Suppressor Analysis of the Saccharomyces cerevisiae Gene REC104 Reveals a Genetic Interaction With REC102

Corresponding author: Robert Malone, Department of Biological Sciences, 427 Biology Bldg., University of Iowa, Iowa City, IA 52242., robert-malone{at}uiowa.edu (E-mail)

Communicating editor: M. E. ZOLAN

	ABSTRACT

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

REC104 is a gene required for the initiation of meiotic recombination in Saccharomyces cerevisiae. To better understand the role of REC104 in meiosis, we used an in vitro mutagenesis technique to create a set of temperature-conditional mutations in REC104 and used one ts allele (rec104-8) in a screen for high-copy suppressors. An increased dosage of the early exchange gene REC102 was found to suppress the conditional recombinational reduction in rec104-8 as well as in several other conditional rec104 alleles. However, no suppression was observed for a null allele of REC104, indicating that the suppression by REC102 is not "bypass" suppression. Overexpression of the early meiotic genes REC114, RAD50, HOP1, and RED1 fails to suppress any of the rec104 conditional alleles, indicating that the suppression might be specific to REC102.

CHROMOSOMES undergo a series of specialized events during meiosis, including genetic recombination and pairing of homologues. High levels of recombination occur in prophase I of meiosis and are required in most organisms for proper chromosome segregation in meiosis I and the production of viable meiotic products (e.g., spores). The budding yeast Saccharomyces cerevisiae has been a powerful tool for understanding meiosis and meiotic recombination (PETES et al. 1991 ). The yeast SPO13 gene has been useful in ordering meiotic recombination genes into a recombination pathway (e.g., MALONE 1983 ; MAO-DRAAYER et al. 1996 ). A spo13 null mutation results in a single division in meiosis (KLAPHOLZ and ESPOSITO 1980 ; MALONE and ESPOSITO 1981 ; HUGERAT and SIMCHEN 1993 ). In the absence of recombination initiation, chromosomes divide equationally in the presence of a spo13 null mutation and produce live Rec^- spores (e.g., MALONE and ESPOSITO 1981 ). Thus, a spo13 null mutation provides a method for studying, in live meiotic products, the effects of some types of mutations that reduce meiotic recombination.

Meiotic recombination genes have been classified as "early" or "late" on the basis of mutant phenotypes in the presence of a spo13 null mutation (MALONE 1983 ; PETES et al. 1991 ). Strains containing a mutation in a recombination gene that is required early produce viable spores in the presence of a spo13 null mutation (e.g., GALBRAITH and MALONE 1992 ). One class of early recombination genes has been called "early exchange" (EE) because the genes are required early in meiosis for the initiation of all types of meiotic recombination (MALONE 1983 ; MAO-DRAAYER et al. 1996 ). Most of the EE genes appear to be directly involved in initiating the pathway resulting in the exchange of DNA between homologs; they are required for the formation of meiotic double-strand breaks (DSBs; e.g., RAD50, CAO et al. 1990 ; REC104, BULLARD et al. 1996 ). A second group of early recombination genes has been called "early synapsis" (ES; MAO-DRAAYER et al. 1996 ), including HOP1 (HOLLINGSWORTH and BYERS 1989 ; HOLLINGSWORTH et al. 1990 ), RED1 (ROCKMILL and ROEDER 1990 ), and MEK1 (ROCKMILL and ROEDER 1991 ). These represent a distinguishable class of early recombination genes (i.e., rescued by a spo13 null mutation) required for synaptonemal complex (SC) formation, but only for interchromosomal recombination (MAO-DRAAYER et al. 1996 ; SCHWACHA and KLECKNER 1997 ). Meiotic recombination mutants that cannot be rescued by spo13 null have been designated "late exchange" (LE) genes (MAO-DRAAYER et al. 1996 ). These genes [including RAD52, RAD57, and DMC1 (e.g., GAME et al. 1980 ; MALONE 1983 ; BISHOP et al. 1992 )] appear to be directly involved in the exchange pathway and act after DSB formation.

Activities of a few EE gene products have been proposed either from testing protein function directly, by inference from mutant analysis, or by comparison with homologs. Both MER1 (NANDABALAN and ROEDER 1995 ) and MRE2 (NAKAGAWA and OGAWA 1997 ) are necessary for meiotic splicing of MER2 mRNA. RAD50 has been shown to bind DNA in an ATP-dependent fashion (RAYMOND and KLECKNER 1993 ). Special alleles of RAD50 and MRE11, rad50S and mre11S, allow DSB formation but prevent DSB processing (ALANI et al. 1990 ; NAIRZ and KLEIN 1997 ). Rad50p and Mre11p have regions that are similar to portions of the SbcC and SbcD proteins of Escherichia coli, suggesting a possible nuclease activity (SHARPLES and LEACH 1995 ). KEENEY et al. 1997 purified a protein covalently attached to DSB ends in rad50S strains and identified it as Spo11p, a protein exhibiting moderate sequence similarity to a family of type II topoisomerases (BEGERAT et al. 1997). The specific activities of the other EE genes in DSB formation are not yet clear.

