- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Formosa, T.
- Articles by Nittis, T.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Formosa, T.
- Articles by Nittis, T.
Dna2 Mutants Reveal Interactions with Dna Polymerase
and Ctf4, a Pol
Accessory Factor, and Show That Full Dna2 Helicase Activity Is Not Essential for Growth
Tim Formosaa and
Thalia Nittisa
a Department of Biochemistry, University of Utah School of Medicine, Salt Lake City, Utah 84132
Corresponding author: Tim Formosa, Department of Biochemistry, University of Utah School of Medicine, 50 N. Medical Dr., Salt Lake City, UT 84132., formosa{at}medschool.med.utah.edu (E-mail)
Communicating editor: L. S. SYMINGTON
| ABSTRACT |
|---|
Mutations in the gene for the conserved, essential nuclease-helicase Dna2 from the yeast Saccharomyces cerevisiae were found to interact genetically with POL1 and CTF4, which encode a DNA Polymerase
subunit and an associated protein, suggesting that Dna2 acts in a process that involves Pol
. DNA2 alleles were isolated that cause either temperature sensitivity, sensitivity to alkylation damage, or both. The alkylation-sensitive alleles clustered in the helicase domain, including changes in residues required for helicase activity in related proteins. Additional mutations known or expected to destroy the ATPase and helicase activities of Dna2 were constructed and found to support growth on some media but to cause alkylation sensitivity. Only damage-sensitive alleles were lethal in combination with a ctf4 deletion. Full activity of the Dna2 helicase function is therefore not needed for viability, but is required for repairing damage and for tolerating loss of Ctf4. Arrest of dna2 mutants was RAD9 dependent, but deleting this checkpoint resulted in either no effect or suppression of defects, including the synthetic lethality with ctf4. Dna2 therefore appears to act in repair or lagging strand synthesis together with Pol
and Ctf4, in a role that is optimal with, but does not require, full helicase activity.
THE Ctf4 protein binds to the catalytic subunit of DNA Polymerase
(Pol1 protein) from the yeast Saccharomyces cerevisiae either as the isolated purified Pol1 protein or as the endogenous Pol
/primase holoenzyme in cell extracts (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
subunit (![]()
and other proteins. In this case, introducing mutations into other components of these complexes might make Ctf4 function essential, if two destabilizing effects could not be tolerated simultaneously. To further characterize the role of Ctf4 and to identify other proteins that might act with Pol
, we screened for mutations that are synthetically lethal with a ctf4 deletion.
One of the mutations identified was an allele of the essential gene DNA2. DNA2 is broadly conserved among eukaryotes, has helicase signature motifs and helicase activity, and is required for DNA synthesis in permeabilized cells, intact cells, and in nuclear extracts (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
, strengthening the ties to lagging strand synthesis. We also find that mutations known or expected to diminish or obliterate the helicase function of Dna2 still allow growth but cause sensitivity to alkylation damage and inability to tolerate loss of Ctf4 function. These results further deemphasize the role of the helicase activity of Dna2 and suggest that Dna2 and Ctf4 proteins act together in some forms of damage repair.
| MATERIALS AND METHODS |
|---|
Media and strains:
Media were as described (![]()
![]()
|
Synthetic lethal screen:
A ctf4 synthetic lethal screen was performed essentially as described (![]()
Plasmids:
pTF90 was derived from pRS426 (![]()
![]()
2(::TRP1)], and also removed the last 10 residues of SOL3. pJB20 was derived from pTF98 by subcloning the 7960-bp BamHI fragment containing DNA2 into pHSS6 (![]()
![]()
Site-directed mutagenesis:
The 2272-bp XbaI-PstI fragment containing the helicase domain of DNA2 was subcloned into pBlueScript II (Stratagene, La Jolla, CA) and mutagenized using the Quikchange system (Stratagene). GGAATGCCAGGGACTGGTACCACTACTGTTATCGCAG and its complement were used to introduce K1080T (and a KpnI site; mutation of this invariant lysine to any other residue destroys ATPase activity, so K1080T should be equivalent to the previously described K1080E allele; ![]()
![]()
Transposons:
Tn1000 mutagenesis was performed as described (![]()
![]()
Isolation of additional dna2 mutants:
pTF98 (YCp, DNA2, LEU2) was treated with 1 M hydroxylamine for 2040 min at 75° as described (![]()
2(::TRP1) with a low copy DNA2 plasmid marked with URA3] was transformed with the mutagenized pTF98. Transformants were replica plated to medium containing 5-fluoro-orotic acid (5-FOA; ![]()
3(::URA3)] with a mutated pTF98 plasmid was screened for spontaneous conversion of the genomic deletion by plating on medium containing 5-FOA and testing isolates for loss of the plasmid. Southern blots were used to confirm clean conversion of the genomic locus. These strains (7720-x) contained the dna2-x mutations in a normal genomic context.
Telomere lengths:
DNA was extracted from saturated cultures as described (![]()
-32P]dCTP and random primers as described (![]()
![]()
| RESULTS |
|---|
A mutation that is synthetically lethal with a deletion of CTF4 maps to DNA2:
A mutation that caused the Pol
-binding protein Ctf4 to be essential for viability was identified and found to segregate as a single locus. A low copy number plasmid containing DNA2 and two other genes was found to complement this lethality (Figure 1). A series of transposon insertions demonstrated that complementation was due to DNA2 (Figure 1). The synthetically lethal mutation was therefore either in DNA2 or was suppressed by a low copy DNA2 plasmid.
|
Mini-Tn3(URA3) transposon disruptions of the DNA2 region (![]()
![]()
To facilitate identification of dna2-2 in subsequent crosses, the adjacent gene SOL3 (![]()
(::LEU2) adjacent to the normal DNA2 gene produced eight double mutants among 36 viable spores, which is close to the expected 25%. This confirms that the synthetic lethality with ctf4 is tightly linked to dna2-2.
