- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Kirkpatrick, D. T.
- Articles by Petes, T. D.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Kirkpatrick, D. T.
- Articles by Petes, T. D.
Maximal Stimulation of Meiotic Recombination by a Yeast Transcription Factor Requires the Transcription Activation Domain and a DNA-Binding Domain
David T. Kirkpatricka, Qingqing Fanb, and Thomas D. Petesaa Department of Biology, Curriculum in Genetics and Molecular Biology, University of North Carolina, Chapel Hill, North Carolina 27599-3280
b Center for Neurobiology and Behavior, Columbia University, New York, New York 10032
Corresponding author: Thomas D. Petes, Curriculum in Genetics and Molecular Biology, University of North Carolina, Chapel Hill, NC 27599-3280., tompetes{at}email.unc.edu (E-mail)
Communicating editor: R. S. HAWLEY
| ABSTRACT |
|---|
The DNA sequences located upstream of the yeast HIS4 represent a very strong meiotic recombination hotspot. Although the activity of this hotspot requires the transcription activator Rap1p, the level of HIS4 transcription is not directly related to the level of recombination. We find that the recombination-stimulating activity of Rap1p requires the transcription activation domain of the protein. We show that a hybrid protein with the Gal4p DNA-binding domain and the Rap1p activation domain can stimulate recombination in a strain in which Gal4p-binding sites are inserted upstream of HIS4. In addition, we find recombination hotspot activity associated with the Gal4p DNA-binding sites that is independent of known transcription factors. We suggest that yeast cells have two types of recombination hotspots,
(transcription factor dependent) and ß (transcription factor independent).
RECOMBINATION events are not distributed evenly along eukaryotic chromosomes. Regions with high (hotspots) and low (coldspots) levels of recombination exist (reviewed by ![]()
![]()
![]()
![]()
The HIS4 hotspot region contains binding sites for the transcription activators Rap1p, Gcn4p, Bas1p, and Bas2p (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
A number of observations indicate that the transcriptional activator Rap1p is important for hotspot activity at the HIS4 locus. First, as described above, alteration of the Rap1p-binding site upstream of HIS4 eliminates hotspot activity (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Rap1p has diverse cellular roles (reviewed by ![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Some of the functions described above require Rap1p to interact with other proteins, including Sir3p, Sir4p, Rif1p, and Rif2p (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
The domains of the 827-amino-acid Rap1p required for the activities described above are diagrammed in Figure 1. The region of the protein between amino acids 43 and 279 is required for the bend induced in DNA by Rap1p binding (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
|
Given the diverse cellular functions of Rap1p, a number of explanations of the recombination-stimulating effect of the protein are possible. First, the binding of Rap1p may open the chromatin, allowing access of the enzyme complex that forms the initiating double-strand DNA breaks; this complex presumably contains Spo11p (![]()
| MATERIALS AND METHODS |
|---|
Media:
Standard media were utilized (![]()
Plasmids:
The plasmids pAJL1000 and pDTK109 contain altered forms of RAP1 inserted into the CEN-containing vector pRS316 (![]()
N allele, encoding a Rap1p lacking amino acids near the N terminus (Figure 1). The pDTK109 plasmid was constructed by joining an EcoRI-XbaI fragment containing the rap1-
N allele [derived from pM672 (provided by D. Shore)] with EcoRI-XbaI-treated pRS316.
The plasmids pDTK116-BC, pDTK118-BAC, pDTK121-BA contain fusion genes encoding proteins with the DNA-binding domain from Gal4p (amino acids 1147 of Gal4p) attached to various Rap1p-derived domains inserted in the vector pRS316; the synthesis of the fusion gene in these plasmids is controlled by the RAP1 promoter. The portion of the Rap1p represented in each plasmid is shown in Figure 1. The plasmid pDTK116-BC was constructed by transferring the EcoRI-XbaI fragment from p136 (![]()
![]()
The plasmid pDTK121-BA was derived from pDTK118-BAC. pDTK118-BAC was treated with BamHI and NotI, deleting the DNA sequences encoding the Rap1p portion of the fusion protein, and a BamHI-NotI fragment encoding amino acids 630695 of Rap1p was inserted. This DNA fragment was produced by using the oligonucleotides 739 (5' CAGTAGGATCCTATCTTACGCTATACCAGAAAAC 3') and 706 (5' GTATTGCGGCCGCTTATGGTGGAAAGCTTATGGTATC 3') in a PCR reaction with undeleted pDTK118-BAC DNA; this fragment was then treated with BamHI and NotI. The plasmid pDTK122-B (encoding a protein with the Gal4p DNA-binding domain but no Rap1p protein sequences) was constructed by related procedures. The double-stranded oligonucleotide formed by annealing 13030 (5' GATCTAATGATAA 3') and 13031 (5' GGCCTTATCATTA 3') was ligated to BamHI/NotI-digested pDTK118-BAC. The altered regions of pDTK121-BA and pDTK122-B were confirmed by sequencing.
The plasmid pQF1 was used to replace the transcription-factor-binding sites located upstream of the wild-type HIS4 gene with duplicated Gal4p-binding sites. Oligonucleotides with the sequences 5' TCGACGGAAGACTCTCCTCCGCACTGTATTACCATAGTACCGCGGAAGACTCTCCTCCGC 3' and 5' TCGAGCGGAGGAGAGTCTTCCGCGGTACTATGGTAATACAGTGCGGAGGAGAGTCTTCCG 3' were annealed together and inserted into the XhoI site of pPD5 (a YIp5 derivative; ![]()
![]()
![]()
The plasmids used to generate mutations of various yeast genes were the following: (1) pLSD64 (provided by D. Shore; rap1::LEU2 allele), (2) pKD18 (provided by E. T. Young; adr1-
2::URA3 allele), (3) pBM2387 (provided by M. Johnston; gal4::hisG-URA3-hisG allele), (4) pNKY85 (provided by S. Keeney; leu2
::hisG-URA3-hisG allele), and (5) pNKY349 (provided by N. Kleckner; rad50S).
