- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Tharun, S.
- Articles by Parker, R.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Tharun, S.
- Articles by Parker, R.
Analysis of Mutations in the Yeast mRNA Decapping Enzyme
Sundaresan Tharuna and Roy Parkeraa Departments of Molecular and Cellular Biology and Biochemistry and the Howard Hughes Medical Institute, University of Arizona, Tucson, Arizona 85721-0106
Corresponding author: Roy Parker, Departments of Molecular and Cellular Biology and Biochemistry and the Howard Hughes Medical Institute, Life Sciences South Building, East Lowell St., P.O. Box 210 106, University of Arizona, Tucson, AZ 85721-0106., rrparker{at}u.arizona.edu (E-mail)
Communicating editor: F. WINSTON
| ABSTRACT |
|---|
A major mechanism of mRNA decay in yeast is initiated by deadenylation, followed by mRNA decapping, which exposes the transcript to 5' to 3' exonucleolytic degradation. The decapping enzyme that removes the 5' cap structure is encoded by the DCP1 gene. To understand the function of the decapping enzyme, we used alanine scanning mutagenesis to create 31 mutant versions of the enzyme, and we examined the effects of the mutations both in vivo and in vitro. Two types of mutations that affected mRNA decapping in vivo were identified, including a temperature-sensitive allele. First, two mutants produced decapping enzymes that were defective for decapping in vitro, suggesting that these mutated residues are required for enzymatic activity. In contrast, several mutants that moderately affected mRNA decapping in vivo yielded decapping enzymes that had at least the same specific activity as the wild-type enzyme in vitro. Combination of alleles within this group yielded decapping enzymes that showed a strong loss of function in vivo, but that still produced fully active enzymes in vitro. This suggested that interactions of the decapping enzyme with other factors may be required for efficient decapping in vivo, and that these particular mutations may be disrupting such interactions. Interestingly, partial loss of decapping activity in vivo led to a defect in normal deadenylation-dependent decapping, but it did not affect the rapid deadenylation-independent decapping triggered by early nonsense codons. This observation suggested that these two types of mRNA decapping differ in their requirements for the decapping enzyme.
THE turnover of mRNA is an important control point in the regulation of gene expression. Though mRNA decay mechanisms vary with organisms and the nature of the mRNA, several commonalities do exist among the various eukaryotes (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Decapping is a key step in the turnover of yeast mRNAs, because variation in decapping rates accounts for part of the differences in decay rates of specific mRNAs in yeast (![]()
![]()
![]()
Earlier studies have identified the yeast DCP1 gene as encoding a decapping enzyme that is required for mRNA decay in vivo and sufficient for decapping activity in vitro (![]()
![]()
![]()
![]()
In the present work, we used alanine-scanning mutagenesis to create 31 different mutant versions of the decapping enzyme, and we examined the effects of the mutations both in vivo and in vitro. Two types of mutations that affected mRNA decapping were identified. One set of mutations resulted in strong loss of function both in vivo and in vitro, indicating that they affected specific amino acid residues important for enzymatic function. The second set of mutations resulted in moderate, or in some allelic combinations, strong loss of function in vivo, but they failed to cause any loss of activity of the protein in vitro. This suggests that the amino acid residues that were changed in these mutants may be required for some functionally important in vivo interactions of Dcp1p with other proteins that were not present in the purified in vitro system. Our studies also revealed that mutants with partial loss of function in vivo were not defective for the rapid deadenylation-independent decapping triggered by early nonsense codons, and that they were defective only for the normal deadenylation-dependent decapping in vivo, suggesting a difference between these two processes with regard to their requirement for the decapping enzyme.
| MATERIALS AND METHODS |
|---|
Oligonucleotide-directed mutagenesis:
All mutants of DCP1, except dcp1-41 to -44, were generated by this procedure. For performing site-directed mutagenesis, the DCP1 gene was cloned into the yeast shuttle vector pUN45 (![]()
![]()
1.7-kb fragment by digesting p424DCP1 with enzymes ApaI and NotI, and it was then inserted into the pUN45 vector digested with the same two enzymes. This resulted in the plasmid pRP783, which was used for making all the mutants. The single-stranded form of this plasmid was made after transforming it into Escherichia coli XL1 Blue cells and infecting them with M13K07 helper phage. Site-directed mutagenesis was then performed following standard methods by annealing mutagenic oligonucleotide to the single-stranded form of pRP783, extending it with Klenow to complete the second strand, and closing the second strand with ligase. After this, a portion of the mutagenesis reaction mixture was transformed into E. coli TB1 cells, and plasmid minipreps made from several transformants were screened by restriction analysis (using pRP783 as control) to find those bearing the mutated DCP1 gene. This yielded plasmids pRP872pRP898, which bore the various primary mutant forms of DCP1 (Table 1). These plasmids were then transformed into dcp1
strain yRP1071 (![]()
|
Mutants dcp1-41 to -44 were made by combining mutations of allele dcp1-17 or dcp1-4 with mutations of dcp1-19 or dcp1-25. The mutations of dcp1-17 and dcp1-4 occur close to the N terminus of Dcp1p, while the dcp1-19 and dcp1-25 mutations affect sites closer to the C terminus of the Dcp1p sequence. Therefore, the combinations were made by exchanging the region coding for the N-terminal portion of Dcp1p in vectors pRP886 and pRP889 with those derived from pRP885 and pRP874 by restriction digestion and ligation.