The original dna2-1 allele was temperature sensitive (![]()
Additional interactions with ctf4 and dna2-2:
![]()
![]()
(30 tetrads examined for each) but not with any of three POL1 alleles, indicating some specificity of the genetic interaction. To further address the issue of specificity, we constructed double mutants with a variety of conditional temperature-sensitive (ts) cell division cycle (cdc) mutants with defects in different cellular processes (Table 2). Most combinations were viable, and grew as well as the single cdc mutants, as assayed by determining the maximal permissive temperature (MPT) for growth of these strains. However, both ctf4 and dna2-2 affected the growth of some pol1 mutants. For example, the cdc17-1 mutant displayed a decrease in plating efficiency of at least 104-fold at 33° when combined with either ctf4 or dna2-2. The only additional lethal interactions that were noted involved proteins that appear to modulate the DNA polymerase
/
processivity factor proliferating cell nuclear antigen (PCNA). A conditional mutation in one of the subunits of RF-C, which loads PCNA onto DNA molecules (![]()
![]()
![]()
![]()
![]()
|
A screen for additional alleles of DNA2:
Additional alleles of DNA2 were identified using a plasmid shuffling method (![]()
|
|
We integrated a set of the dna2 alleles into the genome so that the alleles could be examined in their normal context. In every case tested, the integrated version displayed a more stringent phenotype than the plasmid-borne version (Table 3). While the vector that was used for the mutagenesis contained a centromere and was presumably a single copy in most cells, the consistent increase in stringency upon integration suggests that the plasmid context leads to higher expression due to increased transcription or higher gene copy number. In two cases, dna2-1 and dna2-8, the integration of the mutations into the genome revealed sensitivity to MMS that was not observed when the mutations were present on plasmids. This suggests that the function of Dna2 is affected by the level of expression of the gene, and that the ability to tolerate DNA damage is especially sensitive to the amount of Dna2 activity. Consistent with a model in which Dna2 concentration affects its function, we found that increased expression of DNA2 from high copy plasmids or strong promoters was detrimental to the growth of cells (not shown).
Synthetic lethality of dna2 mutants with ctf4 is allele specific:
We attempted to construct ctf4 dna2 double mutants with the new alleles using standard genetic crosses to see if the synthetic lethality observed with dna2-1 and dna2-2 is general. Some dna2 alleles were clearly lethal with ctf4, but others produced viable double mutants at the expected frequency (Table 3). To examine large numbers of events, we used a plasmid loss assay to determine the phenotypes of the dna2 ctf4 combinations. We constructed a strain with deletions of both CTF4 and DNA2 that contained a DNA2 plasmid marked with URA3. The dna2-LEU2 mutant plasmids were then transformed into this strain, and transformants were transferred to medium containing 5-FOA to test for growth of the dna2 ctf4 cells. As shown in Figure 3 and Table 3, both the meiotic segregation and mitotic plasmid loss assays revealed similar effects. The wild-type DNA2 plasmid supported rapid growth of the ctf4-
dna2-
strain, as did the dna2 alleles -4, -5, -7, -9, -12, -13, and -15. Alleles dna2-3, -8, -10, and -16 supported growth, but only weakly. Plasmids with alleles dna2-2 (not shown), -6, -11, -14, and -19 failed to support growth, which indicates that these are tight lethals in combination with ctf4. dna2-3, -8, and -16 each gave weak growth in combination with ctf4 in the plasmid assay, but produced no viable double mutants in crosses (dna2-3 is the same as dna2-1; see below). dna2-3 and -8 were also sensitive to MMS only when present as the genomic version, so the acquisition of synthetic lethality upon integration correlates with acquisition of MMS sensitivity and is in keeping with the overall pattern of increased stringency of phenotypes with genomic mutations.
|
The correlation of MMS sensitivity with ctf4 synthetic lethality was found to be general: alleles scored as MMS sensitive were lethal with ctf4, and MMS-resistant (ts only) mutations allowed loss of CTF4 (Table 3 and Figure 4). dna2 mutants that cannot survive chronic exposure to DNA damage are therefore also unable to tolerate mutation of CTF4.
|
In contrast to the allele specificity observed for the lethality of dna2 alleles with ctf4, all dna2 alleles tested were lethal in combination with a rad27 deletion (Table 3). This included alleles that caused temperature sensitivity, MMS sensitivity, or both, and alleles that did or did not tolerate deletion of CTF4. Cells lacking the flap endonuclease Rad27 therefore require optimal performance of all of the functions of Dna2 affected by the alleles tested.
