. Proudfoot, and C. Miller for providing molecular reagents used for portions of the work described in this manuscript. We also acknowledge S. Gross, T. Jackson, and Drs. R. Baricos, M. Clancy, D. Dawson, E. First, A. Lustig, C. Miller, and C. Moore, as well as the members of the labs of Drs. Hyman and Lustig for valuable discussions. This research was supported by the National Science Foundation grant MCB9604295 to L. E. Hyman. C. Magrath was funded by the Louisiana Education Quality Support Fund Fellowship.
Manuscript received September 1, 1998; Accepted for publication February 9, 1999.
| LITERATURE CITED |
|---|
ALTSCHUL, S. F., W. GISH, W. MILLER, E. W. MYERS, and D. J. LIPMAN, 1990 Basic local alignment search tool. J. Mol. Biol. 215:403-410[Medline].
AUSUBEL, F. M., R. BRENT, R. E. KINGSTON, D. D. MOORE, J. G. SEIDMAN et al. 1994 Current Protocols in Molecular Biology. John Wiley & Sons, New York.
BIRSE, C. E., L. MINVIELLE-SEBASTIA, B. A. LEE, W. KELLER, and N. J. PROUDFOOT, 1998 Coupling termination of transcription to messenger RNA maturation in yeast. Science 280:298-301
BRIGGS, M. W. and J. S. BUTLER, 1996 RNA polymerase III defects suppress a conditional lethal poly(A) polymerase mutation in Saccharomyces cerevisiae.. Genetics 143:1149-1161[Abstract].
BRIGGS, M. W., K. T. BURKARD, and S. J. BUTLER, 1998 Rrp6p, the yeast homologue of the human PM-Scl 100 kDA autoantigen, is essential for efficient 5.8 S 3'-end formation. J. Biol. Chem. 273:13255-13263
BUTLER, J. S. and T. PLATT, 1988 RNA processing generates the mature 3' ends of yeast CYC1 mRNA in vitro. Science 242:1270-1274
CAPRARA, M. G., V. LEHNERT, A. M. LAMBOWITZ, and E. WESTHOF, 1996 A tyrosyl-tRNA synthetase recognizes a conserved tRNA-like structural motif in the group I intron catalytic core. Cell 87:1135-1145[Medline].
CHEN, J. and C. L. MOORE, 1992 Separation of factors required for cleavage and polyadenylation of yeast pre-mRNA. Mol. Cell. Biol. 12:3470-3481
CHEN, S., R. REGER, C. MILLER, and L. E. HYMAN, 1996 Transcriptional terminators are associated with origins of replication in yeast. Nucleic Acids Res. 15:2885-2893.
CHERRY, J. M., C. BALL, S. WENG, G. JUVIK, and R. SCHMIDT et al., 1997 Genetic and physical maps of Saccharomyces cerevisiae.. Nature 387:67-73[Medline].
COLGAN, D. F. and J. L. MANLEY, 1997 Mechanism and regulation of mRNA polyadenylation. Genes Dev. 11:2734-2766.
EGGERMONT, J. and N. PROUDFOOT, 1993 Poly(A) signals and transcriptional pause sites combine to prevent interference between RNA polymerase II promoters. EMBO J. 12:2539-2548[Medline].
FELDMANN, H., G. MANNHAUPT, C. SCHWARZLOSE and J. VETTER, 1994 A probable gene of GlyRS from Saccharomyces cerevisiae. EMBL Protein Sequence Data Base, accession no. Z35990.
FIRMENICH, A. and K. REDDING, 1993 An efficient procedure for multiple transformations of yeast in parallel. Biotechniques 14:712-718[Medline].
FIRST, E., 1998 Catalysis of tRNA aminoacylation by class I and class II aminoacyl-tRNA synthetases, pp. 573607 in Comprehensive Biological Catalysis. Academic Press, San Diego.
FREIST, W., D. T. LOGAN, and D. H. GAUSS, 1996 Glycyl-tRNA synthetase. Biol. Chem. Hoppe-Seyler 377:343-356[Medline].