With the exception of the splicing functions MER1 and MRE2, the genes in the EE class all display the same null mutant phenotypes: reduced sporulation, spore inviability, no meiotic recombination, and the ability to be rescued by a spo13 null mutation. Interactions in mitotic cells have been reported among MRE11, RAD50, and XRS2 genes required for both meiotic DSB formation and mitotic DSB repair (JOHZUKA and OGAWA 1995 ; DOLGANOV et al. 1996 ). Evidence for large structures [termed recombination nodules (CARPENTER 1975 , CARPENTER 1987 )] associated with recombination in Drosophila melanogaster and other organisms raises the possibility that recombination protein complexes associated with the SC may exist along chromosomes for the initiation of recombination. In S. cerevisiae, the members of the EE class are clearly candidates for participation in an initiation complex/recombination nodule.

REC104 is an EE gene exhibiting meiosis-specific expression (GALBRAITH and MALONE 1992 ) for which no homologs have been reported in the databases other than in Saccharomyces species (NAU et al. 1997 ). Null mutations in REC104 confer all phenotypes expected of a typical EE gene (see above). Because many of the EE gene products might be present in a recombination initiation complex, we asked which, if any, gene products might interact with Rec104p. The use of high-copy plasmids to isolate suppressors of known mutations has been a powerful technique to identify genetic and/or physical interactions between genes (e.g., BROACH and VOLKERT 1991 ). HOLLINGSWORTH and JOHNSON 1993 previously identified REC104 as a high-copy suppressor of hop1-628, a temperature-sensitive allele of the ES gene HOP1, establishing a potential bridge between recombination initiation and SC components. To look for REC104 suppressors, we first created a set of mutations conferring a conditional phenotype for meiotic recombination and then performed a high-copy suppression screen that identified REC102 as a suppressor of a rec104 conditional allele. Like REC104, REC102 is a meiosis-specific EE gene (COOL and MALONE 1992 ). This is the first evidence for a possible interaction between two meiosis-specific EE genes in meiotic recombination in S. cerevisiae.

	MATERIALS AND METHODS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Yeast strains and plasmids:
The yeast strains and plasmids used in this study are listed in Table 1. LS2-6 and LS2-8 are congenic diploids. LS2-3-4B and LS2-3-20D haploid strains (rec104-1) were used to make isogenic diploids containing rec104-8, rec104-12, rec104-20, and rec104-21 alleles. Each conditional allele (located on the integrating plasmids pLS6I, pLS10I, pLS16I, or pLS17I, respectively) was transformed into LS2-3-4B and LS2-3-20D and the allele was placed into the chromosome by two-step gene replacement (ROTHSTEIN 1991 ). Strains were verified by both Southern blotting and genetic tests. Correct haploids containing either rec104-1 or one of the conditional mutations were crossed to give LS5-1 (rec104-8/rec104-1), NW2-1 (rec104-21/rec104-21), NW3-1 (rec104-12/rec104-12), and NW4-1 (rec104-20/rec104-20) diploids. The conditional recombination phenotype of each diploid was confirmed by measuring sporulation, viability, and recombination at the permissive and nonpermissive temperatures.

The plasmid pLS1 was constructed for use as a gapped vector containing the REC104 flanking regions without the coding sequences. This plasmid was constructed by subcloning DNA corresponding to -420 to -40 (primers 1 and 2: ClaI-EcoRI) and +611 to +1211 (primers 3 and 4: EcoRI-XbaI) relative to the +1 of the REC104 coding region by three-piece ligation into the ClaI and XbaI sites of pRS316. These fragments were generated by PCR with restriction enzyme sites added to the ends of each fragment. The plasmid was digested with EcoRI before transformation into yeast to generate a gapped vector. Sequences of primers are as follows: primer 1, GTCATTCCAATTTGTCGGA; primer 2, CGGGGATTCTTATACAAAAG; primer 3, AACGGGAATTCTTCCATGAT; primer 4, CACAAAGAGATCTAGAGAAG. Plasmids pLS6, pLS10, pLS16, and pLS17 contain the mutations rec104-8, rec104-12, rec104-20, and rec104-21, respectively, after gap rescue of pLS1 with mutagenized PCR DNA (see PCR mutagenesis below). Integrating plasmids pLS6I, pLS10I, pLS16I, and pLS17I were constructed by cloning a 1.2-kb XbaI-ClaI fragment from pLS6, pLS10, pLS16, and pLS17 into pRS306.

Yeast media and genetic procedures:
Yeast strains were grown on YPD or synthetic complete media lacking uracil (SC-ura; SHERMAN et al. 1986 ). Sporulation media are described in MALONE et al. 1991 . Sporulation media containing 0.03% galactose were used for galactose induction. Strains were sporulated for 7 days at 24° and 5 days at 35°. Media containing 5-fluoroorotic acid (5-FOA) were prepared as described by BOEKE et al. 1984 . Media containing both canavanine and cycloheximide (Can + Cyh) was prepared by adding 200 µl of 0.1% cycloheximide and 3 ml of 1% canavanine to 500 ml of SC-arg media.

Mating, diploid isolation and analysis, and tetrad and dyad dissection were carried out by standard procedures (SHERMAN et al. 1986 ). A lithium acetate procedure was used to transform yeast (ITO et al. 1983 ).