Strains:
All strains used in this study were derived from the haploid strains AS13 (MATa leu2 ura3 ade6 rme1) and AS4 (MAT
trp1 arg4 tyr7 ade6 ura3 spt22; ![]()
|
|
The diploid strains DTK438 and DTK453 were used to examine the effects of rap1-
N and rap1-17 on HIS4 hotspot activity. To construct an AS13-derived haploid strain with the rap1-
N mutation, we transformed the haploid strain HF4U (![]()
N) to yield DTK342. HF4U is isogenic with AS13 except for the following alterations: (1) replacement of HIS4 with his4-lopc, (2) replacement for wild-type RAD50 gene with the rad50S allele (![]()
![]()
N allele.
To create an AS13 derivative bearing rap1-17, we crossed DTK354 (described above) to DTK355. DTK355 was derived from DNY25 (which contains a his4-lopc mutation; ![]()
![]()
A similar process was used to create AS4-derived rap1-17 and rap1-
N strains. A rad50S derivative of AS4 (DNY107; ![]()
::hisG allele. DTK388 was mated to LS1-leu2
. LS1-leu2
was derived from LS1 (![]()
![]()
![]()
(DTK389) was transformed with a BglII-XbaI fragment derived from pLSD64 to generate DTK400 (heterozygous for rap1::LEU2). DTK410 and DTK411 were created by transformation of DKT400 with pDTK109 (encoding rap1-
N) and pAJL1000 (encoding rap1-17), respectively. DTK410 was sporulated and dissected, and a spore containing pDTK109 with the genotype
rap1::LEU2 was isolated (DTK431). Similarly, a spore derived from DTK411 containing pAJL1000 with the genotype
rap1::LEU2 was isolated (DTK451). The diploid DTK438 was constructed by mating DTK354 and DTK431, and the diploid DTK453 was generated by mating DTK366 and DTK451.
In the diploid strain QFY120, the transcription-factor-binding sites located upstream of HIS4 were replaced by duplicated Gal4p-binding sites. In addition, the strain was heterozygous for the his4-lopc allele. This strain was constructed by mating QFY32 and QFY33. The haploids QFY32 and QFY33 were derived from PD80 and PD63 (![]()
To examine the recombination-stimulating effects of various Gal4p/Rap1p fusion proteins, we transformed QFY122 with the following plasmids (name of transformed strain in parentheses): pRS316 (DTK191), pDTK116-BC (DTK192), pDTK118-BAC (DTK193), pDTK121-BA (DTK197), and pDTK122-B (DTK206). A related set of strains was constructed by transforming the rad50S diploid QFY135 with the same plasmids: PRS316 (DTK216), pDTK116-BC (DTK217), pDTK118-BAC (DTK218), pDTK121-BA (DTK219), and pDTK-122-B (DTK220). QFY135 was constructed by mating the haploids QFY44 and PG31, gal4::hisG derivatives of QFY36 and QFY37, respectively. QFY36 and QFY37 were Ura+ rad50S transformants obtained by transformation of HF5U (QFY36) and HF6U (QFY37) with EcoRI/BamHI-treated pNKY349.
Meiotic analysis:
For genetic analysis, diploids were sporulated on plates at 18° for 46 days and dissected by standard methods onto plates containing rich growth medium; the colonies were then replica plated to various omission media. Spores derived from strains heterozygous for the his4-lop and his4-lopc alleles have high levels of postmeiotic segregation, which are detectable as sectored His+/His- colonies on medium lacking histidine (![]()
![]()
Isolation and analysis of DNA and RNA:
DNA was isolated from meiotic or premeiotic cells by methods described previously (![]()
![]()
![]()
![]()
Total RNA was prepared (![]()
![]()
| RESULTS |
|---|
As described in the Introduction, Rap1p is required for the meiotic recombination hotspot observed upstream of HIS4. Rap1p has diverse cellular roles and the protein domains required for these roles have been characterized (Figure 1). To determine which protein domains of Rap1p were required for hotspot activity, we examined the recombination-stimulating properties of deletion derivatives of Rap1p. In addition, we studied the effects of fusion proteins with the Gal4p-binding domain and various segments of Rap1p on recombination in strains in which the normal HIS4 upstream sequences were replaced with Gal4p-binding sites. These two studies show that maximal hotspot activity requires proteins that have both a DNA-binding domain and a transcription activation domain.
