- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Dohrmann, P. R.
- Articles by Sclafani, R. A.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Dohrmann, P. R.
- Articles by Sclafani, R. A.
RAD53 Regulates DBF4 Independently of Checkpoint Function in Saccharomyces cerevisiae
Paul R. Dohrmanna, Guy Oshiroa, Marianne Tecklenburga, and Robert A. Sclafaniaa Department of Biochemistry and Molecular Genetics, University of Colorado Health Sciences Center, Denver, Colorado 80262
Corresponding author: Robert A. Sclafani, Department of Biochemistry and Molecular Genetics, 4200 E. 9th Ave., Box B121, University of Colorado Health Sciences Center, Denver, CO 80262., robert.sclafani{at}uchsc.edu (E-mail)
Communicating editor: M. JOHNSTON
| ABSTRACT |
|---|
The Cdc7p and Dbf4p proteins form an active kinase complex in Saccharomyces cerevisiae that is essential for the initiation of DNA replication. A genetic screen for mutations that are lethal in combination with cdc7-1 led to the isolation of seven lsd (lethal with seven defect) complementation groups. The lsd7 complementation group contained two temperature-sensitive dbf4 alleles. The lsd1 complementation group contained a new allele of RAD53, which was designated rad53-31. RAD53 encodes an essential protein kinase that is required for the activation of DNA damage and DNA replication checkpoint pathways, and that is implicated as a positive regulator of S phase. Unlike other RAD53 alleles, we demonstrate that the rad53-31 allele retains an intact checkpoint function. Thus, the checkpoint function and the DNA replication function of RAD53 can be functionally separated. The activation of DNA replication through RAD53 most likely occurs through DBF4. Two-hybrid analysis indicates that the Rad53p protein binds to Dbf4p. Furthermore, the steady-state level of DBF4 message and Dbf4p protein is reduced in several rad53 mutant strains, indicating that RAD53 positively regulates DBF4. These results suggest that two different functions of the cell cycle, initiation of DNA replication and the checkpoint function, can be coordinately regulated through the common intermediate RAD53.
THE initiation of DNA replication is a strictly regulated process that is coupled tightly to cell cycle progression and results in the accurate duplication of the genetic material. Orderly cell cycle events ensure that the initiation of DNA replication occurs once, and only once, per cell cycle. At the same time, eukaryotic cells also have evolved mechanisms for reducing or eliminating the result of DNA damage or incomplete replication before completing other cell cycle events, such as mitosis. These surveillance mechanisms, termed checkpoints, ensure that the integrity of the genome is intact before proceeding through crucial cellular events (for reviews see ![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Isolation of mutants defective in cell cycle progression led to the identification of CDC7, a gene encoding a nuclear serine/threonine kinase that is essential for the initiation of S phase in Saccharomyces cerevisiae (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
uctuates in a cell cycle-dependent manner, peaking at the time S phase begins (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Initiation of the checkpoint program requires the activity of many different proteins. The components of the DNA damage checkpoint machinery generally fall into three classes: sensors, transducers, and targets (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
RAD53 (=MEC2, SPK1, SAD1) encodes a dual-specificity protein kinase that is required for all three DNA damage checkpoints at G1, S phase, and G2 (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
Several lines of circumstantial evidence suggest that in addition to its checkpoint function, RAD53 could also be involved in the initiation of DNA replication. First, RAD53 has been shown to be transcriptionally coregulated with DNA synthetic genes (![]()
![]()
![]()
![]()
![]()
The two different aspects of the cell cycle, initiation of DNA replication and checkpoint function, could be coordinately regulated through DNA metabolism events. As a starting point for our studies, we were interested in identifying genes that act in the same pathway or affect a similar function as CDC7. Here we report the isolation of a new allele of RAD53 in a genetic screen for mutants that are lethal in combination with cdc7-1. This allele of RAD53 retains a fully functional checkpoint. In addition, we show that Rad53p interacts with Dbf4p and controls the level of expression of DBF4. Thus, we demonstrate that the checkpoint functions and the DNA replication functions can be functionally separated in RAD53. These results suggest strongly that coordination of the two separate functions could occur through a common intermediate, namely, RAD53.