Sequence changes in dna2 alleles:
Nucleotide sequence from the dna2 plasmids was used to determine the mutations in each allele (Figure 4). The entire ORF was sequenced for alleles dna2-1, -2, -11, and -15 to ensure that only the mutations noted were present, but only portions (an average of 43% of the ORF) of the remaining alleles were sequenced, leaving the possibility that additional changes also contributed to their phenotypes. Alleles dna2-1 and -15 were chosen to demonstrate that mutations in the conserved nonhelicase regions were sufficient for causing temperature sensitivity, and alleles dna2-2 and -11 were chosen because they affect invariant residues in the helicase motifs (see below). The wild-type sequence of DNA2 from an A364a strain was also determined because dna2-1 and dna2-2, which were isolated from this strain background, were each found to have 27 mutations relative to the standard sequence derived from an S288C strain. Twenty-six of the mutations were found to be common to both mutant alleles and to the A364a WT. The 26 mutations cause 11 amino acid differences, 9 of which are in the poorly conserved first 400 residues of DNA2 that are not needed for helicase or nuclease activities (![]()
While ts mutations were found throughout the conserved regions of DNA2, seven of the eight MMS-sensitive alleles were clustered in the C-terminal region that contains the helicase motifs (Figure 4). The unique R1253Q mutation in dna2-2 directly altered helicase motif IV. Several versions of this motif are found in the different families that make up helicase superfamily I, but only this arginine residue is invariant among all members of the superfamily (![]()
![]()
![]()
![]()
A previous report concluded that the helicase function of DNA2 was essential because a K1080E mutation in helicase domain I was found to be lethal (![]()
![]()
![]()
|
Chromosome stability in dna2 mutants:
Mutations in CTF4 caused increased rates of chromosome loss and recombination (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Interactions between dna2 mutations and checkpoint functions:
We tested the DNA contents of dna2 mutants by flow cytometry and found that the ts mutants all arrested at restrictive temperatures with 2C DNA contents and >80% large-budded cells, consistent with previous reports (Figure 6, data not shown, and ![]()
![]()
|
While RAD9 was needed for morphological arrest in dna2 mutants, removal of the checkpoint did not diminish the viability of these mutants. This was assessed by testing the MPT, the maximal MMS concentration tolerated, and the remaining viability after a brief shift to 37° with dna2 and dna2 rad9 strains for alleles dna2-1, -4, -12, and -16. The only case in which a rad9 mutation showed a strong effect was with dna2-16, where suppression was observed (Figure 7). Both the MPT and the MMS resistance were enhanced by deletion of RAD9, although the survival after a 4-hr incubation at 37° was ~3% for each strain. The deletion of RAD9 also suppressed the lethality of ctf4 dna2-2 combinations. A diploid heterozygous for dna2-2, ctf4, and rad9 mutations was sporulated and 100 haploid segregants from 38 tetrads were examined. The rad9 mutation was found in 52% of the clones, while dna2-2 and ctf4 were each found in 37%. Four spores were found to have both dna2-2 and ctf4 mutations, and all four also had the rad9 mutation. The triple mutants were thus recovered at less than the expected frequency (4% instead of 12.5%) and grew slowly, but were viable.
|
One explanation for the lack of synthetic effects between dna2 and checkpoint mutations could be that some aspect of the checkpoint function depends on Dna2 and is therefore equally deficient in single dna2 mutants and dna2-checkpoint combinations. For example, if dna2 mutants cause damage that should elicit a response to arrest DNA replication during S phase, but the Dna2 protein is needed to detect or signal this information, the cells could proceed inappropriately through S phase, compiling lethal damage that is sensed by the G2/M machinery but can no longer be repaired. We therefore tested the response of dna2 mutants to circumstances that activate G1/S and S phase checkpoints in normal cells to see if these responses were intact. Each of the dna2 mutants was found to arrest normally in G1 when treated with 0.02% MMS (not shown). Further, a dna2-2 strain was found to exhibit the normal slowing of the progression of S phase in response to MMS treatment (![]()
dna2 mutations alter telomere replication:
Mutations in POL1 and some other replication proteins cause telomeres to become unusually long (![]()
![]()
![]()
![]()
![]()
![]()
|
| DISCUSSION |
|---|
Deletion of the Pol1-binding protein Ctf4 impairs DNA metabolism but leaves cells viable. We isolated mutations that make Ctf4 essential and found that one such mutation was in DNA2. Our results connect Dna2 to a role in a DNA Polymerase
-dependent process, consistent with previous reports that proposed a role in lagging strand DNA synthesis (![]()
![]()
Genetic interactions link Dna2 to Pol
and other lagging strand synthesis factors:
Ctf4 and Pol
interact physically and genetically, and the properties of ctf4 mutants suggest that this binding is biologically relevant (![]()
![]()
. Consistent with this, dna2-2 displayed an allele-specific synthetic defect with a pol1 mutation. In addition to the effect with pol1, ctf4 and dna2 mutations had strong effects when combined with rad27, rfc1, chl12, spt16, and cdc16 mutations. The Pol
/primase holoenzyme is thought to provide the primers that initiate each Okazaki fragment during lagging strand synthesis (![]()
![]()
![]()
![]()
![]()
![]()
![]()
and
, and also binds to a large number of replication, repair, and cell cycle progression factors, including Rad27 (![]()
![]()
![]()
![]()
(![]()
![]()
Full activity of the Dna2 helicase function is needed only for repair and tolerating loss of Ctf4:
DNA2 is a member of the Sen1-like family of helicases, sharing extensive similarity with this group throughout the helicase domain (![]()
![]()
![]()
To our surprise, some of the dna2 mutations we isolated were in residues expected to eliminate helicase activity, but these alleles had no obvious effects on growth, which suggests that full Dna2 helicase activity is not essential. Two of these alleles, dna2-2 and dna2-11, were alterations of invariant residues in helicase motifs IV and V. Mutations introduced into these same residues in E. coli UvrD and herpes virus UL5 proteins caused a reduction in ATPase and complete loss of helicase activity in vitro, and obliterated their functions in vivo (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
The MMS-sensitive alleles of DNA2 clustered in the helicase domain and the site-directed motif I and II mutations were MMS sensitive. All of the MMS-sensitive alleles were also synthetically lethal with ctf4, while mutations that tolerated MMS normally also survived the loss of CTF4. The dna2-1 allele was MMS sensitive, mapped outside the helicase domain, and was lethal with ctf4, while dna2-13 was MMS resistant, mapped inside the helicase domain, and tolerated deletion of ctf4. This demonstrates that the correlation of synthetic lethality with ctf4 is clearly with MMS sensitivity and not with map position within the helicase domain. The helicase function is therefore needed for some forms of DNA damage repair and for tolerating loss of Ctf4.