Analysis of the effects of aminoterminal and carboxy-terminal deletions of Rap1p on HIS4 hotspot activity:
One convenient method of monitoring HIS4 hotspot activity is by measuring the frequency of aberrant segregation (non-2:2 segregation) of a heterozygous mutation within the HIS4 coding sequence by tetrad analysis. In many of our previous studies, we have used mutant alleles resulting from 26-bp palindromic insertions (his4-lopc or his4-lop) near the beginning of the HIS4 gene. In one such strain, DNY26 (![]()
![]()
52, strain PD81) or the Rap1p-binding site (his4-51, strain MW118) substantially reduces the frequency of aberrant segregation (![]()
![]()
![]()
![]()
|
To determine the role of the nonessential functional domains of Rap1p in stimulating HIS4 hotspot activity, two diploid strains were constructed, each with a different mutant allele of RAP1. The strain DTK453 contained the rap1-17 mutant allele (![]()
N (![]()
The aberrant segregation of his4-lopc in DTK453 was 38%, significantly (P < 0.001 by Fisher exact test for both comparisons) above the level of aberrant segregation seen in a strain lacking the HIS4 upstream activation region (PD81) or in a strain that lacks only the Rap1p DNA-binding site (MW118). The aberrant segregation of his4-lopc in DTK438 (37%) was nearly identical to DTK453 and significantly greater than observed for PD81 or MW118. For both DTK453 and DTK438, the frequencies of aberrant segregation for his4-lopc were significantly reduced compared to the frequency observed in the wild-type strain DNY26.
These results suggest that the portions of Rap1p that are deleted in Rap1-17p and Rap1p-
Np are not essential, but may contribute, to hotspot activity. Alternatively, because the mutated forms of Rap1p are expressed from a plasmid in DTK453 and DTK438, it is possible that the level of Rap1p is quantitatively different from the wild-type level of Rap1p. The strains with the mutated forms of Rap1p do not have a global reduction in meiotic recombination relative to the wild-type DNY26 strain. The gene conversion frequencies at the ARG4 locus were 18% (DTK438), 12% (DTK453), and 9% (DNY26). The recombination distances between ARG4 and the centromere in the three strains were 12 cM (DTK438), 16 cM (DTK453), and 12 cM (DNY26).
Strains with a null mutation of RAP1 are not viable. If this lack of viability is a consequence of the role of Rap1p as a transcription factor, Rap1-17p and Rap1-
Np should be capable of stimulating HIS4 transcription. We confirmed this prediction by measuring the level of HIS4 mRNA (relative to an actin control mRNA) by Northern analysis (Figure 2). Control strains AS13 and HF4U (wild-type promoter sequences and wild-type Rap1p) had similar levels of HIS4 mRNA. A strain with a deletion of the Rap1p-binding site (HF3) had a level of HIS4 transcript at least 10-fold reduced from the control strains, whereas strains with the rap1-17 or rap1-
N mutations had HIS4 mRNA levels that were reduced about 4-fold. Thus, the proteins encoded by these mutant genes retain some, but not all, of their transcription-stimulating activity.
|
As shown in Figure 1, Rap1-17p lacks the silencing domain, the domain required for telomere length maintenance, and the binding sites for Sir3p, Sir4p, and Rif1p. The results shown in Table 3 and Figure 2 indicate that none of these functions are essential for the hotspot-activation or transcription-activation functions of Rap1p. As expected from this conclusion, a deletion of SIR3 had no effect on DSB formation at the HIS4 hotspot (data not shown). Similarly, the region of Rap1p that generates a DNA bend upon binding (missing in Rap1-
Np) is not required for hotspot activity or transcription activation. These results suggest that the essential recombination-stimulating activity of Rap1p might be the DNA-binding and transcription activation domains. Because Rap1p is essential, we could not examine the effects of deletions removing these domains by the same approach. Consequently, we replaced the Rap1p-binding sites upstream of HIS4 with Gal4p-binding sites and examined the transcription-stimulating effects of various activators that had the Gal4p DNA-binding domain and portions of Rap1p.
Stimulation of HIS4 gene expression and meiotic recombination activity by insertion of Gal4-binding sites:
As in the studies described above, we used diploid strains that were heterozygous for the allele his4-lopc and homozygous for various sequences upstream of HIS4. We first examined the effects of these alterations on HIS4 gene expression. As shown in Figure 3, strains with the wild-type upstream sequences (DNY26) or with a telomeric insertion (MW154, containing three Rap1p-binding sites replacing the wild-type upstream sequences) have strong His+ phenotypes (![]()
![]()
|
The activation of HIS4 gene expression in QFY120 in glucose-containing medium is somewhat surprising for two reasons. First, expression of Gal4p is repressed four- to seven-fold in cells grown on glucose-containing medium (![]()
![]()
![]()
![]()
To investigate in more detail the possibility of Gal4p-independent activation of HIS4 expression by the duplicated Gal4p-binding sites, we constructed a derivative of QFY120 (QFY122) that was homozygous for a deletion of GAL4. In addition, because the Gal4p-binding site shares sequence homology with the binding site recognized by the transcription factor Adr1p (![]()
In these strains, we monitored the level of aberrant segregation for the his4-lopc allele (as a genetic measure of hotspot activity), as well as the frequency of crossing-over between HIS4 and the linked LEU2 gene (Table 3). QFY120, homozygous for the insertion of duplicated Gal4p-binding sites (his4-301), had a level of aberrant segregation (53%) for the his4-lopc allele that was close to that observed in the wild-type strain DNY26. Sporulation of QFY120 in medium containing galactose, instead of glucose, did not significantly elevate the frequency of aberrant segregation or crossovers above the frequency observed in cells sporulated in glucose-containing medium. In addition, derivatives of QFY120 in which GAL4 (QFY122) or GAL4 and ADR1 (QFY132) were mutated had about the same level of aberrant segregation and crossovers as QFY120 (Table 3). In summary, when duplicated Gal4p-binding sites were inserted upstream of HIS4, we observed recombination hotspot activity. Both the frequency of aberrant segregation of his4-lopc and the level of HIS4-LEU2 crossovers were elevated relative to the values observed in PD81, a strain that lacks hotspot activity. The hotspot activity of the Gal4p-binding sites, however, did not require the binding of Gal4p or Adr1p.