| MATERIALS AND METHODS |
|---|
Yeast strains, media, and plasmids:
Yeast strains were grown in yeast extract/peptone/dextrose (YEPD) with 2% glucose or in synthetic defined (SD) minimal media supplemented with appropriate amino acids and 2% glucose. All yeast strains used in this study are listed in Table 1. All strains are congenic with A364a, except as marked (![]()
![]()
![]()
![]()
![]()
::URA3 disruption, plasmid pBR322-pep4
::URA3 was digested with EcoRI and XhoI before transformation. The presence of pep4
::URA3 was analyzed using the APE overlay test for CpY activity (![]()
::hisG-URA3-hisG disruption, pPD84 was digested with BamHI before transformation. The presence of the rad53
::hisG-URA3-hisG disruption was analyzed by Southern blot analysis (![]()
::hisG-URA3-hisG disruption were grown on 5-fluoro-orotic medium to select for loss of the URA3 marker, resulting in a strain carrying rad53
::hisG allele.
|
All plasmids used in this study are listed in Table 2. The CDC7-ADE3 sectoring plasmids were constructed in several steps. To construct pPD4 (pRS316-CDC7-ADE3), a 2.7-kb SalI to EcoRI CDC7 fragment from pRH102 (![]()
|
The DBF4 genomic plasmids pPD32 (pRS315-DBF4) and pGO117 (pRS425-DBF4) were constructed by ligating the genomic 5-kb SalI to EcoRI DBF4 fragment from pDBF4.4 (![]()
The RAD53 genomic plasmids pPD60 (pRS316-RAD53) and pPD83 (pRS314-RAD53) were constructed by ligating the genomic 5322-bp ClaI RAD53 fragment into the ClaI sites of pRS316 and pRS314, respectively.
Plasmid pPD84 (pBS-rad53
::hisG-URA3-hisG) was created in two steps. First, the 5322-bp genomic RAD53 ClaI fragment was cloned into the ClaI site of pBS KS+ (Stratagene, La Jolla, CA), generating pPD82. This plasmid was then digested with SphI to completion and filled in with Klenow. This removes the RAD53 promoter and most of the coding region of RAD53 (nt -477 to +1887). The 3.8-kb BamHI to BglII hisG-URA3-hisG fragment from pNKY51 (![]()
::hisG-URA3-hisG).
The GAL4DB-RAD53 plasmids were constructed as follows. A 1221-bp PvuII fragment of RAD53 was first cloned into the SmaI site in frame of pY2, generating pPD93 [pGAL4DB-RAD53i (aa50aa457)]. pPD94 [pGAL4DB-RAD53 (aa50aa822)] was constructed by ligating in the 2321-bp BamHI-to-HindIII fragment of RAD53 from pPD82 into the BamHI and HindIII sites of pPD93, reconstructing the 3' end of RAD53. Plasmid pGO174 (pRS316-7HA-DBF4) was constructed in several steps. First, the genomic 5-kb SalI to HindIII DBF4 fragment from pDBF4.4 (![]()
![]()
Synthetic lethality screen:
The synthetic lethality screen was done as described previously (![]()
![]()
![]()
![]()
Determination of DNA damage-induced cell cycle delay:
For UV survival studies, cells were grown to late-logarithmic phase in liquid culture (108 cells/ml), counted, and plated at a dilution of ~500 cfu/plate. Cells were mutagenized by exposure to UV light with a 254-nm source at fluence rate of 0.7 mW/cm2, as measured with a UVP radiometer for doses of 0, 40, 60, 80, and 100 J/m2 (![]()
For hydroxyurea arrest experiments, cells were grown to midlogarithmic phase in liquid YEPD culture (107 cells/ml). A small aliquot of cells was removed from each culture as a negative control before adding hydroxyurea. Hydroxyurea was then added to a final concentration of 0.2 M, and aliquots were removed at timed intervals to determine cell number and to score for viability as colony-forming units on YEPD plates (![]()
Two-hybrid assay:
Activation domain and DNA-binding domain fusion plasmids were first transformed sequentially into strain PJ69-4a, and selection was carried out on SD-Leu-Trp plates. To assay for interaction, colonies were plated onto SD-Leu-Trp-Ade plates, and prototrophic growth was analyzed (![]()
![]()
![]()
Northern blot analysis:
A plasmid containing a 7-hemagluttin tag DBF4 gene under the control of the wild-type DBF4 promoter was transformed into wild-type, rad53-31, rad53-11, and rad53
::hisG strains for Northern, FACS, and immunoblot experiments (see below). The rad53
::hisG strain was kept alive by overexpression of RNR1 (![]()
![]()
-32P (3000 Ci/mmol; New England Nuclear, Boston, MA) from the following templates: for DBF4, a 794-bp XhoI internal fragment of DBF4; for POL1, an EcoRI 869-bp internal fragment of POL1. To detect 18s rRNA, an 18s rRNA DNA primer (5' GCTTATACTTAGACATGCAT 3'; gift from Judith Jaehning) was labeled with [
-32P]ATP (6000 Ci/mmol) and T4 polynucleotide kinase. Hybridization and subsequent washes of the Northern blots with the 18s rRNA DNA primer were carried at a temperature of 40°. Autoradiographic bands were quantitated on a Molecular Dynamics PhosphorImager using ImageQuant software.