The correlation of MMS sensitivity and synthetic lethality with ctf4 could indicate that Ctf4 and Dna2 act cooperatively to repair the damage caused by MMS, or that the same functions of Dna2 needed for tolerating alkylation damage are also needed for tolerating damage caused by Ctf4 deficiency. In the first case, Ctf4 might act to assemble or stabilize complexes containing Dna2 that then act during repair of alkylation damage. ctf4 and dna2 mutants would be individually sensitive to MMS because of an inability to form these complexes and effect repair efficiently. Combinations would be lethal due to a further reduction in repair capability or the inability to form similar complexes needed for a more essential function such as lagging strand synthesis. In the second model, certain types of DNA damage require the efficient function of the Dna2 helicase activity for repair, and these types of damage are found in cells treated with MMS and in cells lacking Ctf4. We favor the first model for two reasons. First, the synthetic lethality of dna2 ctf4 combinations is suppressed by loss of the RAD9 checkpoint. If the ctf4 mutation caused lethal damage to accumulate that had to be repaired by Dna2, removal of a checkpoint would not be expected to rescue the cells because they would still contain lethal amounts of damage. Second, our preliminary data show that Dna2 is found in whole cell extracts in a complex that elutes from a size-exclusion matrix at ~700 kD, but this complex is lost and the Dna2 is partially degraded in cells lacking Ctf4 (T. NITTIS, unpublished observations). We therefore propose that Ctf4 acts as a scaffold to assemble or stabilize complexes that can include Pol
and Dna2 as components. Loss of Ctf4 allows these complexes to form only inefficiently, requiring optimal performance of each of the remaining members of the complexes. Different complexes utilizing Ctf4 might act in lagging strand synthesis, Okazaki fragment maturation, and DNA damage repair. Alternatively, a single complex might act in all of these processes but use only some components for each task. This model could explain the existence of damage-sensitive alleles of POL1 (![]()
![]()
![]()
While dna2 mutants produce a signal that engages the Rad9 checkpoint, the ensuing delays are either neutral or detrimental to the viability of the cells. One interpretation of this surprising result is that dna2 mutants might accumulate damage that cannot be repaired. The damage is sensed by checkpoint mechanisms, but the delay that this triggers is ineffective in promoting repair. In some cases, the damage is irreparable but not lethal, so the persistent arrest signals only serve to inhibit growth. Mutated Dna2 proteins could retain the ability to bind to other proteins and to helicase substrates, as noted for the herpes virus UL5 mutants (![]()
| ACKNOWLEDGMENTS |
|---|
We thank E. Mortensen and D. Bronson for technical assistance, V. Lundblad for advice on the telomere assay, S. Forsburg and J. Campbell for providing Dna2 homolog sequences, and J. Wittmeyer, D. Carroll, and D. Stillman for comments on the manuscript. Support for this work was provided by the National Institutes of Health and by the Lucille Markey Foundation.
Manuscript received October 7, 1998; Accepted for publication January 18, 1999.
| LITERATURE CITED |
|---|
ADAMS, A. K. and C. HOLM, 1996 Specific DNA replication mutations affect telomere length in Saccharomyces cerevisiae.. Mol. Cell. Biol. 16:4614-4620[Abstract].
AGUILERA, A. and H. L. KLEIN, 1988 Genetic control of intrachromosomal recombination in Saccharomyces cerevisiae. I. Isolation and genetic characterization of hyper-recombination mutations. Genetics 119:779-790
ALTSCHUL, S. F., T. L. MADDEN, A. A. SCHAFFER, J. ZHANG, and Z. ZHANG et al., 1997 Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402
AUSUBEL, F. M., R. BRENT, R. E. KINGSTON, D. D. MOORE, J. G. SEIDMAN, J. A. SMITH and K. STRUHL (Editors), 1994 Current Protocols in Molecular Biology. Greene Publishing Associates, Inc., and John Wiley & Sons, Inc., Boston.
BAE, S. H., E. CHOI, K. H. LEE, J. S. PARK, and S. H. LEE et al., 1998 Dna2 of Saccharomyces cerevisiae possesses a single-stranded DNA-specific endonuclease activity that is able to act on double-stranded DNA in the presence of ATP. J. Biol. Chem. 273:26880-26890
BENDER, A. and J. R. PRINGLE, 1991 Use of a screen for synthetic lethal and multicopy suppressor mutants to identify two new genes involved in morphogenesis in Saccharomyces cerevisiae.. Mol. Cell. Biol. 11:1295-1305
BOEKE, J. D., J. TRUEHEART, G. NATSOULIS, and G. R. FINK, 1987 5-fluoroorotic acid as a selective agent in yeast molecular genetics. Methods Enzymol. 154:164-175[Medline].
BRAGUGLIA, D., P. HEUN, P. PASERO, B. P. DUNCKER, and S. M. GASSER, 1998 Semi-conservative replication in yeast nuclear extracts requires Dna2 helicase and supercoiled template. J. Mol. Biol. 281:631-649[Medline].
BUDD, M. E. and J. L. CAMPBELL, 1995a DNA polymerases required for repair of UV-induced damage in Saccharomyces cerevisiae.. Mol. Cell. Biol. 15:2173-2179[Abstract].
BUDD, M. E. and J. L. CAMPBELL, 1995b A yeast gene required for DNA replication encodes a protein with homology to DNA helicases. Proc. Natl. Acad. Sci. USA 92:7642-7646
BUDD, M. E. and J. L. CAMPBELL, 1997 A yeast replicative helicase, Dna2 helicase, interacts with yeast FEN-1 nuclease in carrying out its essential function. Mol. Cell. Biol. 17:2136-2142[Abstract].
BUDD, M. E., W.-C. CHOE, and J. L. CAMPBELL, 1995 DNA2 encodes a DNA helicase essential for replication of eukaryotic chromosomes. J. Biol. Chem. 270:26766-26769
CAMPBELL, J. L., and C. S. NEWLON, 1991 Chromosomal DNA replication, pp. 41146 in The Molecular and Cellular Biology of the Yeast Saccharomyces, edited by J. R. BROACH, J. R. PRINGLE and E. W. JONES. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
CARSON, M. J. and L. HARTWELL, 1985 CDC17: an essential gene that prevents telomere elongation in yeast. Cell 42:249-257[Medline].