At least two possibilities exist for the hotspot activity observed in QFY120 and its derivatives. First, the duplicated Gal4p-binding sites might bind an unknown transcription factor that stimulates meiotic recombination at HIS4. Alternatively, some property of the DNA sequence of the insertion may be responsible for hotspot activity. These possibilities will be addressed in more detail in the DISCUSSION.
Analysis of the recombination-stimulating properties of fusion proteins containing the DNA-binding domain of Gal4p and activation domains of Rap1p in strains with Gal4p-binding sites upstream of HIS4:
Although Gal4p does not appear to contribute to hotspot activity (as described above), we previously concluded that Rap1p was capable of contributing to HIS4 hotspot activity (![]()
![]()
![]()
These strains were sporulated and tetrads were dissected. As above, we monitored the aberrant segregation frequency of his4-lopc and crossovers between HIS4 and LEU2; only tetrads in which at least one spore retained the plasmid (signalling retention of the plasmid in the diploid cell giving rise to the spores) were included in our analysis (Table 4). As expected, QFY122 with the vector alone had the same frequency of recombination as QFY122 without any plasmid (compare Table 3 and Table 4). Three types of effects were seen in the derivatives of QFY122 with the fusion plasmids. In the strain with pDTK116-BC, both the frequency of aberrant segregation and the level of HIS4-LEU2 crossovers were significantly (P < 0.01) reduced compared to QFY122 with the vector alone. In the strains with pDTK118-BAC and pDTK121-BA, both the frequency of aberrant segregation and the level of crossovers between HIS4 and LEU2 were significantly (P < 0.01) elevated compared to QFY122 with only the vector. In the strain with the plasmid pDTK122-B, the frequency of aberrant segregation was significantly (P < 0.02) elevated, but the frequency of crossovers was not (P = 0.8), compared with QFY122 with the vector alone.
|
These results indicate that fusion proteins with the Gal4p-binding domain and a complete Rap1p activation domain (encoded by plasmids pDTK118-BAC and pDTK-121-BA) stimulate meiotic recombination more effectively than other fusion proteins. A protein with the Gal4p-binding domain with no Rap1p (encoded by pDTK122-B) had a smaller stimulatory effect on recombination, whereas a fusion protein with the Gal4p-binding domain, a truncated activation domain, and the C-terminal sequences derived from Rap1p (encoded by pDTK116-BC) suppressed recombination. These effects are unlikely to reflect differing amounts of different Gal4p/Rap1p proteins, because Western analysis indicates similar levels of expression for the different fusions (![]()
As first shown at the ARG4 locus (![]()
![]()
![]()
|
As expected, the highest levels of DSB formation (~25%) were observed in strains with the plasmids pDTK118-BAC and pDTK121-BA; these same plasmids were associated with the highest levels of recombination. The levels of DSB in the other three strains were considerably lower, between 3 and 8%. Although this result is consistent with the lower level of recombination observed in these strains, the level of DSBs does not appear to be directly proportional to the level of recombination. For example, although the frequency of aberrant segregation differs by less than a factor of two between the strain with the plasmid pDKT118-BA and the strain with the vector alone, the level of DSBs differs by about a factor of three. In summary, the analysis of DSBs confirms that the highest level of recombination in the QFY122 background requires both the Gal4p-binding domain and a complete Rap1p activation domain. Some hotspot activity (measured by genetic and physical techniques), however, results from the duplicated Gal4p-binding sites in the absence of the binding of known transcription factors.
Analysis of the effects of fusion proteins containing the DNA-binding domain of Gal4p and activation domains of Rap1p on gene expression in strains with Gal4p-binding sites upstream of HIS4:
We examined the QFY122 derivatives with the same plasmids used to study recombination for growth on medium with and without histidine. Although all strains grew at approximately the same rate on medium with histidine, growth on medium without histidine varied in the different strains (Figure 5). Strains with the plasmids pDTK118-BAC or pDTK121-BA formed colonies much more readily on medium lacking histidine than the strains with pRS316, pDTK116-BC, or pDTK122-B. All of these strains, unlike PD81, however, eventually formed colonies on the histidine-deficient medium. Thus, the same fusion proteins that maximally stimulate HIS4 meiotic recombination also maximally stimulate HIS4 gene expression.
|
| DISCUSSION |
|---|
The main conclusions of this study are the following: (1) maximal rates of meiotic recombination hotspot activity stimulated by the binding of transcription factors require both the DNA binding and activation domains of these proteins, and (2) certain DNA sequences appear to stimulate recombination and gene expression without requiring any known bound transcription factors. We suggest that yeast cells have two types of recombination hotspots:
hotspots, in which hotspot activity involves an interaction of the recombination machinery with the activation domain of bound transcription factors, and ß hotspots, in which the recombination machinery (without contacting transcription factors) acts on "naked" DNA. Each of these conclusion will be discussed further below.