GALLIE, D. R. and V. WALBOT, 1990 RNA pseudoknot domain of tobacco mosaic virus can functionally substitute for a poly(A) tail in plant and animal cells. Genes Dev. 4:1149-1157
GIETZ, D., A. ST. JEAN, R. WOODS, and R. H. SCHIESTL, 1992 Improved method for high-efficiency transformation of intact yeast cells. Nucleic Acids Res. 20:1425
GREGER, I. H., F. DEMARCHI, M. GIACCA, and N. J. PROUDFOOT, 1998 Transcriptional interference perturbs the binding of SP1 to the HIV-1 promoter. Nucleic Acids Res. 26:1294-1300
GULDENER, U., S. HECK, T. FIEDLER, J. BEINHAUER, and J. HEGEMANN, 1996 A new efficient gene disruption cassette for repeated use in budding yeast. Nucleic Acids Res. 24:2519-2524
GUTHRIE, C., and G. R. FINK, 1991 Guide to Yeast Genetics and Molecular Biology. Academic Press, San Diego.
HANI, J., B. SCHELBERT, A. BERNHARDT, H. DONDEY, and G. FISCHER et al., 1999 Mutations in a peptidyl prolyl-cis/trans-isomerase gene lead to a defect in 3'-end formation of a pre-mRNA in Saccharomyces cerevisiae.. J. Biol. Chem. 274:108-116
HIETER, P., C. MANN, M. SNYDER, and R. DAVIS, 1985 Mitotic stability of yeast chromosomes: a colony color assay that measures nondisjunction and chromosome loss. Cell 40:381-392[Medline].
HINNEBUSCH, A. G., and S. W. LIEBMAN, 1991 Protein synthesis and translational control in Saccharomyces cerevisiae, pp. 627735 in The Molecular and Cellular Biology of the Yeast Saccharomyces cerevisiae: Genome Dynamics, Protein Synthesis, and Energetics, edited by J. R. BROACH, J. R. PRINGLE and E. W. JONES. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
HOPPER, A., and N. MARTIN, 1992 Processing of yeast cytoplasmic and mitochondrial precursor tRNAs, pp. 99141 in The Molecular and Cellular Biology of the Yeast Saccharomyces cerevisiae: Gene Expression, edited by E. W. JONES, J. R. PRINGLE and J. R. BROACH. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
HYMAN, L. E. and C. L. MOORE, 1993 Termination and pausing of RNA polymerase II downstream of yeast polyadenylation sites. Mol. Cell. Biol. 13:5159-5167
HYMAN, L. E., S. H. SEILER, J. WHORISKEY, and C. L. MOORE, 1991 Point mutations upstream of the yeast ADH2 poly(A) site significantly reduce the efficiency of 3'-end formation. Mol. Cell. Biol. 11:2004-2012
JOHNSTON, M. and R. W. DAVIS, 1984 Sequences that regulate the divergent GAL1-GAL10 promoter in Saccharomyces cerevisiae.. Mol. Cell. Biol. 4:1440-1448
KELLER, W. and L. MINVIELLE-SEBASTIA, 1997 A comparison of mammalian and yeast pre-mRNA 3'-end processing. Curr. Opin. Cell Biol. 9:329-336[Medline].
KOSHLAND, D., J. KENT, and L. HARTWELL, 1985 Genetic analysis of mitotic transmission of minichromosomes. Cell 40:393-403[Medline].
LABOUESSE, M., 1990 The yeast mitochondrial leucyl-RNA synthethase is a splicing factor for the excision of several group I introns. Mol. Gen. Genet. 224:209-221[Medline].
LAMBOWITZ, A. M. and P. S. PERLMAN, 1990 Involvement of aminoacyl-tRNA synthethases and other proteins in group I and group II intron splicing. Trends Biochem. Sci. 15:440-444[Medline].
LOGAN, D. T., M. H. MAZAURIC, D. KERN, and D. MORAS, 1995 Crystal structure of glycyl-RNA synthetase from Thermus thermophilus.. EMBO J. 14:4156-4167[Medline].
LUE, N. F. and R. D. KORNBERG, 1987 Accurate initiation at RNA polymerase II promoters in extracts from Saccharomyces cerevisiae.. Proc. Natl. Acad. Sci. USA 84:8839-8843
LUE, N. F., P. M. FLANAGAN, R. J. KELLEHER, III, A. EDWARDS, and R. D. KORNBERG, 1991 RNA polymerase II transcription in vitro.. Methods Enzymol. 194:545-549[Medline].