RNA preparation and analysis:
For steady-state RNA analysis, cells were grown to midlog phase in SCTrp minimal medium containing sucrose and galactose as carbon sources. For mRNA half-life determination by transcriptional repression, cells were grown as described above to midlog and then shifted to SCTrp minimal medium with glucose as a carbon source. RNA preparation and analysis were done as described previously (![]()
3' end fragments of MFA2pG and PGK1pG mRNAs were determined by probing Northern blots with 5'-32P end-labeled oligonucleotides [capable of hybridizing to both full-length species and poly(G)
3' end fragments] specific for the respective mRNAs (![]()
![]()
Construction of the FLAG-Dcp1p overexpression vector:
The FLAG-fused chimeras of mutant DCP1 genes were created by PCR amplification of the mutant DCP1 sequences from their corresponding CEN vector clones (pRP872pRP898, see above and Table 1) using the oligonucleotide GCAGCACCGGATCCATGGACTACAAGGACGACGATGACAAGATGACCGGAGCAGCAAC (oRP311), which places the FLAG-coding sequence 5' of the DCP1 gene, as well as the oligonucleotide GCAGCACCGTCGACTTCTCACTTGGGCATCTC (oRP312). This PCR fragment was digested with BamHI and SalI, and it was ligated into the yeast expression vector pG-1 (![]()
Purification of FLAG-Dcp1p:
Wild-type and mutant FLAG-Dcp1p proteins were purified from dcp1
cells (yRP1071) carrying the plasmid pRP801 (![]()
The FLAG-Dcp1p preparation was analyzed by standard SDS-PAGE methods on a 10% gel (![]()
Preparation of cap-labeled substrate for in vitro decapping assay:
Uncapped mRNAs lacking poly(A) tails were synthesized in vitro by T7 RNA polymerase runoff transcriptions. Full-length MFA2 mRNA was transcribed from plasmid pRP802 (![]()
T7 transcriptions were done in 100-µl reactions containing 12 µg of template DNA, 5 mM NTPs, 40 mM Tris-HCl, pH 8.0, 1 mM spermidine, 5 mM DTT, 50 µg/ml BSA, 0.01% Triton X-100, 20 mM MgCl2, 5 units yeast inorganic pyrophosphatase (Sigma, St. Louis, MO) and 40 units T7 RNA polymerase (Boehringer Mannheim) at 37° for ~15 hr (![]()
7-Methyl caps were added to in vitro-synthesized MFA2 transcripts in reactions typically containing 23 pmol RNA, 45 pmol [
-32P]GTP, 40 units RNasin (Promega, Madison, WI), 0.67 mM S-adenosylmethionine, 50 mM Tris-HCl, pH 7.6, 2 mM MgCl2, 6 mM KCl, 1 mM DTT, and 25 units guanylyltransferase (GIBCO-BRL) at 37° for 2 hr (![]()
![]()
Decapping assays:
Decapping assays used in this study were similar to those described previously (![]()
-32P-m7GDP) was separated from the unreacted substrate by PEI-cellulose thin-layer chromatography developed in 0.45 M (NH4)2SO4. Activity at any time t is calculated by dividing the amount of product formed at time t by the total amount of substrate taken for the reaction (the sum of the amount of product formed and the amount of unreacted substrate at time t). The activity values were then normalized for the amount of Dcp1p protein in the sample to determine the specific activity values, which were used to plot graphs for the time courses. Quantitations of product formed and unreacted substrate left after the reaction were done using a Molecular Dynamics PhosphorImager. To determine the amount of Dcp1p protein in the purified preparations, Western blot of purified samples was probed with anti-Dcp1p antibodies, and the Dcp1p band intensity in the autoradiograph was then quantitated using the IP Lab Gel program. In addition, for careful comparison, protein concentrations of the purified enzymes were adjusted and then the activity was reassayed where equal amounts of purified Dcp1p could be compared directly (see Figure 6 for example). Whenever a set of purified Dcp1p samples were compared for specific activity, they were all assayed together with wild-type Dcp1p using the same substrate preparation. Assays done with different substrate preparations were not compared.
|
|
|
|
|
|
| RESULTS |
|---|
Mutagenic strategy:
For the analysis of Dcp1p, we used site-directed mutagenesis to change residues that are expected to be important for function. Two approaches were used. First, we used the strategy of charged-to-alanine scanning mutagenesis. In this procedure, clusters of charged amino acids in the primary sequence, which are likely to be on the surface of the folded protein, were identified and systematically changed to alanines (![]()
![]()
![]()
3 residues were changed. Five residues each were affected in dcp1-41 and -42, and four each were changed in dcp1-40, -43, and -44 (Table 1). In each case, it was confirmed by sequencing that the mutant DCP1 gene contained only the targeted mutations. The positions of all mutations on the primary sequence are shown in Figure 1.
Effects of the mutations on deadenylation-dependent decapping in vivo:
To study the effect of the mutations in the DCP1 gene, we determined if they affected mRNA decapping in vivo. Loss of decapping enzyme function (as in dcp1
) leads to a block in mRNA decay in vivo (![]()
3' exonucleolytic digestion of mRNA in vivo (by Xrn1p) is dependent on the removal of mRNA cap by the DCP1 gene product. The dcp1 mutant alleles were expressed from a centromere plasmid in the dcp1
yeast strain yRP1071 (![]()
![]()
![]()
![]()
3' end fragment. In the absence of any decapping, however, the action of Xrn1p and, hence, the formation of a mRNA fragment resulting from the poly(G) tract is blocked (![]()
3' end fragment of the mRNA can be used as a first approximation of the efficiency of decapping and 5' to 3' exonucleolytic digestion (see ![]()
3' end fragment ratios for the MFA2pG and PGK1pG transcripts in all the dcp1 mutants.