Transcription-factor-dependent stimulation of recombination activity:
We previously concluded that the activity of the wild-type HIS4 recombination hotspot required the binding of three transcription factors, Rap1p, Bas1p, and Bas2p (![]()
![]()
![]()
Previous studies demonstrate that meiotic hotspot activity at HIS4 is not directly related to the rate of transcription (![]()
![]()
![]()
![]()
![]()
|
A number of variants of the second model are possible. The activation domain could contact the recombination machinery directly or indirectly through connector proteins. Once the connection is made, the transcription factor could tether the recombination complex to the DNA until the initiating DSB is made or the connection could simply facilitate the entry of the recombination machinery onto the chromosome by a transient association. Because DSBs occur in a local region of ~50100 bp near the hotspot, rather than at a single position (![]()
![]()
![]()
![]()
![]()
Different transcription factors appear to have different abilities to stimulate recombination. HIS4 hotspot activity in strains with duplicated Gal4p-binding sites upstream of HIS4 was approximately the same with or without Gal4p, even when cells were sporulated in galactose-containing medium (Table 3). Although we did not monitor synthesis of Gal4p in meiosis, ![]()
![]()
![]()
The results obtained with the Gal4p/Rap1p fusions (Table 4) add several complicating factors. First, in the strain with the plasmid pDTK116-BC (fusion protein with the Gal4p DNA-binding domain and the C terminus of Rap1p lacking the activation domain), we found a significant reduction of recombination compared to the level of exchange found in the absence of Gal4p. Second, the strain with the plasmid pDTK122-B (Gal4p-binding domain alone) had slightly elevated levels of aberrant segregation for his4-lopc without an elevated level of crossovers or DSBs. Although we have no simple explanation for these results, some of these complications may represent interactions between transcription-factor-dependent and transcription-factor-independent hotspot activity (as described below).
The finding that transcription factors stimulate meiotic recombination at the HIS4 locus (as described above and in ![]()
![]()
![]()
![]()
![]()
In summary, meiotic recombination hotspots induced by the action of transcription factors may be common in eukaryotes. We term these
-recombination hotspots.
Possible transcription-factor-independent stimulation of recombination activity and gene expression at HIS4:
In addition to naturally occurring meiotic recombination hotspots, foreign DNA sequences introduced into yeast cells will occasionally stimulate meiotic recombination. For example, high levels of meiotic recombination are associated with integrated pBR322 sequences (![]()
![]()
![]()
-recombination hotspot for which the transcription factor has not yet been identified. An alternative possibility is that the duplicated binding sites represent a different type of hotspot (ß-hotspot) in which hotspot activity reflects DNA that is accessible to the recombination machinery independent of the binding of a transcription factor (Figure 6B); this DNA may be "naked," that is, unbound by any cellular protein. We favor the second explanation, because it seems more consistent with the observation that insertions of foreign DNA of diverse sequence often have hotspot activity.
Two other issues related to the hypothesis of two types of hotspots should be discussed. First, most recombination hotspots in yeast are located in regions of open chromatin (![]()
- and ß-hotspots. Second, we suggest that naturally occurring hotspots in yeast are likely to be
rather than ß. Because the chromosome that initiates recombination is the recipient of information during meiotic exchange (reviewed by ![]()
-hotspots are transcription-factor-binding sites, it is likely that other selective forces will balance the loss caused by meiotic recombination. Any ß-hotspot that is not associated with a cellular function, however, would be expected to be eventually lost as a consequence of recombination.
There are two modes of stimulating transcription that may be related to our proposal of two types of recombination hotspots. High levels of gene expression in yeast, as in other eukaryotes, usually require the binding of transcription factors to the upstream region (reviewed by ![]()
![]()
![]()
Minisatellite instability:
Mammalian genomes contain regions of DNA (minisatellites) in which short (20 to several hundred bp) repeats are tandemly arranged (![]()
![]()
- or ß-hotspots. For example, the minisatellite located near Ha-Ras that binds the NF-
B transcription factor (![]()
hotspot. Previously, ![]()
| ACKNOWLEDGMENTS |
|---|
We thank D. Shore (and members of his lab), A. Lustig, S. G. Gasser, M. Johnston, and E. T. Young for yeast strains, plasmids, and/or useful discussions. We thank M. Dominska and D. Terrill for help with tetrad dissections and E. Sia and R. Kokoska for comments on the manuscript. This work was supported by National Institutes of Health grant GM-24110. D.T.K. is a Special Fellow of the Leukemia Society of America.
Manuscript received April 1, 1998; Accepted for publication January 28, 1999.
| LITERATURE CITED |
|---|
ALANI, E., R. PADMORE, and N. KLECKNER, 1990 Anaylsis of wild-type and rad50 mutants of yeast suggests an intimate relationship between meiotic chromosome synapsis and recombination. Cell 61:419-436[Medline].
ARMOUR, J. A. L. and A. J. JEFFREYS, 1992 Biology and applications of human minisatellite loci. Curr. Opin. Genet. Dev. 2:850-856[Medline].
ARNDT, K. T., C. A. STYLES, and G. R. FINK, 1987 Multiple global regulators control HIS4 transcription in yeast. Science 237:874-880
BAUDAT, F. and A. NICOLAS, 1997 Clustering of meiotic double-strand breaks on yeast chromosome III. Proc. Natl. Acad. Sci. USA 94:5213-5218
BHAT, P. J. and J. E. HOPPER, 1992 Overproduction of the GAL1 or GAL3 protein causes galactose-independent activation of the GAL4 protein: evidence for a new model of induction for the yeast GAL/MEL regulon. Mol. Cell. Biol. 12:2701-2707
BUCK, S. W. and D. SHORE, 1995 Action of a RAP1 carboxy-terminal silencing domain reveals an underlying competition between HMR and telomeres in yeast. Genes Dev. 9:370-384
CHENG, C., H. KACHEROVSKY, K. M. DOMBEK, S. CAMIER, and S. K. THUKRAL et al., 1994 Identification of potential target genes for Adr1p through characterization of essential nucleotides in UAS1. Mol. Cell. Biol. 14:3842-3852
DE MASSY, B., V. ROCCO, and A. NICOLAS, 1995 The nucleotide mapping of DNA double-strand breaks at the CYS3 initiation site of meiotic recombination in Saccharomyces cerevisae.. EMBO J. 14:4589-4598[Medline].