CHRISTIANSON, T. W., R. S. SIKORSKI, M. DANTE, J. H. SHERO, and P. HIETER, 1992 Multifunctional yeast high-copy-number shuttle vectors. Gene 110:119-122[Medline].
CULLMANN, G., K. FIEN, R. KOBAYASHI, and B. STILLMAN, 1995 Characterization of the five replication factor C genes of Saccharomyces cerevisiae.. Mol. Cell. Biol. 15:4661-4671[Abstract].
EISSENBERG, J. C., R. AYYAGARI, X. V. GOMES, and P. M. J. BURGERS, 1997 Mutations in yeast proliferating cell nuclear antigen define distinct sites for interaction with DNA polymerase
and DNA polymerase
. Mol. Cell. Biol. 17:6367-6378[Abstract].
FIORENTINO, D. F. and G. R. CRABTREE, 1997 Characterization of Saccharomyces cerevisiae dna2 mutants suggests a role for the helicase late in S phase. Mol. Biol. Cell. 8:2519-2537
GIETZ, R. D. and A. SUGINO, 1988 New yeast-Escherichia coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking six-base pair restriction sites. Gene 74:527-534[Medline].
GORBALENYA, A. E. and E. V. KOONIN, 1993 Helicases: amino acid sequence comparisons and structure-function relationships. Curr. Opin. Struct. Biol. 3:419-429.
GRAVES-WOODWARD, K. L., J. GOTTLIEB, M. D. CHALLBERG, and S. K. WELLER, 1997 Biochemical analyses of mutations in the HSV-1 helicase-primase that alter ATP hydrolysis, DNA unwinding, and coupling between hydrolysis and unwinding. J. Biol. Chem. 272:4623-4630
HALL, M. C. and S. W. MATSON, 1997 Mutation of a highly conserved arginine in motif IV of Escherichia coli DNA helicase II results in an ATP-binding defect. J. Biol. Chem. 272:18614-18620
HARRIS, S. D. and J. E. HAMER, 1995 sepB: an Aspergillus nidulans gene involved in chromosome segregation and the initiation of cytokinesis. EMBO J. 14:5244-5257[Medline].
HARRIS, S. D. and P. R. KRAUS, 1998 Regulation of septum formation in Aspergillus nidulans by a DNA damage checkpoint pathway. Genetics 148:1055-1067
HARRIS, S. D., J. L. MORRELL, and J. E. HAMER, 1994 Identification and characterization of Aspergillus nidulans mutants defective in cytokinesis. Genetics 136:517-532[Abstract].
HARTWELL, L. H., 1967 Macromolecule synthesis in temperature-sensitive mutants of yeast. J. Bacteriol. 93:1662-1670
HARTWELL, L. H. and D. SMITH, 1985 Altered fidelity of mitotic chromosome transmission in cell cycle mutants of S. cerevisiae.. Genetics 110:381-395
HEICHMAN, K. A. and J. M. ROBERTS, 1998 CDC16 controls initiation at chromosome replication origins. Mol. Cell 1:457-463[Medline].
HOEKSTRA, M. F., H. S. SEIFERT, J. NICKOLOFF, and F. HEFFRON, 1991 Shuttle mutagenesis: bacterial transposons for genetic manipulations in yeast. Methods Enzymol. 194:329-342[Medline].
IIRI, T., Z. FARFEL, and H. R. BOURNE, 1998 G-protein diseases furnish a model for the turn-on switch. Nature 394:35-38[Medline].
KOHLER, A., M. S. SCHMIDT-ZACHMANN, and W. W. FRANKE, 1997 AND-1, a natural chimeric DNA-binding protein, combines an HMG-box with regulatory WD-repeats. J. Cell Sci. 110:1051-1062[Abstract].
KORNBERG, A., and T. BAKER, 1992 DNA Replication. W. H. Freeman and Co., New York.
KOUPRINA, N., E. KROLL, V. BANNIKOV, V. BLISKOVSKY, and R. GIZATULLIN et al., 1992 CTF4 (CHL15) mutants exhibit defective DNA metabolism in the yeast Saccharomyces cerevisiae.. Mol. Cell. Biol. 12:5736-5747
KOUPRINA, N., E. KROLL, A. KIRILLOV, V. BANNIKOV, and V. ZAKHARYEV et al., 1994 CHL12, a gene essential for the fidelity of chromosome transmission in the yeast Saccharomyces cerevisiae.. Genetics 138:1067-1079[Abstract].
LOOR, G., S. J. ZHANG, P. ZHANG, N. L. TOOMEY, and M. Y. LEE, 1997 Identification of DNA replication and cell cycle proteins that interact with PCNA. Nucleic Acids Res. 25:5041-5046
MCALEAR, M. A., K. M. TUFFO, and C. HOLM, 1996 The large subunit of replication factor C (Rfc1p/cdc44p) is required for DNA replication and DNA repair in Saccharomyces cerevisiae.. Genetics 142:65-78[Abstract].
MILES, J. and T. FORMOSA, 1992a Evidence that POB1, a Saccharomyces cerevisiae protein that binds to DNA polymerase a, acts in DNA metabolism in vivo.. Mol. Cell. Biol. 12:5724-5735
MILES, J. and T. FORMOSA, 1992b Protein affinity chromatography with purified yeast DNA polymerase
detects proteins that bind to DNA polymerase. Proc. Natl. Acad. Sci. USA 89:1276-1280
MORGAN, B. A., F. L. CONLON, M. MANZANARES, J. B. MILLAR, and N. KANUGA et al., 1996 Transposon tools for recombinant DNA manipulation: characterization of transcriptional regulators from yeast, Xenopus, and mouse. Proc. Natl. Acad. Sci. USA 93:2801-2806
PAULOVICH, A. G. and L. H. HARTWELL, 1995 A checkpoint regulates the rate of progression through S phase in S. cerevisiae in response to DNA damage. Cell 82:841-847[Medline].