Fluorescence-activated cell sorter (FACS) analysis:
Cells were grown in synthetic defined media at 23°, diluted to 106 cells/ml, allowed to grow to a density of 24 x 106 cells/ml (midlogarithmic phase), and then processed for FACS analysis as described previously (![]()
Immunoblot analysis:
For immunoblot analysis, cells were grown in synthetic defined media to midlogarithmic phase (2 x 106 cells/ml) and analyzed with a Coulter Multisizer II. A total of 2 x 107 cells were processed for yeast extracts. Cells were washed twice in H2O and then resuspended in 20 µl SDS sample buffer plus protease inhibitors [phenylmethyl sufonyl fluoride (Sigma), 174 ng/ml; leupeptin (Peptide Institute, Inc.), 1.3 ng/ml; and pepstatin (Boehringer Mannheim, Indianapolis, IN), 0.3 ng/ml], and then boiled immediately for 5 min. SDS-PAGE and immunoblot analysis was performed as described previously (![]()
| RESULTS |
|---|
cdc7-1 synthetic lethal screen:
A screen for mutations that are lethal in combination with cdc7-1 was conducted to identify genes that are in the same genetic pathway or that affect the same biochemical process as CDC7. The screen is based on a red/white adenine colony sectoring assay (![]()
![]()
![]()
We expected to find mutations in DBF4 on the basis of the fact that cdc7-1 mutation is known to be synthetically lethal with dbf4-1 from previous experiments (![]()
The largest complementation group (lsd6) contained 11 isolates. Two different types of experiments show that lsd6 mutants contain null or intragenic mutations in cdc7. First, it was noted that 11 diploids, which resulted from a backcross to cdc7-1 (after loss of pRS316-CDC7-ADE3-URA3 plasmid), generated two viable and two lethal spores upon tetrad dissection (data not shown). All viable spores from the crosses were TRP1, indicating linkage to CDC7 (<5 cM). Second, a plasmid bearing the cdc7-1 mutation could complement the cdc7 null mutation in the chromosome, resulting in a sectored phenotype and supporting our hypothesis. The remaining five complementation groups contained one member each.
Cloning of LSD1:
Colony sectoring was used to identify plasmids from a YCp50 yeast genomic library (American Type Culture Collection, Rockville, MD) that could complement the lsd1-1 mutation. Out of ~6900 colonies, one plasmid could complement the defect, and it was designated pPD58. A primer was then used to sequence the regions flanking the insert within the pPD58 library clone. The DNA sequence within the insert was compared to the Saccharomyces Genome Database and found to contain five contiguous open reading frames from chromosome XVI. One of these is RAD53, which was found to complement the nonsectoring defect of strain PDY207. This suggests that the lsd1-1 is an allele of RAD53. To prove this, the PEP4 gene, which is adjacent to RAD53, was disrupted with URA3 in lsd1-1. The lsd1-1 mutation always cosegregated with the pep4
::URA3 marker in subsequent crosses, indicating that the two genes are tightly linked (<2 cM, data not shown). We conclude that lsd1-1 encodes an allele of RAD53, which we have named rad53-31.
A null allele of RAD53 can be suppressed by RNR1 in high copy on plasmid pGAP-RNR1 (![]()
![]()
![]()
The DNA checkpoint is functional in a rad53-31 strain:
Many alleles of RAD53 have been isolated in different screens for mutations with a checkpoint defect (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
|
For analysis of the S phase checkpoint, survival of wild-type, rad53-11, and rad53-31 strains in the presence of 200 mM hydroxyurea was examined. Again, as expected, the rad53-11 strain demonstrated a marked decline in viability (Figure 1B). In contrast, the rad53-31 strain, like the wild-type, demonstrated no significant loss in viability when grown in the presence of hydroxyurea. We conclude that rad53-31 is still proficient in checkpoint function.