PCR mutagenesis of REC104:
Random mutagenesis of REC104 was performed as described in MUHLRAD et al. 1992 . This mutagenesis technique involves cotransformation of PCR-mutagenized DNA with a "gapped vector" (pLS1) containing homology to the PCR product. Because they contain homology, the two DNA fragments will recombine in vivo to produce a circular plasmid, some fraction of which will contain a random mutation. Primers used were primer 50, GGCATAAATGGAAGAAAAGG and primer 97, GGAACTCTTCATCACTAATC located at -339 and +910 relative to +1 of REC104. Conditions for mutagenic PCR were as follows: 2.5 ng of REC104 template (-339 to +910 relative to +1 of REC104), 2.5 µm of each primer, 0.5 mM dNTPs, 1x PCR buffer, and 2.5 units of Taq polymerase (BRL) in a final volume of 50 µl. Magnesium and manganese were added to a total of 10 mM final concentration. In the first mutagenesis (reaction 1), 9.7 mM magnesium and 0.3 mM manganese were used, and in the second mutagenesis (reaction 2) 9.2 mM magnesium and 0.8 mM manganese were used.

Two independent screens for conditional alleles of REC104 were performed. Screen 1 involved pLS1 DNA digested with EcoRI (gapped vector) and PCR-mutagenized REC104 DNA (at a molar ratio of 10:1) transformed into LS2-6 (rec104-1). Transformants were picked to SC-ura medium, transferred to sporulation medium, and screened for a conditional recombination phenotype at 24° and 35°. As a control, a PCR product from a reaction containing no manganese was also transformed into LS2-6 using the same conditions. From this control experiment, no transformants out of 200 examined displayed a mutant phenotype.

DNA of candidates carrying conditional alleles was isolated and electroporated into E. coli. Plasmid DNA of each candidate was analyzed by restriction enzyme digestion and sequencing.

High-copy suppressor screen:
LS5-1 (rec104-8/rec104-1) was transformed with 1 µg of a YEp24-based library (MALONE et al. 1991 ) and 5000 transformants were picked to SC-ura media. Recombination was measured by sporulating at both 24° and 35° and replica plating to SC-leu media. After initial testing, 101 candidates with high levels of recombination were retested by sporulating and replica plating to SC-leu, SC-trp, SC-met, Can, and Cyh media. A total of 56 candidates were single-colony purified and retested again for recombination at 35°. Finally, yeast genomic DNA was made from 22 candidates and electroporated into E. coli. Plasmid DNA was isolated from E. coli and examined by restriction enzyme digestion and Southern blotting. Plasmids containing the final 22 candidates were retransformed into a fresh LS5-1 diploid, and recombination was measured by sporulating transformants and replica plating to media diagnostic for recombination.

Recombination measurements:
Intragenic heteroallelic recombination frequencies that reflect gene conversion were measured as described in MAO-DRAAYER et al. 1996 . The recessive drug-resistance markers (CAN1 and CYH2) were used as a measure of proper chromosome segregation and hence, indirectly, of crossing over (HOLLINGSWORTH and BYERS 1989 ).

Northern analysis:
RNA was isolated from JK9-1 at 0, 5, 6, 7, 12, and 24 hr in sporulation medium. Northern analysis was performed as described in COOL and MALONE 1992 . RNA (20 µg) was loaded in each lane. The blot was reprobed with the ENO1 gene as a loading control.

	RESULTS

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Isolation of conditional REC104 mutants:
Mutations in the REC104 gene were isolated to identify important regions of Rec104p and, more pertinent to the experiments in this article, to provide useful tools for isolating functional suppressors (e.g., HOLLINGSWORTH and JOHNSON 1993 ). Conditional mutations provide an opportunity to look for suppressors under conditions of partial gene activity due to low activity levels or misfolding of the mutant protein.

A random mutagenesis technique utilizing PCR (MATERIALS AND METHODS) was implemented in part because Rec104p has no strong sequence similarity to any known proteins or motifs. In two independent screens done to obtain conditional alleles (MATERIALS AND METHODS), 134 rec104 mutants were obtained (Table 2). Mutants were divided into four classes on the basis of their recombination phenotypes: Partial function mutants displayed intermediate levels of recombination at all temperatures, temperature-sensitive mutants had lower levels of recombination at 35°, cold-sensitive mutants recombined at lower levels at 24°, and null alleles caused a complete loss of recombinational activity (i.e., no difference from the null rec104-1 mutation) at all temperatures. The two experiments generated 31 temperature-sensitive (ts) and 3 cold-sensitive (cs) alleles of REC104 (Table 2).

Characterization of a temperature-sensitive allele of REC104:
The rec104-8 temperature-sensitive allele was isolated from the first mutagenesis. A rec104-8 homozygous diploid displayed a modest temperature-sensitive phenotype (Figure 1). We asked whether the ts phenotype could be enhanced by constructing a hemizygous strain (rec104-1/rec104-8). The hemizygous diploid (LS5-1) has an easily detectable temperature-sensitive meiotic recombination phenotype with greatly reduced meiotic recombination at 35° (Figure 1A). Comparison of the phenotypes of the homozygous and hemizygous diploids suggests that Rec104-8p is present and partially functional at 35°, but that the amount of activity present at 35° is critical. This makes the rec104-8 allele an excellent candidate to be used for suppressor analysis. To characterize the properties of a rec104-8 hemizygous diploid (LS5-1), we measured sporulation and spore viability at permissive and nonpermissive temperatures (Table 3). Both were reduced at the nonpermissive temperature (35°), as predicted. If one averages the recombination observed at four independent genomic loci (Table 3), the overall meiotic recombination frequency at 35° is ~5% of the value at 24°. Recombination measurements in the wild-type strain (LS2-8) at 35° were 90% of the 24° value, indicating that recombination is not significantly affected when the wild-type strain is sporulated at 35°. The frequency of crossing over was measured in a rec104-8 hemizygous diploid containing a spo13-1 mutation to measure recombination among viable spores. LS5-30 diploids were sporulated and recombination was measured at 24° and 35°. The data in Table 4 demonstrate that meiotic crossing over is drastically reduced in LS5-30 diploids at 35° and is relatively normal at 24°.