The results of these studies (summarized in Table 1) are as follows. First, 16 of the dcp1 primary mutations (covering 27 residues) did not have any significant effect on the ratio of poly(G)
3' end fragment to full-length mRNA and, hence, were not pursued further. These alleles include dcp1-3, -5, -6, -10, to -16, -21, -24, -26 to -28 and -40. Second, the mutant dcp1-7 showed a large effect on the ratio. In this mutant, Arg70 and Asp71 were both converted to alanines (Figure 1). Subsequent studies indicated that the severity of the phenotype of this mutant could be almost fully attributed to the mutation of Arg70. This was revealed by the mutant dcp1-34, wherein only Arg70 is mutated to alanine. Third, 9 mutants, dcp1-2, -4, -17, -19, -25, -31, -32, -33, and -35, showed a partial change in the poly(G)
3' end fragment to full-length mRNA ratio, suggesting that these alleles represented partial loss-of-function mutations. Importantly, it should be noted that the dcp1 mutations affected both MFA2pG and PGK1pG mRNAs similarly in each case, indicating that mRNA-specific rates of decapping cannot be attributed to the decapping enzyme per se (see DISCUSSION).
To confirm that the changes in poly(G)
3' end fragment to full-length mRNA ratios observed in the mutant strains reflected a change in mRNA turnover rates, we directly measured the half-life of MFA2pG mRNA in the different mutants. For this purpose, we took advantage of the fact that the MFA2pG mRNA is expressed from the GAL1 UAS, whose transcription can be inhibited by the addition of glucose, thus allowing a simple determination of mRNA decay rates (see MATERIALS AND METHODS). The results of these analyses (Figure 2) demonstrated that there was a change in mRNA decay rate in the mutants with an altered ratio of full-length to poly(G)
3' end fragment. As expected, mutants with a large change in the ratio (e.g., dcp1-34) showed a large change in t1/2, and the partial loss-of-function mutants showed a more modest effect. Thus, these observations indicate that we have identified several mutations in the decapping enzyme that affect mRNA turnover in vivo.
The dcp1-2 allele is thermolabile for function:
To determine if any of the mutants were cold or heat sensitive, the ratios of poly(G)
3' end fragment to full-length mRNA were also compared at 18° and 36°. Strikingly, the dcp1-2 mutant showed a severe defect at 36°, but a lesser defect at lower temperatures (Figure 3). This difference was also seen in decay rates where at 18°, both dcp1-2 and wild type showed the same rates of decay, while at 30° and 36°, there was a substantial difference (Figure 2 and Figure 4). In fact, at 36°, MFA2pG mRNA decay in dcp1-2 cells was as slow as in dcp1
cells grown at the same temperature (Figure 4). The dcp1-34 allele also showed small differences in function in response to the temperature of growth. This allele was essentially like a null allele at 30° and higher, but it produced a very small amount of the poly(G)
3' end fragment at 18° (Figure 3). These thermosensitive alleles, especially dcp1-2, should be useful for the analysis of mRNA decay (e.g., see ![]()
In vitro analysis of the mutant decapping enzymes:
The above studies identified a number of mutations in Dcp1p that led to a defect in decapping in vivo. In principle, these defects could arise by several means, including destabilizing the protein, altering the enzymatic properties of the decapping enzyme, or preventing interactions with other factors required for proper decapping. To distinguish these possibilities, we first determined if the mutant proteins were being expressed at levels comparable to the wild-type enzyme. Western analysis of crude extracts made from the various mutant dcp1 strains performed with anti-Dcp1p antibodies showed that the level of the Dcp1p protein was not substantially different in the mutants compared to wild-type strain, with the exception of the dcp1-25 mutant, which showed reduced levels compared to wild type (data not shown). This observation indicated that the loss-of-function phenotypes of the mutants, with the exception of dcp1-25, were not caused by changes in protein stability and were, therefore, likely to be caused by the mutations' effects on either the enzymatic function of the decapping enzyme or its ability to interact with other proteins required for decapping in vivo.
To determine if the mutant Dcp1ps expressed in these alleles were defective in enzymatic activity, we purified them and assayed their ability to decap a capped mRNA in vitro. For this purpose, we expressed FLAG epitope-tagged versions of wild-type and mutant dcp1 genes from 2µ vectors (see MATERIALS AND METHODS) in dcp1
cells (strain yRP1071). FLAG-tagged proteins encoded by the following alleles were purified (see MATERIALS AND METHODS): wild type; five of the mutant alleles that lead to partial defects in mRNA decapping in vivo (dcp1-17, dcp1-4, dcp1-19, dcp1-25, and dcp1-31); the allele dcp1-7, which is completely defective in RNA decay in vivo; and the allele dcp1-2, which has a temperature-sensitive RNA decay phenotype in vivo. Analysis of the purified protein samples on SDS polyacrylamide gel revealed a clean ~30-kD protein (Figure 5) that was verified to be Dcp1p by Western analysis (Figure 6B). The purified enzymes were then assayed in vitro for decapping activity using in vitro-synthesized MFA2 mRNA labeled with 32P in the cap. Upon decapping, this substrate releases radiolabeled m7 GDP, which is separated from it by TLC (see MATERIALS AND METHODS). These assays were done under limiting concentrations of substrate so that they would be sensitive to changes in the affinity of the enzyme for the substrate. Figure 6A shows time course curves of decapping reactions performed with wild-type and mutant FLAG-Dcp1p samples drawn by plotting decapping activity values that were normalized for the amount of Dcp1p protein present in the respective samples, as described in MATERIALS AND METHODS. Assays were also done after adjusting the protein concentrations of the individual preparations so that equal amounts of dcp1 protein were compared directly (Figure 6B). The results are summarized in Table 2.
|
Two classes of mutant proteins were identified. First, the alleles dcp1-2 and dcp1-7, which caused a severe loss of mRNA decay function in vivo, yielded FLAG fusion proteins that had in vitro-specific activities at least five times less than that of wild-type FLAG-Dcp1p (Table 2 and Figure 6). We interpreted this observation to indicate that the dcp1-2 and dcp1-7 mutations alter residues that are important for the enzymatic function of Dcp1p.