Genetic interactions among RAD53 alleles and several cell division cycle mutations:
A cdc7 rad53-11 (=mec2-1) double mutant is viable (![]()
![]()
|
The rad53-11 (=mec2-1) is synthetically lethal with cdc8-1 (![]()
![]()
We reasoned that, because rad53-31 was lethal with cdc7-1, it might also be lethal with dbf4-1 because CDC7 and DBF4 act at the same point in the pathway (![]()
The bob1-1 mutation cannot suppress a rad53
::URA3 null allele:
A recessive mutation in BOB1(MCM5/CDC46) bypasses the requirement for the essential S phase activators Cdc7p and Dbf4p at the G1/S boundary (![]()
![]()
::URA3 disruption was constructed in a heterozygous diploid strain carrying a bob1-1, analyzed by Southern blot to confirm the disruption (data not shown), allowed to sporulate, and individual spores were analyzed for viability (Table 4A). The results are complicated by the fact that strains bearing rad53
::URA3 frequently generate second site suppressors (![]()
![]()
![]()
::URA3.
|
Interaction of Rad53p and Dbf4p:
Given that RAD53 interacts genetically with CDC7 and DBF4, we asked if Rad53p could interact physically with Cdc7p and/or Dbf4p, as assayed by the two-hybrid method. The GAL4-DB-RAD53 (aa50aa822) could complement rad53
::URA3, indicating that it encodes a functional protein (data not shown). The GAL4-DB RAD53i (aa50aa457), which lacks C-terminal sequences, failed to complement the rad53
::URA3 (data not shown). The results show that Rad53p interacts weakly with Dbf4p, but not with Cdc7p (Figure 2). In addition, the Rad53p fusion construct that lacks the C-terminal sequences failed to interact with either Cdc7p or Dbf4p, suggesting that the C-terminal sequences are necessary for interaction with Dbf4p. Previously described interactions were seen between Dbf4p and Cdc7p, and between Dbf4p and Dbf4p (![]()
![]()
|
Several attempts were made to show that Dbf4p and Rad53p interact directly using other physical methods. Rad53p/Dbf4p coimmunoprecipitation and GST-Rad53p/Dbf4p interaction experiments failed to detect an interaction (data not shown). This may reflect a transient or weak interaction between Rad53p and Dbf4p that can only be detected by the sensitive two-hybrid interaction assay. Nevertheless, two independent two-hybrid assays could detect a significant interaction between Rad53p and Dbf4p.
RAD53 regulates DBF4 expression at the mRNA and protein levels:
To understand how rad53-31 manifests its synthetic lethal effect with cdc7-1, we asked whether DBF4 mRNA and/or Dbf4p protein levels were altered in various RAD53 mutants. The level of DBF4 message was significantly reduced in the rad53
::hisG strain, exhibiting about fivefold less mRNA than the wild type (Figure 3A). This was not a result of overexpression of the RNR1 gene because wild-type cells that overexpress RNR1 demonstrate no difference in DBF4 expression (data not shown). In addition, the Northern blot results demonstrated that the level of DBF4 message in the rad53-11 strain was reduced about twofold. Surprisingly, the level of DBF4 message was increased in the rad53-31 strain.
|
DBF4 is an MCB box-regulated gene that is expressed just before S phase (![]()
![]()
::hisG strain. However, the POL1 mRNA level was not significantly different between wild-type and rad53
::hisG strains (Figure 3A). We conclude that RAD53 does not universally affect MCB box-regulated genes.
We hypothesized that the elevated levels of DBF4 (and POL1) message in the rad53-31 strain could be a result of cells being shifted toward one phase of the cell cycle. To test this possibility, FACS analysis was performed on the yeast strains that were used to make the extracts (Figure 3C). Most of the rad53-31 cells were in the G2 phase of the cell cycle. It should be noted that this is the first phenotypic defect we have observed for strains that bear only the rad53-31 genotype. The level of DBF4 message was then compared between wild-type and rad53-31 mutant extracts that were prepared from cells arrested at the same stage of the cell cycle (Figure 3B). Cells were grown first to midlogarithmic phase and then arrested in G1/S in the presence of 200 mM hydroxyurea for 4 hr. DBF4 message is only moderately reduced in the rad53-31 strain (Figure 3B).