LUND, E. and J. DAHLBERG, 1998 Proofreading and aminoacylation of tRNAs before export from the nucleus. Science 282:2082-2085
MANS, R. M. W., C. W. A. PLEIJ, and L. BOSCH, 1991 tRNA-like structures. Eur. J. Biochem. 201:303-324[Medline].
MCCRACKEN, S. M., N. FONG, K. YANKULOV, S. BALLANTYNE, and G. PAN et al., 1997 The C-terminal domain of RNA polymerase II couples mRNA processing to transcription. Nature 385:357-361[Medline].
MILLER, C., M. A. MARTINAT, and L. E. HYMAN, 1998 Assessment of aryl hydrocarbon receptor complex interaction using pBEVY plasmids: a family of yeast expression vectors with bidirectional promoters. Nucleic Acids Res. 24:3577-3583.
MOHR, G., M. G. CAPRARA, Q. GUO, and A. M. LAMBOWITZ, 1994 A tyrosyl-tRNA synthetase can function similarly to an RNA structure in the Tetrahymena ribozyme. Nature 370:147-150[Medline].
MUTO, A., C. USHIDA, and H. HIMENO, 1998 A bacterial RNA that functions as both a tRNA and an mRNA. Trends Biochem. Sci. 23:25-29[Medline].
NAMEKI, N., K. TAMURA, H. ASAHARA, and T. HASEGAWA, 1997 Recognition of tRNA(Gly) by three widely diverged glycyl-tRNA synthetases. J. Mol. Biol. 268:640-647[Medline].
O'CONNOR, J. P. and C. L. PEEBLES, 1992 PTA1, an essential gene of Saccharomyces cerevisiae affecting pre-tRNA processing. Mol. Cell. Biol. 12:3843-3856
PLATT, T., 1998 RNA structure in transcription elongation, termination, and antitermination, pp. 541574 in RNA Structure and Function, edited by R. SIMONS and M. GRUNBERG-MANAGO. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
PREKER, P. J., M. OHNACKER, L. MINVIELLE-SEBASTIA, and W. KELLER, 1997 A multisubunit 3'-end processing factor from yeast containing poly(A) polymerase and homologues of the subunits of mammalian cleavage and polyadenylation specificity factor. EMBO J. 16:4727-4737[Medline].
PROUDFOOT, N. J., 1986 Transcriptional interference and termination between duplicated
-globin gene constructs suggests a novel mechanism for gene regulation. Nature 322:562-565[Medline].
ROSE, M. D., P. NOVICK, J. H. THOMAS, D. BOTSTEIN, and G. R. FINK, 1987 A Saccharomyces cerevisiae genomic bank based on centromere-containing shuttle vector. Gene 60:237-243[Medline].
RUSSNAK, R., K. W. NEHRKE, and T. PLATT, 1995 REF2 encodes an RNA binding protein directly involved in yeast mRNA 3'-end formation. Mol. Cell. Biol. 15:1689-1697
RUSSO, P., 1995 Saccharomyces cerevisiae mRNA 3'-end forming signals are also involved in transcription termination. Yeast 11:447-453[Medline].
RUSSO, P. and F. SHERMAN, 1989 Transcription terminates near the poly(A) site in the CYC1 gene of the yeast Saccharomyces cerevisiae.. Proc. Natl. Acad. Sci. USA 86:8348-8352
SAKS, M., J. SAMPSON, and J. ABELSON, 1998 Evolution of a transfer RNA gene through a point mutation in the anticodon. Science 279:1665-1670
SCHIMMEL, P. and R. ALEXANDER, 1998 All you need is RNA. Science 281:658-659
SCHRAY, B. and R. KNIPPERS, 1991 Binding of human glutaminyl-tRNA synthetase to a specific site of its mRNA. Nucleic Acids Res. 19:5307-5312
SHERMAN, F., G. R. FINK and J. B. HICKS, 1986 Laboratory Course Manual for Methods in Yeast Genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.
SHIBA, K., H. MOTEGI, and P. SCHIMMEL, 1997 Maintaining genetic code through adaptations of tRNA synthetases to taxonomic domains. Trends Biochem. Sci. 22:453-457[Medline].