View larger version (54K): In this window In a new window Download PPT slide   Figure 1. (A) The rec104-8 mutation confers a temperature-sensitive recombination defect. Patches of wild-type diploid cells (LS2-8), rec104-8 hemizygous diploid cells, or rec104-8 homozygous diploid cells were sporulated at the indicated temperature and replicated to SC-leu media to examine meiotic recombination at the LEU1 locus. Each microcolony represents a recombination event. Similar results were observed at four other loci diagnostic for recombination. (B) REC102 suppresses the temperature-sensitive meiotic recombination defect of rec104-8. Plasmids contained in the diploid LS5-1 (hemizygous rec104-8) are indicated next to their respective patches. HC, high-copy plasmid; CEN, centromere-based plasmid. HC REC102a is the original high-copy plasmid recovered from the suppression screen. HC REC102b is pJK22 (Table 1). Vector, YEp24; CEN REC104, pAMG409; HC REC104, pAMG406.

Screen for suppressors of rec104-8:
To identify high-copy suppressors, the hemizygous diploid LS5-1 was transformed with a YEp24 (2µ)-based library (MALONE et al. 1991 ). A total of 5000 transformants was analyzed for meiotic recombination at the nonpermissive temperature. After several rounds of testing (see MATERIALS AND METHODS), two candidates retained the ability to suppress a rec104-8 mutant. As expected, REC104 itself was recovered as a suppressor of a rec104-8 mutation. One other high-copy plasmid, pSUP77, suppressed a rec104-8 allele.

Characterization of the suppression of rec104-8 by REC102:
Sequencing both ends of the suppressor plasmid pSUP77 demonstrated that only one complete open reading frame, REC102, was contained on the 2.1-kb insert. To verify that the important element in the suppressing plasmid was REC102, an independently constructed high-copy plasmid (pJK22) containing only REC102 regulatory and coding sequences was transformed into LS5-1. pJK22 is capable of suppressing (Figure 1B), confirming that REC102 is the gene responsible for suppression of rec104-8.

High-copy plasmids typically result in a 10-fold increase in the gene product levels (RINE 1991 ). To determine if the high-copy number was necessary for suppression, a centromere-based plasmid (pCM212), present at one to two copies per cell (TSCHUMPER and CARBON 1983 ), and containing REC102 was transformed into LS5-1. pCM212 is also capable of some suppression of rec104-8 (Figure 1B), but not to the same extent as the high-copy plasmids. This demonstrates that REC102 suppression is dosage dependent, though it may not be linearly related to copy number. The degree of suppression of rec104-8 by REC102 was quantitated and the results are displayed in Table 5. At nonpermissive temperature, LS5-1 (rec104-8/rec104-1) diploids containing vector alone have an average 79-fold reduction in recombination compared to a diploid containing the wild-type REC104 gene. The presence of high-copy REC102 in LS5-1 resulted in a 10.3-fold increase in meiotic recombination over vector alone (or only a 7.7-fold reduction relative to wild type; Table 5). The presence of a CEN plasmid containing REC102 (pCM212) resulted in an intermediate increase in recombination (4.9-fold) over the vector-alone control (or a 16-fold decrease from the wild-type control; Table 5). Recombination measurements included both gene conversion (as measured by Leu⁺, Met⁺, Trp⁺ prototrophs) and crossing over (as measured indirectly by Can^r,Cyh^r spores).

High-copy REC102 suppresses multiple alleles of REC104:
To determine whether REC102 could suppress other alleles of REC104, we examined suppression in homozygous diploids containing one of three different conditional rec104 alleles. These included two ts alleles (rec104-21 and rec104-12) and one cs allele (rec104-20). Figure 2 demonstrates that high-copy REC102 can suppress both rec104-21 and rec104-12, although substantially less suppression is observed for the rec104-20 allele. Quantitation of the suppression of multiple rec104 alleles by REC102 is shown in Table 6. These data demonstrate that the presence of a high-copy REC102 increases recombination 10-fold in the rec104-21 diploid, 16-fold in the rec104-12 strain, but only 3.4-fold in the rec104-20 strain (see DISCUSSION).

View larger version (74K): In this window In a new window Download PPT slide   Figure 2. Suppression of rec104 conditional mutants by REC102 is not specific to the rec104-8 allele. Diploids containing different rec104 conditional alleles are shown on the left. The allele number is indicated below the diploid name. The vectors contained in each diploid are indicated above the columns. YEp24 was used for the vector control. HC, high copy. Diploid NW4-1 was sporulated at 24° for 7 days because it contains the rec104-20 cold-sensitive allele. All other diploids were sporulated at 35° for 5 days. Replica-plating assays were done using the same sporulation plates at the same time.

High-copy REC102 is not a bypass suppressor of REC104:
To test if REC102 can bypass the need for Rec104p in meiosis, high-copy REC102 was transformed into a rec104-1 diploid strain. High-copy REC102 cannot suppress a null allele of REC104 (rec104-1; GALBRAITH et al. 1997 ; Figure 2).