To test the level of Dbf4p protein expression in the four strains, cells carrying a plasmid with a HA-tagged DBF4 plasmid were grown to midlogarithmic phase and then harvested to prepare the cells for FACS and the extracts for immunoblot analysis (Figure 4). FACS profiles generated for the four strains were similar to those shown in Figure 3. Immunoblots were then probed with antibodies against 7HA-DBF4p and G6PDp. Dbf4p was undetectable in the rad53
::hisG strain, indicating that RAD53 positively regulates Dbf4p. Longer exposures revealed a very low level of Dbf4p expression in the rad53
::hisG strain (data not shown). The level of Dbf4p protein expression in the rad53-31 and rad53-11 strains was similar to that seen for mRNA expression. Dbf4p protein levels were reduced in the rad53-11 strain, whereas they were slightly increased in the rad53-31 strain. We conclude from these experiments that DBF4 is regulated in a RAD53-dependent manner at both the mRNA and protein levels.
|
| DISCUSSION |
|---|
The activation of DNA repair mechanisms and simultaneous activation of cell cycle arrest by DNA damage checkpoints results in minimizing the effects of DNA damage to eukaryotic cells. Failure of the cellular restraints imposed normally by a checkpoint can result in increased mutation rates, genomic instability, and ultimately death if cells continue to divide unchecked. It is perhaps not so surprising that the signals involved in eukaryotic DNA checkpoint control could be integrated with other DNA replication functions. It has been suggested that the RAD53 gene, which is involved in the DNA checkpoint, encodes a signal-transducing kinase that could integrate several of these functions (![]()
![]()
It has been postulated that RAD53 encodes dual functions, including positive regulation of replication and negative regulation of cell cycle progression (![]()
To this point, the evidence is circumstantial regarding the role of RAD53 in the control of DNA replication. Several lines of evidence suggest that RAD53 is associated with DNA replication: transcriptional coregulation with other DNA synthetic enzymes, the terminal arrest phenotype or rad53
null mutants, the nuclear localization of Rad53p, and the essential function of RAD53 (![]()
![]()
The experiments performed here provided the strongest evidence yet that there is a direct requirement for RAD53 in the initiation of DNA replication. Our results indicate that the checkpoint function of the rad53-31 allele remains intact. At the same time, the rad53-31 allele is lethal in combination with cdc7-1, a gene that is intimately related to the initiation of DNA synthesis. Indeed, it appears that the checkpoint and replication functions of RAD53 can be separated. This effect can only be seen in combination with cdc7-1 because mutations that completely knock out the replication function of RAD53 presumably also knock out the checkpoint function and perhaps the essential function of RAD53. Similarly, a synthetic growth defect was seen by rad53-31 in combination with dbf4-1. The RAD53 synthetic defects seen in combination with both CDC7 and DBF4 imply that RAD53 affects a similar biochemical process or a similar function as CDC7 and DBF4. Another possibility is that RAD53 acts in the same genetic pathway as CDC7 and DBF4. The allele specificity seen with rad53-11 and different cdc7 alleles illustrates the fact that a certain level of Cdc7p kinase activity is required in combination with rad53-11, or the cells become inviable. As measured originally through segregation lag experiments, a hierarchy of function of cdc7 mutants at permissive temperature was determined (![]()
![]()
![]()
![]()
The predominant G2 population seen in the rad53-31 mutant via FACS analysis could also be a consequence of the rad53-31 allele generating a weak but constitutive checkpoint signal. Perhaps the synthetic lethality seen with the cdc7-1 rad53-31 double mutant is a combination of reduced activity of the cdc7-1 gene product and a dominant but weak checkpoint signal from rad53-31.
Given the fact that the bob1-1 mutation can bypass the requirement for CDC7 and DBF4 (![]()
![]()
::URA3? It is probable that bob1-1 cannot bypass the checkpoint function absent in rad53
::URA3 because it is required for integrating the G1, S, and G2 checkpoints. Perhaps the cell cannot survive without all three functions. Alternatively, RAD53 may be required for other essential functions, such as expression of RNR1 (![]()
The two lines of evidence presented here also illustrate that RAD53 exerts its positive control through DBF4. First, two-hybrid studies suggest that Rad53p may interact directly through Dbf4p. Second, RAD53 regulates the expression of DBF4 at the message and protein levels. The DBF4 message is reduced fivefold, and the levels of Dbf4p protein are virtually undetectable in a rad53
::hisG strain. This indicates that RAD53 regulates DBF4 positively. At this point, we do not have an explanation for why either DBF4 message or Dbf4p protein is slightly increased in the rad53-31 strain. Could a quantitative difference in the Dbf4p protein be responsible for generating the synthetic lethal defect of a rad53-31 cdc7-1 strain? We know that lowering the level of DBF4 message twofold in a cdc7-1 background is still viable (P. DOHRMANN, unpublished results). This suggests that the reason rad53-31 is lethal with cdc7-1 is not quantitative because the level of DBF4 message seen in a rad53-31 strain is 80% of wild type (Figure 3B). Therefore, it follows that RAD53 must regulate some qualitative difference in Dbf4p protein.