The second class consisted of six mutants that showed a partial loss of function in vivo, dcp1-4, dcp1-17, dcp1-19, dcp1-25, and dcp1-31. Unlike their in vivo phenotypes, the in vitro-specific activities of the decapping enzymes made by these mutants did not show any loss of function compared to the wild-type protein. As seen in Table 2 and Figure 6, all the mutant proteins had specific activities equal to or greater than that of wild-type Dcp1p. This result was confirmed in multiple preparations of the proteins. The higher specific activity (compared to that of wild-type protein) of some of the mutant proteins may result from the fact that when Dcp1p is overexpressed, only a fraction of the enzyme is active (![]()
One possible explanation for the mutations that affect decapping in vivo but not in vitro is that they target residues required for interactions in vivo that are absent in the in vitro experiment. Alternatively, because these partial loss-of-function mutants have only a weak RNA decay phenotype (moderate stabilization of MFA2pG mRNA) in vivo, another explanation could be that the effects of these mutations on the in vitro enzymatic efficiency of the protein is too small to be detected. One way to distinguish between these two possibilities would be to combine the mutations borne by two or more of these partial loss-of-function mutants to make new mutants that show a more severe loss of function in vivo and to study the specific activity of the decapping enzyme made by such mutants. If the second possibility were true, then one would predict these proteins to have significantly less specific activity than the wild-type protein. On the other hand, if these mutants affect important in vivo interactions with other factors, then combination of the lesions should yield proteins with strong defects in vivo, but still active in vitro when the enzyme is purified.
To this end, mutations of dcp1-17 and dcp1-4 alleles were individually combined by restriction digestion and ligation with mutations of dcp1-19 or dcp1-25. This resulted in four new mutants, dcp1-41 (combination of dcp1-17 and dcp1-19 mutations), dcp1-42 (combination of dcp1-17 and dcp1-25 mutations), dcp1-43 (combination of dcp1-4 and dcp1-19 mutations), and dcp1-44 (combination of dcp1-4 and dcp1-25 mutations). The plasmids were then individually transformed into dcp1
strain to analyze their phenotypes.
MFA2pG mRNA half-life was measured in the mutant strains dcp1-41 to -44. As shown in Figure 7, the alleles dcp1-41 and -42 (combination of mutations of dcp1-17 with those of dcp1-19 and dcp1-25, respectively) do not cause any significantly stronger loss of function than the primary partial loss-of-function mutants and, hence, were not studied further. On the other hand, the other two alleles, dcp1-43 and dcp1-44 (combination of mutations of dcp1-4 with those of dcp1-19 and dcp1-25, respectively) clearly resulted in a much higher stabilization of MFA2pG mRNA than any of the primary partial loss-of-function mutants. In addition, Western analysis showed that all these mutant proteins were expressed at approximately the same levels as the wild-type protein (data not shown).
|
To find if the mutant Dcp1p made in the dcp1-43 and dcp1-44 mutants was active in vitro, we made FLAG epitope-tagged versions of the two mutant dcp1 genes and purified the FLAG-tagged enzymes encoded by them as described earlier. In vitro decapping assays performed with these mutant proteins revealed that both of these mutant proteins had specific activities similar to those of the wild-type protein (Table 2 and Figure 6). This strongly supports the idea that the amino acid residues changed in these mutants are not likely to be important for the enzymatic activity of Dcp1p, but, rather, are important for some functionally important interactions of Dcp1p with other proteins in vivo.
Dcp1p mutants partially defective in MFA2pG and PGK1pG mRNA decay are not defective in mRNA surveillance:
The decapping enzyme Dcp1p functions in both the normal deadenylation-dependent decay pathway and in the deadenylation-independent decapping triggered by early nonsense codons (![]()
![]()
![]()
![]()
Examination of the extent of CYH2 pre-mRNA accumulation by Northern analysis in the various dcp1 mutants is shown in Figure 8. As expected, in wild-type cells, very little CYH2 pre-mRNA accumulated in relation to the CYH2 mRNA. In contrast, the amount of the CYH2 pre-mRNA accumulated in the dcp1
strain and in all the strong loss-of-function mutants, except for dcp1-43 (i.e., in dcp1-2, -7, -34, and -44), was substantially higher than in wild-type cells. Consistent with their MFA2pG mRNA decay phenotype in vivo, dcp1-7 and -34 showed higher CYH2 pre-mRNA accumulation than did dcp1-2 and -44. The allele dcp1-43 caused only a moderate increase in CYH2 premRNA accumulation compared to wild-type cells. Nevertheless, the dcp1 alleles that had a partial loss of function in deadenylation-dependent decay (i.e., MFA2pG mRNA decay) did not show any significant increase in the accumulation of CYH2 pre-mRNA compared to the wild-type control. It is important to note here that as seen in Figure 8, the levels of CYH2 pre-mRNA are very low in wild-type cells, and they are increased about fourfold in dcp1
cells, suggesting that ~75% of the pre-mRNA pool in wild-type cells decays in a DCP1-dependent manner.
|
The observation that the partial loss-of-function mutations did not affect deadenylation-independent decapping could be explained in two ways. First, these mutations could affect some specific structural feature(s) of Dcp1p that is required only for deadenylation-dependent decapping. This possibility seemed unlikely because similar results were seen with all the partial loss-of-function alleles. Alternatively, the rate of decapping of the nonsense-containing mRNAs (which undergo deadenylation-independent decapping) could be less sensitive (than normal mRNAs that undergo deadenylation-dependent decapping) to perturbations in the levels of decapping activity in vivo. To test the second possibility, we took advantage of the temperature sensitivity of the dcp1-2 allele. The logic was to determine if there would be a differential effect on nonsense-mediated vs. regular mRNA decay as we raised the temperature and, thereby, decreased the proportion of functional decapping enzyme in vivo.