Not all EE or ES genes can suppress conditional alleles of REC104:
Multiple genes are required for the formation of DSBs in yeast (see Introduction). We asked if HOP1, RED1, REC114, or RAD50, when present in high copy, could suppress rec104 conditional alleles. The ES genes HOP1 and RED1 were tested in light of the previous observation by HOLLINGSWORTH and JOHNSON 1993 that both REC104 and RED1 can partially suppress a hop1 ts mutant when present in high copy and because null mutations in them prevent DSBs (MAO-DRAAYER et al. 1996 ). High-copy plasmids containing HOP1, RED1, RAD50, and REC114 were transformed into LS5-1 (rec104-8 hemizygote), NW2-1 (rec104-21), NW3-1 (rec104-12), and NW4-1 (rec104-20), and these diploids were assayed for recombination at the nonpermissive temperature. The data in Figure 3 demonstrate that when in high copy, the EE and ES genes tested cannot suppress the rec104-8 ts allele. Identical results were observed for rec104-21, rec104-12, and rec104-20 (data not shown).

View larger version (34K): In this window In a new window Download PPT slide   Figure 3. Leu+ meiotic recombinants at 35°. rec104-8 is not suppressed by high-copy HOP1, RED1, REC114, or RAD50. LS5-1 diploid transformants containing YEp24 (vector), pAMG-406 (high-copy REC104), pJK22 (high-copy REC102), pCM212 (CEN-REC102), pNH83-2 (high-copy HOP1), plb-1 (high-copy RED1), pDP14.1 (high-copy REC-114), or pNK2042 (high-copy RAD50) were sporulated at 35° for 5 days and replica plated to SC-Trp. RAD50, HOP1, and RED1 are shown in A; REC114 was examined in a separate experiment shown in B.

REC102 suppression of rec104 mutants is not simple regulatory suppression:
If Rec102p regulated Rec104p, more Rec102p might result in higher expression of REC104, and hence more Rec104-8p activity. To test this possibility, we overexpressed REC104 from both an inducible promoter and from a high-copy, 2-µm-based plasmid in the absence of REC102. The results in Figure 4 show that overexpression of REC104 in the absence of REC102 does not increase recombination.

View larger version (66K): In this window In a new window Download PPT slide   Figure 4. REC102 suppression is not due to simple regulation of REC104. (A) REC104 expression is induced when present on a high-copy plasmid or a GAL-inducible plasmid. JK9-1 cells were removed from sporulation medium at different times in meiosis and expression of REC104 was analyzed by Northern analysis. Both high-copy REC104 (HCREC104) and galactose-inducible REC104 (GALREC104) display an increase in REC104 expression. (B) A rec102 strain (JK9-1) was transformed with YEp24 alone (vector), REC102 (pCM212), galactose-inducible promoter fused to REC104 (pAMG410), and 2-µm-based REC104 (pAMG406). Transformants were sporulated in the presence of galactose. Recombination is shown at the LEU1 locus after 5 days of sporulation at 30°. Both GALREC104 and HCREC104 fail to overcome the recombination defect of a rec102 strain, indicating that the role of REC102 in meiosis is more complex than regulation of REC104.

	DISCUSSION

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

Interactions between early meiotic recombination genes in yeast have been reported in both the EE and ES classes. For the ES genes, HOLLINGSWORTH and JOHNSON 1993 reported an enhancement of spore viability in hop1 mutants in the presence of high-copy RED1. More recently, a direct interaction has been demonstrated between Hop1p and Red1p using the yeast two-hybrid method (HOLLINGSWORTH and PONTE 1997 ). Although interactions have been reported among the EE gene products Rad50p, Mre11p, and Xrs2p [also required for mitotic recombination-repair (JOHZUKA and OGAWA 1995 ; DOLGANOV et al. 1996 )], similar interactions have not yet been identified between any meiosis-specific genes of the EE class.

The data presented in this article show that increased dosage of the EE gene REC102 suppresses rec104-8. Several hypotheses can be proposed to account for the observed suppression of rec104 mutations by REC102. First, REC102 could be a bypass suppressor of REC104, completely alleviating the need for Rec104p in meiosis. The inability of REC102 to suppress a deletion of REC104 rules out this possibility. A second hypothesis proposes direct interaction between Rec104p and Rec102p; increased concentrations of Rec102p would result in stabilization of mutant Rec104p. The positions of the mutations in the rec104 alleles tested are shown in Table 7. There is some clustering of mutations from amino acids 31–50 suggesting this region might be important for interactions with Rec102p. Although our two-hybrid analysis has failed to demonstrate interaction between REC102 and REC104 (data not shown), suppression of rec104 alleles by REC102 does require the presence of Rec104p in the cell.

A third hypothesis supposes that both Rec102p and Rec104p are part of a complex of proteins necessary to initiate recombination (e.g., CARPENTER 1987 ; ENGEBRECHT et al. 1990 ; XU et al. 1997 ) and does not require direct protein-protein interaction between Rec102p and Rec104p. One prediction from this "stoichiometric" model is that multiple early (EE/ES) recombination genes might be able to suppress rec104 conditional alleles when present in high copy. We found no evidence for suppression of any of four rec104 alleles by overexpression of a subset of early meiotic genes (REC114, RAD50, HOP1, and RED1), making the stoichiometric model appear less attractive. It is interesting that overexpression of HOP1 does not suppress any allele of REC104 tested because overexpression of REC104 does weakly suppress several alleles of HOP1 (HOLLINGSWORTH and JOHNSON 1993 ). Two possibilities for the failure of HOP1 to suppress rec104 alleles are that the rec104 alleles tested may confer specific alterations not suppressible by high levels of HOP1, or that the extra Hop1p produced is sequestered in a place where it is inaccessible to Rec104p (structural elements related to the SC, polycomplex bodies, etc.).