We would hypothesize that perhaps Rad53p binds to and modifies Dbf4p protein. The qualitative difference in Dbf4p activity would be partly responsible for the activation of the DNA replication initiation program. In addition, the activation of DBF4 transcription and/or degradation of DBF4 message through RAD53 could be through a positive feedback loop based on the level of activity of the Dbf4p protein. This would explain reasonably why the DBF4 message and protein levels in rad53-31 mutants are not affected severely. At the same time, in rad53
::hisG mutants, Rad53p is unavailable to modify Dbf4p, and as a consequence, DBF4 message and Dbf4p protein rapidly disappear.
With the dramatic reduction of Dbf4p protein, the cells are still viable in the rad53
::hisG strain. Perhaps the essential role of RAD53 is to regulate the expression of RNR1 because high-copy expression of RNR1 can bypass the rad53
::hisG defect. At the same time, RAD53 may also regulate DBF4 levels to ensure rapid S phase entry through this positive feedback loop. Future experiments will address whether Cdc7p kinase activities are altered in various RAD53 mutant strains. This may help elucidate the role of RAD53 in controlling Dbf4p activity.
In conclusion, we have demonstrated that the multiple functions of RAD53 can be separated. These results suggest strongly that RAD53 is a common intermediate between a checkpoint and DNA replication function.
| ACKNOWLEDGMENTS |
|---|
We thank Ted Weinert, Chris Hardy, David Stillman, Judith Jaehning, and Bik Tye for plasmids and/or strains. We thank the University of Colorado Cancer Center Core Facility for performing the FACS analysis. The DNA samples were sequenced by the University of Colorado Cancer Center DNA Sequencing and Analysis Core Facility, which is supported by the National Institutes of Health/National Cancer Institute Cancer Core Support Grant (CA46934). We also thank Judith Jaehning and David Bentley for critically reading the manuscript. This work was supported by U.S. Public Health Service grant GM35078 awarded to R.A.S.
Manuscript received September 11, 1998; Accepted for publication November 24, 1998.
| LITERATURE CITED |
|---|
ABOUSSEKHRA, A., J. E. VIALARD, D. E. MORRISON, M. A. DE LA TORRE-RUIZ, and L. CERNAKOVA et al., 1996 A novel role for the budding yeast RAD9 checkpoint gene in DNA damage-dependent transcription. EMBO J. 15:3912-3922[Medline].
ALANI, E., L. CAO, and N. KLECKNER, 1987 A method for gene disruption that allows repeated use of URA3 selection in the construction of multiply disrupted yeast strains. Genetics 116:541-545
ALLEN, J. B., Z. ZHOU, W. SIEDE, E. C. FRIEDBERG, and S. J. ELLEDGE, 1994 The SAD1/RAD53 protein kinase controls multiple checkpoints and DNA damage-induced transcription in yeast. Genes Dev. 8:2401-2415
ARAKI, H., S. H. LEEM, A. PHONGDARA, and A. SUGINO, 1995 Dpb11, which interacts with DNA polymerase II(epsilon) in Saccharomyces cerevisiae, has a dual role in S-phase progression and at a cell cycle checkpoint. Proc. Natl. Acad. Sci. USA 92:11791-11795
AUSUBEL, F. M., R. BRENT, D. E. KINGSTON, D. E. MOORE, J. G. SEIDMAN et al. (Editors), 1987 Current Protocols in Molecular Biology. John Wiley & Sons, New York.
BAHMAN, M., V. BUCK, A. WHITE, and J. ROSAMOND, 1988 Characterisation of the CDC7 gene product of Saccharomyces cerevisiae as a protein kinase needed for the initiation of mitotic DNA synthesis. Biochim. Biophys. Acta 951:335-343[Medline].