DETLOFF, P., M. A. WHITE, and T. D. PETES, 1992 Analysis of a gene conversion gradient at the HIS4 locus in Saccharomyces cerevisae.. Genetics 132:113-123[Abstract].
DEVLIN, C., K. TICE-BALDWIN, D. SHORE, and K. T. ARNDT, 1991 RAP1 is required for BAS1/BAS2- and GCN4-dependent transcription of the yeast HIS4 gene. Mol. Cell. Biol. 11:3642-3651
FAN, Q. and T. D. PETES, 1996 Relationship between nuclease-hypersensitive sites and meiotic recombination hot spot activity at the HIS4 locus of Saccharomyces cerevisiae.. Mol. Cell. Biol. 16:2037-2043[Abstract].
FAN, Q., F. XU, and T. D. PETES, 1995 Meiosis-specific double-strand DNA breaks at the HIS4 recombination hot spot in the yeast Saccharomyces cerevisae: control in cis and trans.. Mol. Cell. Biol. 15:1679-1688[Abstract].
FELDMANN, H., M. AIGLE, G. ALJINOVIC, B. ANDRE, and M. C. BACLET et al., 1994 Complete DNA sequence of yeast chromosome II. EMBO J. 13:5795-5809[Medline].
GILSON, E., M. ROBERGE, R. GIRALDO, D. RHODES, and S. M. GASSER, 1993 Distortion of the DNA double Helix by RAP1 at silencers and multiple telomeric binding sites. J. Mol. Biol. 231:293-310[Medline].
GILSON, E., T. MULLER, J. SOGO, T. LAROCHE, and S. M. GASSER, 1994 RAP1 stimulates single- to double-strand association of yeast telomeric DNA: implications for telomere-telomere interactions. Nucleic Acids Res. 22:5310-5320
GIRALDO, R. and D. RHODES, 1994 The yeast telomere-binding protein RAP1 binds to and promotes the formation of DNA quadruplexes in telomeric DNA. EMBO J. 13:2411-2420[Medline].
GRIGGS, D. W. and M. JOHNSTON, 1991 Regulated expression of the GAL4 activator gene in yeast provides a sensitive genetic switch for glucose repression. Proc. Natl. Acad. Sci. USA 88:8597-8601
GUTHRIE, C., and G. R. FINK (Editors), 1991 Guide to Yeast Genetics and Molecular Biology. Academic Press, San Diego.
HARDY, C. F. J., L. SUSSEL, and D. SHORE, 1992 A RAP1-interacting protein involved in transcriptional silencing and telomere length regulation. Genes Dev. 6:801-814
HENRY, Y. A. L., A. CHAMBERS, J. S. H. TSANG, A. J. KINGSMAN, and S. M. KINGSMAN, 1990 Characterization of the DNA binding domain of the yeast RAP1 protein. Nucleic Acids Res. 18:2617-2623
HERSKOWITZ, I. and R. E. JENSEN, 1991 Putting the HO gene to work: practical uses for mating-type switching. Methods Enzymol. 194:132-146[Medline].
IYER, V. and K. STRUHL, 1995 Poly(dA:dT), a ubiquitous promoter element that stimulates transcription via its intrinsic DNA structure. EMBO J. 14:2570-2579[Medline].
JEFFREYS, A. J., K. TAMAKI, A. MACLEOD, D. G. MONCKTON, and D. L. NEIL et al., 1994 Complex gene conversion events in germline mutation at human minisatellites. Nature Genetics 6:136-145[Medline].
JOHNSTON, S. A., J. M. SALMERON, and S. S. DINCHER, 1987 Interaction of positive and negative regulatory proteins in the galactose regulon of yeast. Cell 50:143-146[Medline].
KEENEY, S., C. N. GIROUX, and N. KLECKNER, 1997 Meiosis-specific DNA double-strand breaks are catalyzed by Spo11, a member of a widely conserved protein family. Cell 88:375-384[Medline].
KLEIN, F., T. LAROCHE, M. E. CARDENAS, J. F.-X. HOFMANN, and D. SCHWEIZER et al., 1992 Localization of RAP1 and topoisomerase II in nuclei and meiotic chromosomes of yeast. J. Cell Biol. 117:935-948
KOLODKIN, A. L., A. J. S. KLAR, and F. W. STAHL, 1986 Double-strand breaks can initiate meiotic recombination in S. cerevisiae.. Cell 46:733-740[Medline].
KON, N., M. D. KRAWCHUK, B. G. WARREN, G. R. SMITH, and W. P. WAHLS, 1997 Transcription factor Mts1/Mts2 (Aft1/Pcr1, Gad7/Pcr1) activates the M26 meiotic recombination hotspot in S. pombe.. Proc. Natl. Acad. Sci. USA 94:13765-13770
KURTZ, S. and D. SHORE, 1991 RAP1 protein activates and silences transcription of mating-type genes in yeast. Genes Dev. 5:616-627
KYRION, G., K. A. BOAKYE, and A. J. LUSTIG, 1992 C-terminal truncation of RAP1 results in deregulation of telomere size, stability, and function in Saccharomyces cerevisiae.. Mol. Cell. Biol. 12:5159-5173
LICHTEN, M. and A. S. H. GOLDMAN, 1995 Meiotic recombination hotspots. Annu. Rev. Genet. 29:423-444[Medline].