The fourth model for the observed suppression of rec104 conditional mutants by REC102 is one in which REC102 regulates (directly or indirectly) the expression of REC104. The data in Figure 4 eliminate the simple hypothesis that the only role of REC102 in meiosis is to positively regulate transcription of REC104. There remain more complex possibilities that Rec102p might regulate REC104 and at least one other EE gene, or that REC102 is required both in recombination and for regulation of REC104.

We proposed that creating a set of mutant REC104 alleles would also assist in the definition of Rec104p functional domains. NAU et al. 1997 were able to identify regions of significant conservation in Rec104p by analyzing sequences of REC104 genes from three species of Saccharomyces. A comparison of amino acid sequence in the REC104 genes of S. cerevisiae, S. paradoxus, and S. pastorianus indicates that the latter two have 79 and 63% amino acid identity to S. cerevisiae REC104, respectively (NAU et al. 1997 ). We have compared the location of mutations in our rec104 conditional alleles with the regions of conservation (Table 7). Nine of the 11 altered amino acids in the mutants analyzed occur in amino acids conserved between all three species of yeast. All three ts alleles contained mutations in conserved residues located between positions 31 and 71, suggesting that this region might be important for normal Rec104p function. The rec104-20 cs allele is a stop codon resulting in a truncated 138-amino-acid protein. The ability of a rec104-20 mutant to undergo both high levels of gene conversion and crossing over at the permissive temperature is somewhat surprising considering the loss of the highly conserved (NAU et al. 1997 ) C-terminal 45 amino acids.

At nonpermissive temperature, the rec104-8 hemizygous strain has 9.5% average spore viability (Table 3 and Table 5) despite having a 79-fold reduction in recombination (1.3% of the wild-type level; Table 5). In contrast, diploids containing the hop1::TRP1 disruption mutation have ~13% of the normal level of meiotic recombination but spore viability is <1% (FRIEDMAN et al. 1994 ; Table 8). Why is spore viability so much less in the strain with the hop1 mutation even though there is a higher level of recombination? ENGEBRECHT et al. 1990 proposed that recombination done in the context of SC results in proper chiasmata and hence proper chromosome segregation in meiosis I. In this view, even though hop1 mutants have 13% of normal meiotic recombination levels, there is no SC present and hence proper chromosome segregation does not occur and spore viability would be very low. The 9.5% spore viability in the rec104-8 mutant suggests to us that the residual recombination (1.3%) is likely to occur in a context allowing proper chromosome segregation. We note that the cs rec104-20 mutation reduces recombination to a level similar to the hemizygous rec104-8 strain (~1.3%). However, spore viability in the rec104-20 mutant is <1%, suggesting that recombination occurring at the nonpermissive temperature in rec104-20 is not capable of promoting proper chromosome segregation, and, by inference from above, that there is less SC present than in rec104-8 at nonpermissive temperature. It also raises the possibility that the C terminus of REC104 is involved in stabilization or formation of the SC, which is interesting considering the partial suppression of the hop1-628 ts allele by high-copy REC104.

	ACKNOWLEDGMENTS

Special thanks are extended to Kai Jiao for commenting on the manuscript and supplying yeast strains and plasmids. We also thank Yang Mao-Draayer, Nancy Hollingsworth, Eric Alani, Jan Fassler, and Bob Deschenes for critical reading of the manuscript. We thank Bob Deschenes for meaningful discussion. Special thanks to Nancy Hollingsworth for the high-copy HOP1 and RED1 plasmids, Eric Alani for the high-copy RAD50 plasmid, and Ed Winter for the ENO1 plasmid used as an RNA loading control. This work was supported by National Institutes of Health (NIH) grant R01-GM36846 to R.E.M. Laura Salem is supported by a Genetics Predoctoral Training Program Grant from the NIH. Natalie Walter was supported by funding from an Undergraduate Biological Science Education Howard Hughes Program.

Manuscript received August 21, 1998; Accepted for publication December 14, 1998.

	LITERATURE CITED

TOP ABSTRACT MATERIALS AND METHODS RESULTS DISCUSSION LITERATURE CITED

ALANI, E., R. PADMORE, and N. KLECKNER, 1990  Analysis of wild-type and rad50 mutants of yeast suggests an intimate relationship between meiotic chromosome synapsis and recombination. Cell 61:419-436[Medline].

BERGERAT, A., B. DE MASSY, D. GADELLE, P. C. VAROUTAS, and A. NICOLAS et al., 1997  An atypical topoisomerase II from Archaea with implications for meiotic recombination. Nature 386:414-417[Medline].

BISHOP, D. K., D. PARK, L. XU, and N. KLECKNER, 1992  DMC1: a meiosis specific yeast homolog of E. coli recA required for recombination, synaptonemal complex formation, and cell cycle progression. Cell 69:439-456[Medline].

BOEKE, J. D., F. LACROUTE, and G. R. FINK, 1984  A positive selection for mutants lacking orotidine-5'-phosphate decarboxylase activity in yeast: 5-fluoro-orotoc acid resistance. Mol. Gen. Genet. 197:345-346[Medline].

BOTSTEIN, D., S. C. FALCO, S. E. STEWART, M. BRENNAN, and S. SCHERER et al., 1979  Sterile host yeasts (SHY): a eukaryotic system of biological containment for recombinant DNA experiments. Gene 8:17-24[Medline].