BENDER, A. and J. R. PRINGLE, 1991 Use of a screen for synthetic lethal and multicopy suppressee mutants to identify two new genes involved in morphogenesis in Saccharomyces cerevisiae.. Mol. Cell. Biol. 11:1295-1305
BOUSSET, K. and J. F. DIFFLEY, 1998 The Cdc7 protein kinase is required for origin firing during S phase. Genes Dev. 12:480-490
BUCK, V., A. WHITE, and J. ROSAMOND, 1991 CDC7 protein kinase activity is required for mitosis and meiosis in Saccharomyces cerevisiae.. Mol. Gen. Genet. 227:452-457[Medline].
CHAPMAN, J. W. and L. H. JOHNSTON, 1989 The yeast gene, DBF4, essential for entry into S phase is cell cycle regulated. Exp. Cell Res. 180:419-428[Medline].
CHIEN, C. T., P. L. BARTEL, R. STERNGLANZ, and S. FIELDS, 1991 The two-hybrid system: a method to identify and clone genes for proteins that interact with a protein of interest. Proc. Natl. Acad. Sci. USA 88:9578-9582
DE LA TORRE-RUIZ, M. A., C. M. GREEN, and N. F. LOWNDES, 1998 RAD9 and RAD24 define two additive, interacting branches of the DNA damage checkpoint pathway in budding yeast normally required for Rad53 modification and activation. EMBO J. 17:2687-2698[Medline].
DESANY, B. A., A. A. ALCASABAS, J. B. BACHANT, and S. J. ELLEDGE, 1998 Recovery from DNA replicational stress is the essential function of the S-phase checkpoint pathway. Genes Dev. 12:2956-2970
DOHRMANN, P. R., G. BUTLER, K. TAMAI, S. DORLAND, and J. R. GREENE et al., 1992 Parallel pathways of gene regulation: homologous regulators SWI5 and ACE2 differentially control transcription of HO and chitinase. Genes Dev. 6:93-104
DONALDSON, A. D., W. L. FANGMAN, and B. J. BREWER, 1998 Cdc7 is required throughout the yeast S phase to activate replication origins. Genes Dev. 12:491-501
DOWELL, S. J., P. ROMANOWSKI, and J. F. DIFFLEY, 1994 Interaction of Dbf4, the Cdc7 protein kinase regulatory subunit, with yeast replication origins in vivo. Science 265:1243-1246
FAY, D. S., Z. SUN, and D. F. STERN, 1997 Mutations in SPK1/RAD53 that specifically abolish checkpoint but not growth-related functions. Curr. Genet. 31:97-105[Medline].
HARDY, C. F., 1996 Characterization of an essential Orc2p-associated factor that plays a role in DNA replication. Mol. Cell. Biol. 16:1832-1841[Abstract].
HARDY, C. F. and A. PAUTZ, 1996 A novel role for Cdc5p in DNA replication. Mol. Cell. Biol. 16:6775-6782[Abstract].
HARDY, C. F., O. DRYGA, S. SEEMATTER, P. M. PAHL, and R. A. SCLAFANI, 1997 mcm5/cdc46-bob1 bypasses the requirement for the S phase activator Cdc7p. Proc. Natl. Acad. Sci. USA 94:3151-3155
HARTWELL, L. H., 1967 Macromolecule synthesis in temperature-sensitive mutants of yeast. J. Bacteriol. 93:1662-1670
HARTWELL, L. H., 1973 Three additional genes required for deoxyribonucleic acid synthesis in Saccharomyces cerevisiae.. J. Bacteriol. 115:966-974
HARTWELL, L. H. and T. A. WEINERT, 1989 Checkpoints: controls that ensure the order of cell cycle events. Science 246:629-634
HOLLINGSWORTH, R. E., JR. and R. A. SCLAFANI, 1990 DNA metabolism gene CDC7 from yeast encodes a serine (threonine) protein kinase. Proc. Natl. Acad. Sci. USA 87:6272-6276
HOLLINGSWORTH, R. E., JR., R. M. OSTROFF, M. B. KLEIN, L. A. NISWANDER, and R. A. SCLAFANI, 1992 Molecular genetic studies of the Cdc7 protein kinase and induced mutagenesis in yeast. Genetics 132:53-62[Abstract].