For this purpose, we prepared RNA from the dcp1-2 mutant strain grown at 18°, 20°, 22°, 24°, 27°, 30°, 33°, and 36°, and from wild-type cells grown at 18°, 30°, and 36°, and we determined the effects on normal decapping (by examination of the full-length to fragment ratios for the MFA2pG transcript) and deadenylation-independent decapping (by examination of the CYH2 pre-mRNA accumulation relative to CYH2 mRNA accumulation). Comparison of these data showed that decay of the CYH2 pre-mRNA was less sensitive to decreases in the levels of decapping activity. The critical observation was that in dcp1-2 mutants, the decay of MFA2pG mRNA was significantly defective at temperatures where the CYH2 pre-mRNA decay remains normal (Figure 9A). For example, at 30°, there was a substantial increase in the amount of full-length MFA2pG transcript relative to the poly(G)
3' end fragment, whereas there was little change in the amount of CYH2 pre-mRNA accumulation. This observation was consistent with the explanation that in vivo, the decapping activity is limiting for normal mRNA substrates but not for nonsense mRNAs, and, therefore, a partial decrease in decapping activity affects only normal mRNA decay function. This idea was further supported by studying the CYH2 pre-mRNA accumulation in the other mutant with temperature-sensitive MFA2pG mRNA decay phenotype, dcp1-34. In this mutant, the accumulation of CYH2 pre-mRNA is almost as low as in the wild-type control at 18° (Figure 9B), while there is a strong defect in the decapping of the MFA2pG transcript in vivo at the same temperature (as shown by very low levels of poly(G) fragment in relation to full-length MFA2pG mRNA in Figure 3). Importantly, Figure 9 shows that at 36°, the difference in CYH2 pre-mRNA/mRNA ratio between wild-type and dcp1-2 cells is approximately fourfold, which is comparable to the approximately fourfold difference observed in that ratio between wild-type and dcp1
cells grown at 30° (see Figure 8). Because dcp1-2 cells are almost as defective in decapping as dcp1
cells at 36° (see Figure 4), this indicates that the size of the CYH2 pre-mRNA pool degrading in a DCP1-dependent fashion is not drastically altered at higher temperatures. We have also observed a similar fold difference in this ratio when wild-type cells and dcp1
cells grown at 36° were compared (data not shown).
|
As mentioned earlier (Figure 8), the strong loss-of-function allele, dcp1-43, caused only a slight increase in the accumulation of CYH2 pre-mRNA compared to the wild type, unlike all the other strong loss-of-function alleles, dcp1-7, -34, -2, and -44, which resulted in a substantial increase in accumulation of the CYH2 pre-mRNA. At the present time, we do not know if this is because the mutations borne by this allele (dcp1-43) affect features of the decapping enzyme that are specifically required for deadenylation-dependent decapping (normal mRNA decay). Further work will be needed to resolve this issue.
| DISCUSSION |
|---|
Identification of residues important for Dcp1p activity:
In this work, we have identified several residues that are important for the ability of the decapping enzyme to function. The strongest effects were seen with the mutation of arginine at position 70 (dcp1-34) and with the dcp1-2 mutant, in which Arg29 and Asp31 were both changed to alanine residues. The dcp1-34 mutant was defective in decapping in vivo at all temperatures tested, with only a very small amount of mRNA turnover observed at 18°. The dcp1-2 mutant was more strikingly temperature sensitive in its function and showed little difference from the wild type at a low temperature, yet it was phenotypically similar to a null mutant at 36°. In addition to their strong in vivo phenotypes, both dcp1-2 and dcp1-7 produced proteins that were defective in enzymatic activity when purified. This observation indicated that these residues were critical for the enzyme's function. Interestingly, both Arg70 and Asp31 are conserved among a family of related ORFs in the database with homology to the DCP1 sequence (S. MIAN and R. PARKER, unpublished data). One potential role for these conserved arginine and aspartic residues is to be involved in recognition of the substrate. This possibility is suggested by studies on the cytoplasmic cap-binding protein and the viral cap recognition protein, which show that Arg and Asp residues are involved in recognizing the cap moiety. For example, in both proteins, acidic amino acid residues form hydrogen bonds with the N1 and N2 positions of the 7-methylguanine through their side chain carboxyl oxygens (![]()
![]()
- and ß-phosphate oxygens of m7GDP interact with an Arg and a Lys residue of eIF4E (![]()
A second set of interesting residues are the aromatic residues, Trp56, Trp204, and Tyr47, each of which causes a partial loss of function when changed to alanine. These residues are also conserved among the family of related ORFs in the database with homology to DCP1. Furthermore, the importance of such aromatic residues is underscored by the fact that both the cap-binding protein eIF4E and the vaccinia virus cap-specific methyltransferase have been shown to interact with the cap structure by stacking the aromatic ring of 7-methyl guanine between the ring structures of their conserved aromatic amino acid residues, and that the methyl group specificity has at least partly been attributed to such a stacking interaction (![]()
![]()
![]()
In the case of Tyr47, its importance for the protein's function may arise either by virtue of its aromatic ring or its hydroxyl, as in RNase-A, where a conserved Tyr residue has been shown to be required for stabilizing the active site structure (![]()