SNYDER, M., R. J. SAPOLSKY, and R. W. DAVIS, 1988 Transcription interferes with elements important for chromosome maintenance in Saccharomyces cerevisiae.. Mol. Cell. Biol. 8:2184-2194
SPRINGER, C., O. VALERIUS, A. SRITTMATTER, and G. BRAUS, 1997 The adjacent yeast genes ARO4 and HIS7 carry no intergenic regions. J. Biol. Chem. 272:23618-23624.
STEINMETZ, E., 1997 Pre-mRNA processing and the CTD of RNA polymerase II: the tail that wags the dog? Cell 89:491-494[Medline].
WAHLE, E. and W. KELLER, 1996 The biochemistry of polyadenylation. Trends Biochem. Sci. 21:247-250[Medline].
WHITELAW, E. and N. PROUDFOOT, 1986 Alpha-Thalassaemia caused by a poly(A) site mutation reveals that transcriptional termination is linked to 3'-end processing in the human
-globin gene. EMBO J. 5:2915-2922[Medline].
YANOFSKY, C., K. V. KONAN, and J. P. SARSERO, 1996 Some novel transcription attenuation mechanisms used by bacteria. Biochimie 78:1017-1024[Medline].
ZARET, K. S. and F. SHERMAN, 1982 DNA sequence required for efficient transcription termination in yeast. Cell 28:563-573[Medline].
This article has been cited by other articles:
![]() |
E. Rosonina, S. Kaneko, and J. L. Manley Terminating the transcript: breaking up is hard to do. Genes & Dev., May 1, 2006; 20(9): 1050 - 1056. [Full Text] [PDF] |
||||
![]() |
K. Johanson, T. Hoang, M. Sheth, and L. E. Hyman GRS1, a Yeast tRNA Synthetase with a Role in mRNA 3' End Formation J. Biol. Chem., September 19, 2003; 278(38): 35923 - 35930. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Nedea, X. He, M. Kim, J. Pootoolal, G. Zhong, V. Canadien, T. Hughes, S. Buratowski, C. L. Moore, and J. Greenblatt Organization and Function of APT, a Subcomplex of the Yeast Cleavage and Polyadenylation Factor Involved in the Formation of mRNA and Small Nucleolar RNA 3'-Ends J. Biol. Chem., August 29, 2003; 278(35): 33000 - 33010. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. E. Hyman, E. Kwon, S. Ghosh, J. McGee, A. M. B. Chachulska, T. Jackson, and W. H. Baricos Binding to Elongin C Inhibits Degradation of Interacting Proteins in Yeast J. Biol. Chem., May 3, 2002; 277(18): 15586 - 15591. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Carrodeguas and D. F. Bogenhagen Protein sequences conserved in prokaryotic aminoacyl-tRNA synthetases are important for the activity of the processivity factor of human mitochondrial DNA polymerase Nucleic Acids Res., March 1, 2000; 28(5): 1237 - 1244. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Zhao, M. Kessler, S. Helmling, J. P. O'Connor, and C. Moore Pta1, a Component of Yeast CF II, Is Required for Both Cleavage and Poly(A) Addition of mRNA Precursor Mol. Cell. Biol., November 1, 1999; 19(11): 7733 - 7740. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Turner, M. Lovato, and P. Schimmel One of Two Genes Encoding Glycyl-tRNA Synthetase in Saccharomyces cerevisiae Provides Mitochondrial and Cytoplasmic Functions J. Biol. Chem., September 1, 2000; 275(36): 27681 - 27688. [Abstract] [Full Text] [PDF] |
||||
![]() |
A.-M. Duchene, N. Peeters, A. Dietrich, A. Cosset, I. D. Small, and H. Wintz Overlapping Destinations for Two Dual Targeted Glycyl-tRNA Synthetases in Arabidopsis thaliana and Phaseolus vulgaris J. Biol. Chem., April 27, 2001; 276(18): 15275 - 15283. [Abstract] [Full Text] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Magrath, C.
- Articles by Hyman, L. E.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Magrath, C.
- Articles by Hyman, L. E.