ITO, H., Y. FUKUDA, K. MURATA, and A. KIMURA, 1983 Transformation of intact yeast cells treated with alkali cations. J. Bacteriol. 153:163-168
JACKSON, A. L., P. M. PAHL, K. HARRISON, J. ROSAMOND, and R. A. SCLAFANI, 1993 Cell cycle regulation of the yeast Cdc7 protein kinase by association with the Dbf4 protein. Mol. Cell. Biol. 13:2899-2908
JAMES, P., J. HALLADAY, and E. A. CRAIG, 1996 Genomic libraries and a host strain designed for highly efficient two-hybrid selection in yeast. Genetics 144:1425-1436[Abstract].
JONES, E. W., 1991 Tackling the protease problem in Saccharomyces cerevisiae, pp. 428453 in Guide to Yeast Genetics and Molecular Biology (Methods in Enzymology), edited by C. GUTHRIE and G. R. FINK. Academic Press, San Diego.
KIM, S. and T. A. WEINERT, 1997 Characterization of the checkpoint gene RAD53/MEC2 in Saccharomyces cerevisiae.. Yeast 13:735-745[Medline].
KISER, G. L. and T. A. WEINERT, 1996 Distinct roles of yeast MEC and RAD checkpoint genes in transcriptional induction after DNA damage and implications for function. Mol. Biol. Cell. 7:703-718[Abstract].
KITADA, K., L. H. JOHNSTON, T. SUGINO, and A. SUGINO, 1992 Temperature-sensitive cdc7 mutations of Saccharomyces cerevisiae are suppressed by the DBF4 gene, which is required for the G1/S cell cycle transition. Genetics 131:21-29[Abstract].
KRANZ, J. E. and C. HOLM, 1990 Cloning by function: an alternative approach for identifying yeast homologs of genes from other organisms. Proc. Natl. Acad. Sci. USA 87:6629-6633
LEI, M., Y. KAWASAKI, M. R. YOUNG, M. KIHARA, and A. SUGINO et al., 1997 Mcm2 is a target of regulation by Cdc7-Dbf4 during the initiation of DNA synthesis. Genes Dev. 11:3365-3374
LOO, S., C. A. FOX, J. RINE, R. KOBAYASHI, and B. STILLMAN et al., 1995 The origin recognition complex in silencing, cell cycle progression, and DNA replication. Mol. Biol. Cell 6:741-756[Abstract].
LOWNDES, N. F., A. L. JOHNSON, L. BREEDEN, and L. H. JOHNSTON, 1992 SWI6 protein is required for transcription of the periodically expressed DNA synthesis genes in budding yeast. Nature 357:505-508[Medline].
LYDALL, D. and T. WEINERT, 1995 Yeast checkpoint genes in DNA damage processing: implications for repair and arrest. Science 270:1488-1491
NASH, R., G. TOKIWA, S. ANAND, K. ERICKSON, and A. B. FUTCHER, 1988 The WHI1+ gene of Saccharomyces cerevisiae tethers cell division to cell size and is a cyclin homolog. EMBO J. 7:4335-4346[Medline].
NAVAS, T. A., Z. ZHOU, and S. J. ELLEDGE, 1995 DNA polymerase epsilon links the DNA replication machinery to the S phase checkpoint. Cell 80:29-39[Medline].
NAVAS, T. A., Y. SANCHEZ, and S. J. ELLEDGE, 1996 RAD9 and DNA polymerase epsilon form parallel sensory branches for transducing the DNA damage checkpoint signal in Saccharomyces cerevisiae.. Genes Dev. 10:2632-2643
OSTROFF, R. M. and R. A. SCLAFANI, 1995 Cell cycle regulation of induced mutagenesis in yeast. Mutat. Res. 329:143-152[Medline].
PAULOVICH, A. G., R. U. MARGULIES, B. M. GARVIK, and L. H. HARTWELL, 1997 RAD9, RAD17, and RAD24 are required for S phase regulation in Saccharomyces cerevisiae in response to DNA damage. Genetics 145:45-62[Abstract].
ROTHSTEIN, R. J., 1983 One-step gene disruption in yeast. Methods Enzymol. 101:202-211[Medline].
SADOWSKI, I., B. BELL, P. BROAD, and M. HOLLIS, 1992 GAL4 fusion vectors for expression in yeast or mammalian cells. Gene 118:137-141[Medline].
SANCHEZ, Y., B. A. DESANY, W. J. JONES, Q. LIU, and B. WANG et al., 1996 Regulation of RAD53 by the ATM-like kinases MEC1 and TEL1 in yeast cell cycle checkpoint pathways. Science 271:357-360[Abstract].