BROACH, J. R., and F. C. VOLKERT, 1991 Circular DNA plasmids of yeasts, pp. 297–331 in The Molecular Biology of the Yeast Saccharomyces (Genome Dynamics, Protein Synthesis, and Energetics), edited by J. R. BROACH, J. R. PRINGLE and E. W. JONES. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

BULLARD, S. A., S. KIM, A. M. GALBRAITH, and R. E. MALONE, 1996  Double strand breaks at the HIS2 recombination hot spot in Saccharomyces cerevisiae.. Proc. Natl. Acad. Sci. USA 93:13054-13059[Abstract/Free Full Text].

CAO, L., E. ALANI, and N. KLECKNER, 1990  A pathway for generation and processing of double-strand breaks during meiotic recombination in S. cerevisiae.. Cell 61:1089-1101[Medline].

CARPENTER, A., 1975  Electron microscopy of meiosis in Drosophila melanogaster females. The recombination associated structure at pachytene? Proc. Natl. Acad. Sci. USA 72:3186-3189[Abstract/Free Full Text].

CARPENTER, A., 1987  Gene conversion, recombination nodules, and the initiation of meiotic synapsis. Bioessays 6:232-236[Medline].

COOL, M. and R. E. MALONE, 1992  Molecular and genetic analysis of the yeast early meiotic recombination genes REC102 and REC107/MER2.. Mol. Cell. Biol. 12:1248-1256[Abstract/Free Full Text].

DOLGANOV, G. M., R. S. MASER, A. NOVIKOV, L. TOSTO, and S. CHONG et al., 1996  Human Rad50 is physically associated with human Mre11: identification of a conserved multiprotein complex implicated in recombinational DNA repair. Mol. Cell. Biol. 16:4832-4841[Abstract].

ENGEBRECHT, J., J. HIRSCH, and G. S. ROEDER, 1990  Meiotic gene conversion and crossing over: their relationship to each other and to chromosome synapsis and segregation. Cell 62:927-937[Medline].

FRIEDMAN, D. B., N. M. HOLLINGSWORTH, and B. BYERS, 1994  Insertional mutations in the yeast HOP1 gene: evidence for multimeric assembly in meiosis. Genetics 136:449-464[Abstract].

GALBRAITH, A. and R. E. MALONE, 1992  Characterization of REC104, a gene required for early meiotic recombination in the yeast Saccharomyces cerevisiae.. Dev. Genet. 13:392-402[Medline].

GALBRAITH, A., S. A. BULLARD, K. JIAO, J. J. NAU, and R. E. MALONE, 1997  Recombination and the progression of meiosis in Saccharomyces cerevisiae.. Genetics 146:481-489[Abstract].

GAME, J. C., T. J. ZAMB, R. J. BRAUN, M. RESNICK, and R. M. ROTH, 1980  The role of radiation (rad) genes in meiotic recombination in yeast. Genetics 94:51-68[Abstract/Free Full Text].

HOLLINGSWORTH, N. M. and B. BYERS, 1989  HOP1: a yeast meiotic pairing gene. Genetics 121:445-462[Abstract/Free Full Text].

HOLLINGSWORTH, N. M. and A. D. JOHNSON, 1993  A conditional allele of the Saccharomyces cerevisiae HOP1 gene is suppressed by overexpression of two other meiosis-specific genes: RED1 and REC104.. Genetics 133:785-797[Abstract].

HOLLINGSWORTH, N. and L. PONTE, 1997  Genetic interactions between HOP1, RED1, and MEK1 suggest that MEK1 regulates assembly of axial element components in meiosis in the yeast Saccharomyces cerevisiae.. Genetics 147:33-42[Abstract].

HOLLINGSWORTH, N. M., L. GOETSCH, and B. BYERS, 1990  The HOP1 gene encodes a meiosis-specific component of yeast chromosomes. Cell 61:73-84[Medline].

HUGERAT, Y. and G. SIMCHEN, 1993  Mixed segregation and recombination of chromosomes and YACs during single division meiosis in spo13 strains of Saccharomyces cerevisiae.. Genetics 135:297-308[Abstract].

ITO, H., Y. FUKUDA, K. MURATA, and A. KIMURA, 1983  Transformation of intact yeast cells with alkali cations. J. Bacteriol. 153:163-168[Abstract/Free Full Text].

JOHZUKA, K. and H. OGAWA, 1995  Interaction of Mre11 and Rad50: two proteins required for DNA repair and meiosis-specific double-strand break formation in Saccharomyces cerevisiae.. Genetics 139:1521-1532[Abstract].

KEENEY, S., C. N. GIROUX, and N. KLECKNER, 1997  Meiosis-specific DNA double-strand breaks are catalyzed by Spo11, a member of a widely conserved protein family. Cell 88:375-384[Medline].

KLAPHOLZ, S. and R. E. ESPOSITO, 1980  Recombination and chromosome segregation during the single division meiosis in spo12-1 and spo13-1 diploids. Genetics 96:589-611[Abstract/Free Full Text].

MALONE, R. E., 1983  Multiple mutant analysis of recombination in yeast. Mol. Gen. Genet. 189:405-412.

MALONE, R. E. and R. E. ESPOSITO, 1981  Recombinationless meiosis in Saccharomyces cerevisiae.. Mol. Cell. Biol. 1:891-901[Abstract/Free Full Text].