An interesting observation was that the Dcp1p purified from the partial loss-of-function mutants (dcp1-17, dcp1-4, dcp1-19, dcp1-25, and dcp1-31) had wild-type-specific activity in vitro. This was also true for the mutants dcp1-43 and dcp1-44, which contained combinations of alleles that led to a strong defect in decapping in vivo, yet produced a functional decapping enzyme in vitro. These observations indicated that these lesions alter a property of the decapping enzyme that is not assayable in the current in vitro system. One formal possibility is that these mutations alter the enzyme's structure/folding in such a manner that its catalytic efficiency is lost in vivo but not in vitro. This possibility seems unlikely, considering that this effect was seen with seven different mutants. An alternate and simpler explanation is that these lesions disrupt activation (or recruitment onto the substrate) of Dcp1p by some other factors that are required for efficient decapping in vivo rather than by affecting Dcp1p's own catalytic effeciency. Such activation may involve the direct interaction of such factors with Dcp1p. The importance of the requirement of other gene products for the functioning of Dcp1p in vivo has also been suggested by earlier work in which mutations in other genes that affect decapping in vivo without altering the levels of the decapping enzyme were identified (![]()
![]()
Interestingly, among the four mutants that were made by combining mutations borne by different pairs of primary partial loss-of-function mutants, only two (dcp1-43 and dcp1-44) exhibited a clearly more severe (than the primary partial loss-of-function mutants) loss-of-function phenotype in vivo, while the other two (dcp1-41 and dcp1-42) were defective roughly to the same extent as the primary partial loss-of-function mutants. In other words, only two combinations (out of four) of the primary mutations resulted in aggravating the loss-of-function phenotype of the primary mutations while the other two did not. This could happen if the interaction of Dcp1p with other factor(s) involves several sites of contact on the Dcp1p molecule and some of these contacts are redundant with each other. In that case, in any given primary partial loss-of-function mutantwhere a given site(s) is already mutatedintroducing additional mutations in sites that are redundant (for interaction) with that will fail to aggravate the phenotype any further (for discussion of a similar situation see ![]()
The effects of Dcp1p mutations on differential mRNA decapping rates:
An important question is how the different rates of mRNA decapping are specified on individual mRNAs. In principle, there could be specific interactions with the decapping enzyme that recruit the enzyme to individual mRNAs at different rates. From this perspective, it would be expected that specific alleles of the Dcp1p would affect mRNAs differentially. In this light, we initially compared the effects of the mutations on the decay of the PGK1, a stable mRNA, and MFA2, an unstable mRNA. Both of these mRNAs degrade by the deadenylation-dependent decapping pathway, and the difference in their decay rates at least partly results from the difference in their decapping rates (DECKER et al. 1993; ![]()
![]()
![]()
Our experiments show that moderate losses of the decapping enzyme's function specifically affected only deadenylation-dependent decapping and did not have any detectable effect on nonsense-mediated decay in vivo. This conclusion was supported by the following observations, in which conditions that led to a partial defect in normal (MFA2pG) mRNA decay resulted in no defect in nonsense-mediated mRNA decay. First, in all the partial loss-of-function mutants studied, there was no increase in the accumulation of CYH2 pre-mRNA compared to wild type (Figure 8). Second, with increasing growth temperature of dcp1-2 cells, MFA2pG mRNA decay becomes defective at a lower temperature than does the CYH2 premRNA decay (Figure 9A). Third, dcp1-34 cells showed a strong defect in MFA2pG mRNA decay at 18° (Figure 3), but they showed no effect on CYH2 premRNA accumulation at this temperature (Figure 9B).
The above observations argue that nonsense-mediated decapping is less sensitive to perturbations in the decapping enzyme's function than normal deadenylation-dependent decapping. This suggests that the nonsense codon-containing substrate may be a more easily accessible substrate for decapping than the normal mRNA substrate because of the manner in which decapping is triggered in response to a nonsense codon. This view has two implications. First, other trans-acting mutations that have been described as being specific for deadenylation-dependent decapping (![]()
![]()
![]()
| LITERATURE CITED |
|---|
BASHKIROV, V. I., H. SCHERTHAN, J. A. SOLINGER, J.-M. BUERSTEDDE, and W.-D. HEYER, 1997 A mouse cytoplasmic exoribonuclease (mXRN1p) with preference for G4 tetraplex substrates. J. Cell Biol. 136:761-773
BEELMAN, C. A. and R. PARKER, 1995 Degradation of mRNA in eukaryotes. Cell 81:179-183[Medline].
BEELMAN, C. A., A. STEVENS, G. CAPONIGRO, T. E. LAGRANDEUR, and L. HATFIELD et al., 1996 An essential component of the decapping enzyme required for normal rates of mRNA turnover. Nature 382:642-646[Medline].
BOECK, R., B. LAPEYRE, C. E. BROWN, and A. B. SACHS, 1998 Capped mRNA degradation intermediates accumulate in the yeast spb8-2 mutant. Mol. Cell. Biol. 18:5062-5072
CAPONIGRO, G. and R. PARKER, 1995 Multiple functions for the poly(A)-binding protein in mRNA decapping and deadenylation in yeast. Genes Dev. 9:2421-2432
CAPONIGRO, G., D. MUHLRAD, and R. PARKER, 1993 A small segment of MAT
1 transcript promotes mRNA decay in Saccharomyces cerevisiae: a stimulatory role for rare codons. Mol. Cell. Biol. 13:5141-5148
COUTTET, P., M. FROMONT-RACINE, D. STEEL, R. PICTET, and T. GRANGE, 1997 Messenger RNA deadenylation precedes decapping in mammalian cells. Proc. Natl. Acad. Sci. USA 94:5628-5633
DECKER, C. J. and R. PARKER, 1993 A turnover pathway for both stable and unstable mRNAs in yeast: evidence for a requirement for deadenylation. Genes Dev. 7:1632-1643
EBERHARDT, E. S., P. K. WITTMAYER, B. M. TEMPLER, and R. T. RAINES, 1996 Contribution of a tyrosine side chain to ribonuclease A catalysis and stability. Prot. Sci. 5:1697-1703[Medline].
ELLEDGE, S. J. and R. W. DAVIS, 1988 A family of versatile centromeric vectors designed for use in the sectoring-shuffle mutagenesis assay in Saccharomyces cerevisiae. Gene 70:303-312[Medline].
GERA, J. F. and E. J. BAKER, 1998 Deadenylation-dependent and -independent decay pathways for alpha1-tubulin mRNA in Chlamydomonas reinhardtii.. Mol. Cell. Biol. 18:1498-1505
HARRIS, M. E., J. M. NOLAN, A. MALHOTRA, J. W. BROWN, and S. C. HARVEY et al., 1994 Use of photoaffinity crosslinking and molecular modeling to analyze the global architecture of ribonuclease P RNA. EMBO J. 13:3953-3963[Medline].