LIU, Z. and B.-K. TYE, 1991 A yeast protein that binds to vertebrate telomeres and conserved yeast telomeric junctions. Genes Dev. 5:49-59
LIU, J., T.-C. WU, and M. LICHTEN, 1995 The location and structure of double-strand breaks induced during yeast meiosis: evidence for a covalently-linked DNA-protein intermediate. EMBO J. 14:4599-4608[Medline].
LONGTINE, M. S., N. M. WILSON, M. E. PETRACEK, and J. BERMAN, 1989 A yeast telomere binding activity binds to two related telomere sequence motifs and is indistinguishable from RAP1. Curr. Genet. 16:225-239[Medline].
LUSTIG, A. J. and T. D. PETES, 1993 Genetic control of simple sequence stability in yeast. Genome Anal. 7:79-106.
MA, J. and M. PTASHNE, 1987 The carboxy-terminal 30 amino acids of GAL4 are recognized by GAL80. Cell 50:137-142[Medline].
MARCAND, S., E. GILSON, and D. SHORE, 1997 A protein-counting mechanism for telomere length regulation in yeast. Science 275:986-990
MORETTI, P., K. FREEMAN, L. COODLY, and D. SHORE, 1994 Evidence that a complex of SIR proteins interacts with the silencer and telomere-binding protein RAP1. Genes Dev. 8:2257-2269
NAG, D. K. and T. D. PETES, 1993 Physical detection of heteroduplexes during meiotic recombination in the yeast Saccharomyces cerevisiae.. Mol. Cell. Biol. 13:2324-2331
NAG, D. K., M. A. WHITE, and T. D. PETES, 1989 Palindromic sequences in heteroduplex DNA inhibit mismatch repair in yeast. Nature 340:318-320[Medline].
NAGAWA, F. and G. R. FINK, 1985 The relationship between the "TATA" sequence and transcription initiation sites at the HIS4 gene of Saccharomyces cerevisiae.. Proc. Natl. Acad. Sci. USA 82:8557-8561
PALLADINO, F., T. LAROCHE, E. GILSON, A. AXELROD, and L. PILLUS et al., 1993 SIR3 and SIR4 proteins are required for the positioning and integrity of yeast telomeres. Cell 75:543-555[Medline].
PERKINS, D. D., 1949 Biochemical mutants in the smut fungus Ustilago maydis.. Genetics 34:607-626
PETES, T. D., R. E. MALONE and L. S. SYMINGTON, 1991 Recombination in yeast, pp. 407521 in The Molecular and Cellular Biology of the Yeast Saccharomyces, Vol. 1, edited by J. R. BROACH, J. R. PRINGLE and E. W. JONES. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
PTASHNE, M. and A. GANN, 1997 Transcriptional activation by recruitment. Nature 386:569-577[Medline].
SAMBROOK, J., E. F. FRITSCH and T. MANIATIS, 1989 Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
SHENKAR, R., M. SHEN, and N. ARNHEIM, 1991 DNase I-hypersensitive sites and transcription factor-binding motifs within the mouse Eß meiotic recombination hotspot. Mol. Cell. Biol. 11:1813-1819
SHORE, D., 1994 RAP1: a protean regulator in yeast. Trends Genet. 10:408-412[Medline].
SIKORSKI, R. S. and P. HIETER, 1989 A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.. Genetics 122:19-27
SOLOMON, F., L. CONNELL, D. KIRKPATRICK, V. PRAITIS and B. WEINSTEIN, 1992 Methods for studying the cytoskeleton in yeast, pp. 197221 in The Cytoskeleton: A Practical Approach, edited by K. L. CARRAWAY and C. A. C. CARRAWAY. IRL Press, New York.
STAPLETON, A. and T. D. PETES, 1991 The Tn3 ß-lactamase gene acts as a hotspot for meiotic recombination in yeast. Genetics 127:39-51[Abstract].
STRUHL, K., 1995 Yeast transcription regulatory mechanisms. Annu. Rev. Genet. 29:651-674[Medline].
SUN, H., D. TRECO, N. P. SCHULTES, and J. W. SZOSTAK, 1989 Double-strand breaks at an initiation site for meiotic gene conversion. Nature 338:87-90[Medline].
SUSSEL, L. and D. SHORE, 1991 Separation of transcriptional activation and silencing functions of the RAP1-encoded repressor/activator protein 1: isolation of viable mutants affecting both silencing and telomere length. Proc. Natl. Acad. Sci. USA 88:7749-7753
SYMINGTON, L. S. and T. D. PETES, 1988 Expansions and contractions of the genetic map relative to the physical map of yeast chromosome III. Mol. Cell. Biol. 8:595-604
TICE-BALDWIN, K., G. R. FINK, and K. T. ARNDT, 1989 BAS1 has a Myb motif and activates HIS4 transcription only in combination with BAS2. Science 246:931-935
TREPICCHIO, W. L. and T. G. KRONTIRIS, 1993 IGH minisatellite suppression of USF-binding-site- and Eµ-mediated transcriptional activation of the adenovirus major late promoter. Nucleic Acids Res. 21:977-985
WAHLS, W. P., 1998 Meiotic recombination hotspots: shaping the genome and insights into hypervariable minisatellite DNA change. Curr. Top. Dev. Biol. 32:37-75.
WHITE, M. A., M. WIERDL, P. DETLOFF, and T. D. PETES, 1991 DNA-binding protein RAP1 stimulates meiotic recombination at the HIS4 locus in yeast. Proc. Natl. Acad. Sci. USA 88:9755-9759
WHITE, M. A., P. DETLOFF, M. STRAND, and T. D. PETES, 1992 A promoter deletion reduces the rate of mitotic, but not meiotic, recombination at the HIS4 locus in yeast. Curr. Genet. 21:109-116[Medline].