REAGAN, M. S., C. PITTENGER, W. SIEDE, and E. C. FRIEDBERG, 1995 Characterization of a mutant strain of Saccharomyces cerevisiae with a deletion of the RAD27 gene, a structural homolog of the RAD2 nucleotide excision repair gene. J. Bacteriol. 177:364-371
ROSE, M. D., F. WINSTON and P. HIETER, 1990 Methods in Yeast Genetics, A Laboratory Course Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
SHAMPAY, J., J. W. SZOSTAK, and E. H. BLACKBURN, 1984 DNA sequences of telomeres maintained in yeast. Nature 310:154-157[Medline].
SHEN, W. C., D. R. STANFORD, and A. K. HOPPER, 1996 Los1p, involved in yeast pre-tRNA splicing, positively regulates members of the SOL gene family. Genetics 143:699-712[Abstract].
SHERO, J. H., M. KOVAL, F. SPENCER, R. E. PALMER, and P. HIETER et al., 1991 Analysis of chromosome segregation in Saccharomyces cerevisiae.. Methods Enzymol. 194:749-773[Medline].
SHUSTER, J. R., 1982 "Start" mutants of Saccharomyces cerevisiae are suppressed in carbon catabolite-derepressing medium. J. Bacteriol. 151:1059-1061
SIKORSKI, R. S. and M. D. BOEKE, 1991 In vitro mutagenesis and plasmid shuffling: from cloned gene to mutant yeast. Methods Enzymol. 194:302-318[Medline].
SINGER, J. D., B. M. MANNING, and T. FORMOSA, 1996 Coordinating DNA replication to produce one copy of the genome requires genes that act in ubiquitin metabolism. Mol. Cell. Biol. 16:1356-1366[Abstract].
SOMMERS, C. H., E. J. MILLER, B. DUJON, S. PRAKASH, and L. PRAKASH, 1995 Conditional lethality of null mutations in RTH1 that encodes the yeast counterpart of a mammalian 5'- to 3'-exonuclease required for lagging strand DNA synthesis in reconstituted systems. J. Biol. Chem. 270:4193-4196
SPENCER, F., S. L. GERRING, C. CONNELLY, and P. HIETER, 1990 Mitotic chromosome transmission fidelity mutants in Saccharomyces cerevisiae.. Genetics 124:237-249[Abstract].
STILLMAN, B., 1994 Smart machines at the DNA replication fork. Cell 78:725-728[Medline].
WALMSLEY, R. W., C. S. M. CHAN, B.-K. TYE, and T. D. PETES, 1984 Unusual DNA sequences associated with the ends of yeast chromosomes. Nature 310:157-160[Medline].
WITTMEYER, J. and T. FORMOSA, 1997 The Saccharomyces cerevisiae DNA polymerase
catalytic subunit interacts with Cdc68/Spt16 and with Pob3, a protein similar to an HMG1-like protein. Mol. Cell. Biol. 17:4178-4190[Abstract].
This article has been cited by other articles:
![]() |
S. Raynard, H. Niu, and P. Sung DNA double-strand break processing: the beginning of the end Genes & Dev., November 1, 2008; 22(21): 2903 - 2907. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Zhu, C. Ukomadu, S. Jha, T. Senga, S. K. Dhar, J. A. Wohlschlegel, L. K. Nutt, S. Kornbluth, and A. Dutta Mcm10 and And-1/CTF4 recruit DNA polymerase {alpha} to chromatin for initiation of DNA replication Genes & Dev., September 15, 2007; 21(18): 2288 - 2299. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Masuda-Sasa, P. Polaczek, and J. L. Campbell Single Strand Annealing and ATP-independent Strand Exchange Activities of Yeast and Human DNA2: POSSIBLE ROLE IN OKAZAKI FRAGMENT MATURATION J. Biol. Chem., December 15, 2006; 281(50): 38555 - 38564. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Budd, C. C. Reis, S. Smith, K. Myung, and J. L. Campbell Evidence Suggesting that Pif1 Helicase Functions in DNA Replication with the Dna2 Helicase/Nuclease and DNA Polymerase {delta}. Mol. Cell. Biol., April 1, 2006; 26(7): 2490 - 2500. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Ji, M. H. Platts, L. M. Dharamsi, and K. L. Friedman Regulation of Telomere Length by an N-Terminal Region of the Yeast Telomerase Reverse Transcriptase Mol. Cell. Biol., October 15, 2005; 25(20): 9103 - 9114. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. O. Bylund and P. M. J. Burgers Replication Protein A-Directed Unloading of PCNA by the Ctf18 Cohesion Establishment Complex Mol. Cell. Biol., July 1, 2005; 25(13): 5445 - 5455. [Abstract] [Full Text] [PDF] |
||||
![]() |
D.-H. Kim, K.-H. Lee, J.-H. Kim, G.-H. Ryu, S.-H. Bae, B.-C. Lee, K.-Y. Moon, S.-M. Byun, H.-S. Koo, and Y.-S. Seo Enzymatic properties of the Caenorhabditis elegans Dna2 endonuclease/helicase and a species-specific interaction between RPA and Dna2 Nucleic Acids Res., March 3, 2005; 33(4): 1372 - 1383. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. E. Gygax, C. P. Semighini, G. H. Goldman, and S. D. Harris SepBCTF4 Is Required for the Formation of DNA-Damage-Induced UvsCRAD51 Foci in Aspergillus nidulans Genetics, March 1, 2005; 169(3): 1391 - 1402. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. V. Mitkova, E. E. Biswas-Fiss, and S. B. Biswas Modulation of DNA Synthesis in Saccharomyces cerevisiae Nuclear Extract by DNA Polymerases and the Origin Recognition Complex J. Biol. Chem., February 25, 2005; 280(8): 6285 - 6292. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. R. Williams and J. R. McIntosh Mcl1p Is a Polymerase {alpha} Replication Accessory Factor Important for S-Phase DNA Damage Survival Eukaryot. Cell, January 1, 2005; 4(1): 166 - 177. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. M. O'Neill, D. Hanway, E. A. Winzeler, and F. E. Romesberg Coordinated functions of WSS1, PSY2 and TOF1 in the DNA damage response Nucleic Acids Res., December 14, 2004; 32(22): 6519 - 6530. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-I Kao, J. L. Campbell, and R. A. Bambara Dna2p Helicase/Nuclease Is a Tracking Protein, Like FEN1, for Flap Cleavage during Okazaki Fragment Maturation J. Biol. Chem., December 3, 2004; 279(49): 50840 - 50849. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Tomita, T. Kibe, H.-Y. Kang, Y.-S. Seo, M. Uritani, T. Ushimaru, and M. Ueno Fission Yeast Dna2 Is Required for Generation of the Telomeric Single-Strand Overhang Mol. Cell. Biol., November 1, 2004; 24(21): 9557 - 9567. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Zhou and T. S.-F. Wang A Coordinated Temporal Interplay of Nucleosome Reorganization Factor, Sister Chromatin Cohesion Factor, and DNA Polymerase {alpha} Facilitates DNA Replication Mol. Cell. Biol., November 1, 2004; 24(21): 9568 - 9579. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Sharma, J. A. Sommers, and R. M. Brosh Jr In vivo function of the conserved non-catalytic domain of Werner syndrome helicase in DNA replication Hum. Mol. Genet., October 1, 2004; 13(19): 2247 - 2261. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Fien, Y.-S. Cho, J.-K. Lee, S. Raychaudhuri, I. Tappin, and J. Hurwitz Primer Utilization by DNA Polymerase {alpha}-Primase Is Influenced by Its Interaction with Mcm10p J. Biol. Chem., April 16, 2004; 279(16): 16144 - 16153. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-I Kao, J. Veeraraghavan, P. Polaczek, J. L. Campbell, and R. A. Bambara On the Roles of Saccharomyces cerevisiae Dna2p and Flap Endonuclease 1 in Okazaki Fragment Processing J. Biol. Chem., April 9, 2004; 279(15): 15014 - 15024. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. D. Warren, D. M. Eckley, M. S. Lee, J. S. Hanna, A. Hughes, B. Peyser, C. Jie, R. Irizarry, and F. A. Spencer S-Phase Checkpoint Genes Safeguard High-Fidelity Sister Chromatid Cohesion Mol. Biol. Cell, April 1, 2004; 15(4): 1724 - 1735. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Mayer, I. Pot, M. Chang, H. Xu, V. Aneliunas, T. Kwok, R. Newitt, R. Aebersold, C. Boone, G. W. Brown, et al. Identification of Protein Complexes Required for Efficient Sister Chromatid Cohesion Mol. Biol. Cell, April 1, 2004; 15(4): 1736 - 1745. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. P. Bermudez, Y. Maniwa, I. Tappin, K. Ozato, K. Yokomori, and J. Hurwitz The alternative Ctf18-Dcc1-Ctf8-replication factor C complex required for sister chromatid cohesion loads proliferating cell nuclear antigen onto DNA PNAS, September 2, 2003; 100(18): 10237 - 10242. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Ben-Aroya, A. Koren, B. Liefshitz, R. Steinlauf, and M. Kupiec ELG1, a yeast gene required for genome stability, forms a complex related to replication factor C PNAS, August 19, 2003; 100(17): 9906 - 9911. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-H. Bae, H.-S. Kim, S.-H. Bae, H.-Y. Kang, S. Brill, and Y.-S. Seo Bimodal interaction between replication-protein A and Dna2 is critical for Dna2 function both in vivo and in vitro Nucleic Acids Res., June 15, 2003; 31(12): 3006 - 3015. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Weitao, M. Budd, L. L. M. Hoopes, and J. L. Campbell Dna2 Helicase/Nuclease Causes Replicative Fork Stalling and Double-strand Breaks in the Ribosomal DNA of Saccharomyces cerevisiae J. Biol. Chem., June 13, 2003; 278(25): 22513 - 22522. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Ayyagari, X. V. Gomes, D. A. Gordenin, and P. M. J. Burgers Okazaki Fragment Maturation in Yeast. I. DISTRIBUTION OF FUNCTIONS BETWEEN FEN1 AND DNA2 J. Biol. Chem., January 10, 2003; 278(3): 1618 - 1625. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. H. Jin, R. Ayyagari, M. A. Resnick, D. A. Gordenin, and P. M. J. Burgers Okazaki Fragment Maturation in Yeast. II. COOPERATION BETWEEN THE POLYMERASE AND 3'-5'-EXONUCLEASE ACTIVITIES OF POL delta IN THE CREATION OF A LIGATABLE NICK J. Biol. Chem., January 10, 2003; 278(3): 1626 - 1633. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Formosa, S. Ruone, M. D. Adams, A. E. Olsen, P. Eriksson, Y. Yu, A. R. Rhoades, P. D. Kaufman, and D. J. Stillman Defects in SPT16 or POB3 (yFACT) in Saccharomyces cerevisiae Cause Dependence on the Hir/Hpc Pathway: Polymerase Passage May Degrade Chromatin Structure Genetics, December 1, 2002; 162(4): 1557 - 1571. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Parenteau and R. J. Wellinger Differential Processing of Leading- and Lagging-Strand Ends at Saccharomyces cerevisiae Telomeres Revealed by the Absence of Rad27p Nuclease Genetics, December 1, 2002; 162(4): 1583 - 1594. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. R. Williams and J. R. McIntosh mcl1+, the Schizosaccharomyces pombe Homologue of CTF4, Is Important for Chromosome Replication, Cohesion, and Segregation Eukaryot. Cell, October 1, 2002; 1(5): 758 - 773. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-H. Bae, D. W. Kim, J. Kim, J.-H. Kim, D.-H. Kim, H.-D. Kim, H.-Y. Kang, and Y.-S. Seo Coupling of DNA Helicase and Endonuclease Activities of Yeast Dna2 Facilitates Okazaki Fragment Processing J. Biol. Chem., July 12, 2002; 277(29): 26632 - 26641. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. L. M. Hoopes, M. Budd, W. Choe, T. Weitao, and J. L. Campbell Mutations in DNA Replication Genes Reduce Yeast Life Span Mol. Cell. Biol., June 15, 2002; 22(12): 4136 - 4146. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Choe, M. Budd, O. Imamura, L. Hoopes, and J. L. Campbell Dynamic Localization of an Okazaki Fragment Processing Protein Suggests a Novel Role in Telomere Replication Mol. Cell. Biol., June 15, 2002; 22(12): 4202 - 4217. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. S. Ivessa, J.-Q. Zhou, V. P. Schulz, E. K. Monson, and V. A. Zakian Saccharomyces Rrm3p, a 5' to 3' DNA helicase that promotes replication fork progression through telomeric and subtelomeric DNA Genes & Dev., June 1, 2002; 16(11): 1383 - 1396. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-Q. Zhou, H. Qi, V. P. Schulz, M. K. Mateyak, E. K. Monson, and V. A. Zakian Schizosaccharomyces pombe pfh1+ Encodes an Essential 5' to 3' DNA Helicase That Is a Member of the PIF1 Subfamily of DNA Helicases Mol. Biol. Cell, June 1, 2002; 13(6): 2180 - 2191. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-I Kao, L. A. Henricksen, Y. Liu, and R. A. Bambara Cleavage Specificity of Saccharomyces cerevisiae Flap Endonuclease 1 Suggests a Double-Flap Structure as the Cellular Substrate J. Biol. Chem., April 19, 2002; 277(17): 14379 - 14389. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-H. Bae, J.-A. Kim, E. Choi, K.-H. Lee, H.-Y. Kang, H.-D. Kim, J.-H. Kim, K.-H. Bae, Y. Cho, C. Park, et al. Tripartite structure of Saccharomyces cerevisiae Dna2 helicase/endonuclease Nucleic Acids Res., July 15, 2001; 29(14): 3069 - 3079. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Hanna, E. S. Kroll, V. Lundblad, and F. A. Spencer Saccharomyces cerevisiae CTF18 and CTF4 Are Required for Sister Chromatid Cohesion Mol. Cell. Biol., May 1, 2001; 21(9): 3144 - 3158. [Abstract] [Full Text] |
||||
![]() |
R. V. Skibbens Holding Your Own: Establishing Sister Chromatid Cohesion Genome Res., November 1, 2000; 10(11): 1664 - 1671. [Full Text] |
||||
![]() |
K.-H. Lee, D. W. Kim, S.-H. Bae, J.-A. Kim, G.-H. Ryu, Y.-N. Kwon, K.-A. Kim, H.-S. Koo, and Y.-S. Seo The endonuclease activity of the yeast Dna2 enzyme is essential in vivo Nucleic Acids Res., August 1, 2000; 28(15): 2873 - 2881. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. B. Schlesinger and T. Formosa POB3 Is Required for Both Transcription and Replication in the Yeast Saccharomyces cerevisiae Genetics, August 1, 2000; 155(4): 1593 - 1606. [Abstract] [Full Text] |
||||
![]() |
M. J. Ireland, S. S. Reinke, and D. M. Livingston The Impact of Lagging Strand Replication Mutations on the Stability of CAG Repeat Tracts in Yeast Genetics, August 1, 2000; 155(4): 1657 - 1665. [Abstract] [Full Text] |
||||
![]() |
H.-Y. Kang, E. Choi, S.-H. Bae, K.-H. Lee, B.-S. Gim, H.-D. Kim, C. Park, S. A. MacNeill, and Y.-S. Seo Genetic Analyses of Schizosaccharomyces pombe dna2+ Reveal That Dna2 Plays an Essential Role in Okazaki Fragment Metabolism Genetics, July 1, 2000; 155(3): 1055 - 1067. [Abstract] [Full Text] |
||||
![]() |
Q. Liu, W.-c. Choe, and J. L. Campbell Identification of the Xenopus laevis Homolog of Saccharomyces cerevisiae DNA2 and Its Role in DNA Replication J. Biol. Chem., January 21, 2000; 275(3): 1615 - 1624. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.L. DUBOIS, S.J. DIEDE, A.E. STELLWAGEN, and D.E. GOTTSCHLING All Things Must End: Telomere Dynamics in Yeast Cold Spring Harb Symp Quant Biol, January 1, 2000; 65(0): 281 - 296. [Abstract] [PDF] |
||||
![]() |
S.-H. Bae and Y.-S. Seo Characterization of the Enzymatic Properties of the Yeast Dna2 Helicase/Endonuclease Suggests a New Model for Okazaki Fragment Processing J. Biol. Chem., November 22, 2000; 275(48): 38022 - 38031. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Budd, W.-c. Choe, and J. L. Campbell The Nuclease Activity of the Yeast Dna2 Protein, Which Is Related to the RecB-like Nucleases, Is Essential in Vivo J. Biol. Chem., May 26, 2000; 275(22): 16518 - 16529. [Abstract] [Full Text] [PDF] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Formosa, T.
- Articles by Nittis, T.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Formosa, T.
- Articles by Nittis, T.
