HATFIELD, L., C. A. BEELMAN, A. STEVENS, and R. PARKER, 1996 Mutations in trans-acting factors affecting mRNA decapping in Saccharomyces cerevisiae.. Mol. Cell. Biol. 16:5830-5838[Abstract].
HE, F., S. W. PELTZ, J. L. DONAHUE, M. ROSBASH, and A. JACOBSON, 1993 Stabilization and ribosome association of unspliced pre-mRNAs in a upf1
mutant. Proc. Natl. Acad. Sci. USA 90:7034-7038
HEYER, W. D., A. W. JOHNSON, U. REINHART, and R. D. KOLODNER, 1995 Regulation and intracellular localization of Saccharomyces cerevisiae strand exchange protein 1 (Sep1/Xrn1/Kem1), a multifunctional exonuclease. Mol. Biol. Cell. 15:2728-2736.
HIGGS, D. C. and J. T. COLBERT, 1994 Oat phytochrome A mRNA degradation appears to occur via two distinct pathways. Plant Cell 6:1007-1019[Abstract].
HODEL, A., X. SHI, and P. D. GERSHON, 1997 Specific protein recognition of an mRNA cap through its alkylated base. Nat. Struct. Biol. 4:350-354[Medline].
HOLTZMAN, D. A., K. F. WERTMAN, and D. G. DRUBIN, 1994 Mapping actin surfaces required for functional interactions in vivo.. J. Cell Biol. 126:423-432
HSU, C. L. and A. STEVENS, 1993 Yeast cells lacking 5'
3' exoribonuclease 1 contain mRNA species that are poly (A) deficient and partially lack the 5' cap structure. Mol. Cell. Biol. 13:4826-4835
JACOBS ANDERSON, J. S. and R. PARKER, 1998 The 3' to 5' degradation of yeast mRNAs is a general mechanism for mRNA turnover that requires the SKI2 DEVH box protein and 3' to 5' exonucleases of the exosome complex. EMBO J. 17:1497-1506[Medline].
JACOBSON, A. and S. W. PELTZ, 1996 Interrelationships of the pathways of mRNA decay and translation in eukaryotic cells. Annu. Rev. Biochem. 65:693-739[Medline].
LAEMMLI, U. K., 1970 Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685[Medline].
LAGRANDEUR, T. E. and R. PARKER, 1998 Isolation and characterization of Dcp1p, the yeast mRNA decapping enzyme. EMBO J. 17:101-110[Medline].
LAGRANDEUR, T. E. and R. PARKER, 1999 The cis-acting sequences responsible for the differential decay of the unstable MFA2 and stable PGK1 transcripts in yeast include the context of translational start codon. RNA in press.
LIM, S. K. and L. E. MAQUAT, 1992 Human ß-globin mRNAs that harbor a nonsense codon are degraded in murine erythroid tissues to intermediates lacking regions of exon I or exons I and II that have a cap-like structure at the 5' termini. EMBO J. 11:3271-3278[Medline].
MARCOTRIGIANO, J., A.-C. GINGRAS, N. SONENBERG, and S. K. BURLEY, 1997 Cocrystal structure of the messenger RNA 5' cap-binding protein (eIF-4E) bound to 7-methyl GDP. Cell 89:951-961[Medline].
MATSUO, H., H. LI, A. M. MCGUIRE, C. M. FLETCHER, and A. C. GINGRAS et al., 1997 Structure of translation factor eIF4E bound to m7GDP and interaction with 4E-binding protein. Nat. Struct. Biol. 4:717-724[Medline].
MUHLRAD, D. and R. PARKER, 1992 Mutations affecting stability and deadenylation of the yeast MFA2 transcript. Genes Dev. 6:2100-2111
MUHLRAD, D. and R. PARKER, 1994 Premature translational termination triggers mRNA decapping. Nature 370:578-581[Medline].
MUHLRAD, D., C. J. DECKER, and R. PARKER, 1994 Deadenylation of the unstable mRNA encoded by the yeast MFA2 gene leads to decapping followed by 5' to 3' digestion of the transcript. Genes Dev. 8:855-866
MUHLRAD, D., C. J. DECKER, and R. PARKER, 1995 Turnover mechanisms of the stable yeast PGK1 mRNA. Mol. Cell. Biol. 15:2145-2156[Abstract].
PARKER, R., S. W. PELTZ, D. HERRICK, and A. JACOBSON, 1991 Measurement of mRNA decay rates in S. cerevisiae. Methods Enzymol. 194:415-422[Medline].
ROSS, J., 1995 mRNA stability in mammalian cells. Microbiol. Rev. 59:423-450
SCHENA, M., D. PICARD, and K. R. YAMAMOTO, 1991 Vectors for constitutive and inducible gene expression in yeast. Methods Enzymol. 194:389-398[Medline].
SHUMAN, S. and B. MOSS, 1990 Purification and use of vaccinia virus messenger RNA capping enzyme. Methods Enzymol. 181:170-180[Medline].
THARUN, S., and R. PARKER, 1997 Mechanisms of mRNA turnover in eukaryotic cells, pp. 181199 in mRNA Metabolism and Post-transcriptional Gene Regulation (Modern Cell Biology, Vol. 17), edited by J. B. HARFORD and D. R. MORRIS. John Wiley Publishers, New York.
WELLS, J. A., 1991 Systematic mutational analyses of protein-protein interfaces. Methods Enzymol. 202:391-411.
WHITFIELD, T. T., C. R. SHARPE, and C. C. WYLIE, 1994 Nonsense-mediated mRNA decay in Xenopus oocytes and embryos. Dev. Biol. 165:731-734[Medline].