WHITE, M. A., M. DOMINSKA, and T. D. PETES, 1993 Transcription factors are required for the meiotic recombination hotspot at the HIS4 locus in Saccharomyces cerevisae.. Proc. Natl. Acad. Sci. USA 90:6621-6625
WOTTON, D. and D. SHORE, 1997 A novel Rap1p-interacting factor, Rif2p, cooperates with Rif1p to regulate telomere length in Saccharomyces cerevisae.. Genes Dev. 11:748-760
WU, T.-C. and M. LICHTEN, 1994 Meiosis-induced double-strand break sites determined by yeast chromatin structure. Science 263:515-518
WU, T. C. and M. LICHTEN, 1995 Factors that affect the location and frequency of meiosis-induced double-strand breaks in Saccharomyces cerevisiae.. Genetics 140:55-66[Abstract].
XU, L. and N. KLECKNER, 1995 Sequence non-specific double-strand breaks and interhomolog interactions prior to double-strand break formation at a meiotic recombination hotspot in yeast. EMBO J. 14:5115-5128[Medline].
XU, F. and T. D. PETES, 1996 Fine-structure mapping of meiosis-specific double-strand DNA breaks at a recombination hotspot associated with an insertion of telomeric sequences upstream of the HIS4 locus in yeast. Genetics 143:1115-1125[Abstract].
This article has been cited by other articles:
![]() |
J. Gao, M. K. Davidson, and W. P. Wahls Distinct regions of ATF/CREB proteins Atf1 and Pcr1 control recombination hotspot ade6-M26 and the osmotic stress response Nucleic Acids Res., May 1, 2008; 36(9): 2838 - 2851. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Fukuda, K. Kugou, H. Sasanuma, T. Shibata, and K. Ohta Targeted induction of meiotic double-strand breaks reveals chromosomal domain-dependent regulation of Spo11 and interactions among potential sites of meiotic recombination Nucleic Acids Res., February 11, 2008; 36(3): 984 - 997. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. W. Steiner and G. R. Smith Optimizing the Nucleotide Sequence of a Meiotic Recombination Hotspot in Schizosaccharomyces pombe Genetics, April 1, 2005; 169(4): 1973 - 1983. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Zhang, F. Li, J. Li, M. Q. Zhang, and X. Zhang Evidence and characteristics of putative human {alpha} recombination hotspots Hum. Mol. Genet., November 15, 2004; 13(22): 2823 - 2828. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. J. Gong and K. G. Golic Genomic Deletions of the Drosophila melanogaster Hsp70 Genes Genetics, November 1, 2004; 168(3): 1467 - 1476. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Merker, M. Dominska, and T. D. Petes Patterns of Heteroduplex Formation Associated With the Initiation of Meiotic Recombination in the Yeast Saccharomyces cerevisiae Genetics, September 1, 2003; 165(1): 47 - 63. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Fourel, T. Miyake, P.-A. Defossez, R. Li, and E. Gilson General Regulatory Factors (GRFs) as Genome Partitioners J. Biol. Chem., October 25, 2002; 277(44): 41736 - 41743. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. A. Jauert, S. N. Edmiston, K. Conway, and D. T. Kirkpatrick RAD1 Controls the Meiotic Expansion of the Human HRAS1 Minisatellite in Saccharomyces cerevisiae Mol. Cell. Biol., February 1, 2002; 22(3): 953 - 964. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. F. F. Abdullah and R. H. Borts Meiotic recombination frequencies are affected by nutritional states in Saccharomycescerevisiae PNAS, November 20, 2001; (2001) 201529598. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Davis and G. R. Smith Meiotic recombination and chromosome segregation in Schizosaccharomyces pombe PNAS, July 17, 2001; 98(15): 8395 - 8402. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Gerton, J. DeRisi, R. Shroff, M. Lichten, P. O. Brown, and T. D. Petes Inaugural Article: Global mapping of meiotic recombination hotspots and coldspots in the yeast Saccharomyces cerevisiae PNAS, October 10, 2000; 97(21): 11383 - 11390. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. T. Kirkpatrick, Y.-H. Wang, M. Dominska, J. D. Griffith, and T. D. Petes Control of Meiotic Recombination and Gene Expression in Yeast by a Simple Repetitive DNA Sequence That Excludes Nucleosomes Mol. Cell. Biol., November 1, 1999; 19(11): 7661 - 7671. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Yu and R. H. Morse Chromatin Opening and Transactivator Potentiation by RAP1 in Saccharomyces cerevisiae Mol. Cell. Biol., August 1, 1999; 19(8): 5279 - 5288. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Yu, N. Sabet, A. Chambers, and R. H. Morse The N-terminal and C-terminal Domains of RAP1 Are Dispensable for Chromatin Opening and GCN4-mediated HIS4 Activation in Budding Yeast J. Biol. Chem., August 24, 2001; 276(35): 33257 - 33264. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. F. F. Abdullah and R. H. Borts Meiotic recombination frequencies are affected by nutritional states in Saccharomycescerevisiae PNAS, December 4, 2001; 98(25): 14524 - 14529. [Abstract] [Full Text] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Kirkpatrick, D. T.
- Articles by Petes, T. D.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Kirkpatrick, D. T.
- Articles by Petes, T. D.




gure were homozygous for insertions of duplicated Gal4p-binding sites upstream of HIS4, gal4, and rad50S. In addition, each strain contained a plasmid with vector sequences alone (pRS316) or insertions of genes encoding various Gal4p/Rap1 fusion proteins (