MALONE, R. E., S. BULLARD, M. HERMISTON, R. RIEGER, and M. COOL et al., 1991  Isolation of mutants defective in early steps of meiotic recombination in the yeast Saccharomyces cerevisiae.. Genetics 128:79-88[Abstract].

MAO-DRAAYER, Y., A. M. GALBRAITH, D. L. PITTMAN, M. COOL, and R. E. MALONE, 1996  Analysis of meiotic recombination pathways in the yeast Saccharomyces cerevisiae.. Genetics 144:71-86[Abstract].

MUHLRAD, D., R. HUNTER, and R. PARKER, 1992  A rapid method for localized mutagenesis of yeast genes. Yeast 8:79-82[Medline].

NAIRZ, K. and F. KLEIN, 1997  mre11S—a yeast mutation that blocks double-strand-break processing and permits nonhomologous synapsis in meiosis. Genes Dev. 11:2272-2290[Abstract/Free Full Text].

NAKAGAWA, T. and H. OGAWA, 1997  Involvement of the MRE2 gene of yeast in formation of meiosis-specific double-strand breaks and crossover recombination through RNA splicing. Genes Cells 2:65-79[Abstract].

NANDABALAN, K. and G. S. ROEDER, 1995  Binding of a cell-type-specific RNA splicing factor to its target regulatory sequence. Mol. Cell. Biol. 15:1953-1960[Abstract].

NAU, J., K. R. SUMMERS, A. M. GALBRAITH, S. A. BULLARD, and R. E. MALONE, 1997  Isolation of early meiotic recombination genes analogous to S. cerevisiae REC104 from the yeasts S. paradoxus and S. pastorianus.. Curr. Genet. 31:7-14[Medline].

PETES, T. D., R. E. MALONE and L. S. SYMINGTON, 1991 Recombination in yeast, pp. 407–521 in The Molecular and Cellular Biology of the Yeast Saccharomyces (Genome Dynamics, Protein Synthesis, and Energetics), edited by J. R. BROACH, J. R. PRINGLE and E. W. JONES. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

PITTMAN, D., W. LU, and R. E. MALONE, 1993  Genetic and molecular analysis of REC114, an early meiotic recombination gene in yeast. Curr. Genet. 23:295-304[Medline].

RAYMOND, W. E. and N. KLECKNER, 1993  RAD50 protein of S. cerevisiae exhibits ATP-dependent DNA binding. Nucleic Acids Res. 21:3851-3856[Abstract/Free Full Text].

RINE, J., 1991 Gene overexpression in studies of Saccharomyces cerevisiae, pp. 239–251 in Methods in Enzymology, edited by CHRISTINE GUTHRIE and GERALD R. FINK. Academic Press, San Diego.

ROCKMILL, B. and G. S. ROEDER, 1990  Meiosis in asynaptic yeast. Genetics 126:563-574[Abstract].

ROCKMILL, B. and G. S. ROEDER, 1991  A meiosis-specific protein kinase homolog required for chromosome synapsis and recombination. Genes Dev. 5:2392-2404[Abstract/Free Full Text].

ROTHSTEIN, R., 1991  Targeting, disruption, replacement, and allele rescue: integrative DNA transformation in yeast. Methods Enzymol. 194:281-301[Medline].

SCHWACHA, A. and N. KLECKNER, 1997  Interhomolog bias during meiotic recombination: meiotic functions promote a highly differentiated interhomolog-only pathway. Cell 90:1123-1135[Medline].

SHARPLES, G. J. and D. R. LEACH, 1995  Structural and functional similarities between the SbcCD proteins of Escherichia coli and the RAD50 and MRE11 (RAD32) recombination and repair proteins of yeast. Mol. Microbiol. 17:1215-1217[Medline].

SHERMAN, F., G. R. FINK and J. B. HICKS, 1986 Methods in Yeast Genetics: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

SIKORSKI, R. S. and P. HIETER, 1989  A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.. Genetics 122:19-27[Abstract/Free Full Text].

TSCHUMPER, G. and J. CARBON, 1983  Copy number control by a yeast centromere. Gene 23:221-232[Medline].

XU, L., B. M. WEINER, and N. KLECKNER, 1997  Meiotic cells monitor the status of the interhomolog recombination complex. Genes Dev. 11:106-118[Abstract/Free Full Text].

This article has been cited by other articles:

				J. Li, G. W. Hooker, and G. S. Roeder Saccharomyces cerevisiae Mer2, Mei4 and Rec114 Form a Complex Required for Meiotic Double-Strand Break Formation Genetics, August 1, 2006; 173(4): 1969 - 1981. [Abstract] [Full Text] [PDF]

				R. E. Malone, S. J. Haring, K. E. Foreman, M. L. Pansegrau, S. M. Smith, D. R. Houdek, L. Carpp, B. Shah, and K. E. Lee The Signal from the Initiation of Meiotic Recombination to the First Division of Meiosis Eukaryot. Cell, June 1, 2004; 3(3): 598 - 609. [Abstract] [Full Text] [PDF]

				K. Jiao, L. Salem, and R. Malone Support for a Meiotic Recombination Initiation Complex: Interactions among Rec102p, Rec104p, and Spo11p Mol. Cell. Biol., August 15, 2003; 23(16): 5928 - 5938. [Abstract] [Full Text] [PDF]

				K. Kee and S. Keeney Functional Interactions Between SPO11 and REC102 During Initiation of Meiotic Recombination in Saccharomyces cerevisiae Genetics, January 1, 2002; 160(1): 111 - 122. [Abstract] [Full Text] [PDF]