This article has been cited by other articles:
![]() |
H. Gaillard and A. Aguilera A Novel Class of mRNA-containing Cytoplasmic Granules Are Produced in Response to UV-Irradiation Mol. Biol. Cell, November 1, 2008; 19(11): 4980 - 4992. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Chowdhury and S. Tharun lsm1 mutations impairing the ability of the Lsm1p-7p-Pat1p complex to preferentially bind to oligoadenylated RNA affect mRNA decay in vivo RNA, October 1, 2008; 14(10): 2149 - 2158. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. A. Peculis, K. Reynolds, and M. Cleland Metal Determines Efficiency and Substrate Specificity of the Nuclear NUDIX Decapping Proteins X29 and H29K (Nudt16) J. Biol. Chem., August 24, 2007; 282(34): 24792 - 24805. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Chowdhury, J. Mukhopadhyay, and S. Tharun The decapping activator Lsm1p-7p-Pat1p complex has the intrinsic ability to distinguish between oligoadenylated and polyadenylated RNAs RNA, July 1, 2007; 13(7): 998 - 1016. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Xu, J.-Y. Yang, Q.-W. Niu, and N.-H. Chua Arabidopsis DCP2, DCP1, and VARICOSE Form a Decapping Complex Required for Postembryonic Development PLANT CELL, December 1, 2006; 18(12): 3386 - 3398. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. E. Baker and R. Parker Conventional 3' end formation is not required for NMD substrate recognition in Saccharomyces cerevisiae RNA, August 1, 2006; 12(8): 1441 - 1445. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. S. Ford, Q. Guan, E. Neeno-Eckwall, and M. R. Culbertson Ebs1p, a Negative Regulator of Gene Expression Controlled by the Upf Proteins in the Yeast Saccharomyces cerevisiae Eukaryot. Cell, February 1, 2006; 5(2): 301 - 312. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Tharun, D. Muhlrad, A. Chowdhury, and R. Parker Mutations in the Saccharomyces cerevisiae LSM1 Gene That Affect mRNA Decapping and 3' End Protection Genetics, May 1, 2005; 170(1): 33 - 46. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. E. A. Holmes, S. G. Campbell, S. K. De Long, A. B. Sachs, and M. P. Ashe Loss of Translational Control in Yeast Compromised for the Major mRNA Decay Pathway Mol. Cell. Biol., April 1, 2004; 24(7): 2998 - 3010. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kshirsagar and R. Parker Identification of Edc3p as an Enhancer of mRNA Decapping in Saccharomyces cerevisiae Genetics, February 1, 2004; 166(2): 729 - 739. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. L. Heikkinen, S. A. Llewellyn, and C. A. Barnes Initiation-mediated mRNA decay in yeast affects heat-shock mRNAs, and works through decapping and 5'-to-3' hydrolysis Nucleic Acids Res., July 15, 2003; 31(14): 4006 - 4016. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. SCHWARTZ, C. J. DECKER, and R. PARKER The enhancer of decapping proteins, Edc1p and Edc2p, bind RNA and stimulate the activity of the decapping enzyme RNA, February 1, 2003; 9(2): 239 - 251. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Lykke-Andersen Identification of a Human Decapping Complex Associated with hUpf Proteins in Nonsense-Mediated Decay Mol. Cell. Biol., December 1, 2002; 22(23): 8114 - 8121. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Decker and R. Parker mRNA decay enzymes: Decappers conserved between yeast and mammals PNAS, October 1, 2002; 99(20): 12512 - 12514. [Full Text] [PDF] |
||||
![]() |
H. Tourriere, I.-e. Gallouzi, K. Chebli, J. P. Capony, J. Mouaikel, P. van der Geer, and J. Tazi RasGAP-Associated Endoribonuclease G3BP: Selective RNA Degradation and Phosphorylation-Dependent Localization Mol. Cell. Biol., November 15, 2001; 21(22): 7747 - 7760. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. R. Albig and C. J. Decker The Target of Rapamycin Signaling Pathway Regulates mRNA Turnover in the Yeast Saccharomyces cerevisiae Mol. Biol. Cell, November 1, 2001; 12(11): 3428 - 3438. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Dunckley, M. Tucker, and R. Parker Two Related Proteins, Edc1p and Edc2p, Stimulate mRNA Decapping in Saccharomyces cerevisiae Genetics, January 1, 2001; 157(1): 27 - 37. [Abstract] [Full Text] |
||||
![]() |
J. T. Mendell, S. M. Medghalchi, R. G. Lake, E. N. Noensie, and H. C. Dietz Novel Upf2p Orthologues Suggest a Functional Link between Translation Initiation and Nonsense Surveillance Complexes Mol. Cell. Biol., December 1, 2000; 20(23): 8944 - 8957. [Abstract] [Full Text] |
||||
![]() |
D. C. Schwartz and R. Parker mRNA Decapping in Yeast Requires Dissociation of the Cap Binding Protein, Eukaryotic Translation Initiation Factor 4E Mol. Cell. Biol., November 1, 2000; 20(21): 7933 - 7942. [Abstract] [Full Text] |
||||
![]() |
A. van Hoof, R. R. Staples, R. E. Baker, and R. Parker Function of the Ski4p (Csl4p) and Ski7p Proteins in 3'-to-5' Degradation of mRNA Mol. Cell. Biol., November 1, 2000; 20(21): 8230 - 8243. [Abstract] [Full Text] |
||||
![]() |
C. Bonnerot, R. Boeck, and B. Lapeyre The Two Proteins Pat1p (Mrt1p) and Spb8p Interact In Vivo, Are Required for mRNA Decay, and Are Functionally Linked to Pab1p Mol. Cell. Biol., August 15, 2000; 20(16): 5939 - 5946. [Abstract] [Full Text] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Tharun, S.
- Articles by Parker, R.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Tharun, S.
- Articles by Parker, R.



















