- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Skipper, M.
- Articles by Hodgkin, J.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Skipper, M.
- Articles by Hodgkin, J.
Genetic and Molecular Analysis of fox-1, a Numerator Element Involved in Caenorhabditis elegans Primary Sex Determination
Magdalena Skippera, Catherine A. Milnea, and Jonathan Hodgkinaa Medical Research Council Laboratory of Molecular Biology, Cambridge, CB2 2QH, England
Corresponding author: Jonathan Hodgkin, MRC Laboratory of Molecular Biology, Hills Rd., Cambridge, CB2 2QH, England., jah{at}mrc-lmb.cam.ac.uk (E-mail)
Communicating editor: R. K. HERMAN
| ABSTRACT |
|---|
fox-1 was previously identified as a candidate numerator element based on its overexpression phenotype. FOX-1 is an RRM-type RNA-binding protein, which can bind RNAs in vitro. Western analysis detects FOX-1 throughout development. fox-1::lacZ comes on ubiquitously early during embryogenesis. Postembryonically, fox-1::lacZ is expressed sex specifically in a subset of cells in the head and tail. We describe a Tc1-derived deletion allele [fox-1(
)] that removes the RRM domain. fox-1(
) confers no phenotype in XXs, but can rescue XO-specific lethality and feminization caused by duplications of the left end of the X. fox-1(
) synergizes with putative numerators, resulting in abnormal XX development. Genetic analysis indicated that fox-1(
) leads to a slight increase in xol-1 activity, while fox-1(gf) leads to partial loss of xol-1 activity, and xol-1 is epistatic to fox-1. RNase protection experiments revealed increased levels of the 2.2-kb xol-1 message in fox-1(
) animals, and reduced levels in fox-1(gf) animals. Additionally, fox-1(
) impairs male mating efficiency, which, we propose, represents another function of fox-1, independent of xol-1 and its role in sex determination.
THE first step toward sex determination in Caenorhabditis elegans involves evaluating the ratio of the number of X chromosomes to the number of sets of autosomes (the X:A ratio) (![]()
To control sexual phenotype, the X:A primary signal is transduced through a cascade of negatively regulated genes, which are either in high or low activity states in XX or XO animals (for review see ![]()
![]()
![]()
![]()
|
In addition, the X:A ratio controls dosage compensation: this is a process whereby the expression of the two hermaphrodite Xs is equalized to the level of one male X. In C. elegans, dosage compensation and sex determination are coordinately controlled by four early genes: xol-1 and sdc-1, sdc-2, and sdc-3. The sdc genes, together with products of several other genes, achieve dosage compensation by downregulating transcription of the two hermaphrodite Xs (for review see ![]()
Although much has been learned about many individual components involved in C. elegans sex determination, until recently little was known about the nature of the very first step, the X:A primary signal. Early observations indicated that the primary signal is not equivalent to the absolute number of X chromosomes, but rather to the X:A ratio (![]()
![]()
![]()
![]()
Identification of the first candidate numerator locus, feminizing on X (fox), was described by ![]()
The left end of the X, corresponding to eDp26, was also analyzed in detail by ![]()
![]()
![]()
The analysis of numerator function can be approached from two different angles. One can analyze the numerator dosage effects on sex determination and dosage compensation. An alternative approach involves the predicted downstream target of the primary signal, xol-1 (![]()
![]()
![]()
![]()
![]()
![]()
We present here a genetic and molecular analysis of fox-1. We investigated fox-1 expression using Western analysis and lacZ reporter transgenes and examined the ability of FOX-1 to bind RNA in vitro. The effects of fox-1 overexpression in XO animals have been partly described elsewhere (![]()
| MATERIALS AND METHODS |
|---|
General genetic methods, genes, alleles, and strains used:
Worms were cultured under standard conditions at 20° (![]()
![]()
). The following strains and mutations were used: N2 Bristol strain, MT3126 (mut-2), CB4852, CB4932, RC301, KR314, CB4855, CB4858, CB4857, CB4854, CB4856, AB1, and AB3 (![]()
Detection of Tc1 insertions:
All procedures were performed as described in ![]()
- Tc1 specific:
- right 1 (GCTGATCGACTCGATGCCACGTCG)
- right 2 (GATTTTGTGAACACTGTGGTGAAG)
- left 1 (TGTTCGAAGCCAGCTACAATGGC)
- left 2 (TCAAGTCAAATGGATGGATGCTTGAG).
- fox-1-specific primers:
- JDZ8 (GCGACCAAGAAGAGATTGT)
- MSE (GAAGTTGTGCCAGCGGATTGCC).
Once the positive address was identified, a corresponding pool of worms was thawed and worms were singled and allowed to lay eggs. PCR was then performed on the mothers to identify individuals carrying the insertion. Single-worm PCR was performed as described in ![]()
Detection and isolation of a deletion mutant:
Screening for Tc1-derived deletions was done as described in ![]()
- SKIP2 (TTCGACGAATGGCTCGGCGGC)
- SKIP3 (AGCCCGATCCCAGCACTAG)
- SKIP7 (GCATTCTTGCTCATTCACCAC)
- SKIP8 (CAAAACATGTTAAGAAATCATTC).
All PCR reactions were done in duplicate. Once a positive was found, the remaining half of the culture was divided into eight subcultures, and the procedure was repeated. The culture was abandoned unless at least four out of eight subcultures were positive following the next round of selection. The deletion mutant was outcrossed six times in the first instance, using an unc-2 marked strain, before any further genetic analysis.
Sequencing:
PCR deletion products were gel purified and subcloned into a modified pBluescript II SK+ Phagemid vector (Stratagene, La Jolla, CA). The vector had been digested with EcoRV (Biolabs, Inc.) restriction endonuclease; poly(Ts) [Pharmacia (Piscataway, NJ) dTTPs] were transferred onto blunt ends by incubating the cleaved vector in the presence of dTTPs, Taq polymerase buffer, and Taq Polymerase (Promega, Madison, WI) for 1 hr at 72°. The inserts were sequenced by the dideoxy chain termination method (![]()
Construction of fox-1(gf) strains:
Transgenic lines containing extrachromosomal copies of RO4B3, a cosmid containing the fox-1 genomic region and a rol-6 marker plasmid were subjected to X-ray mutagenesis to integrate the cosmid arrays. A total of 50 young adult hermaphrodites from each strain were irradiated with a dose of 3500 rads (dose rate 1.35 rad/sec) using a Torrex 150 X-ray machine. F1 hermaphrodites were transferred singly to fresh plates and allowed to self; their broods were examined for 100% rolling progeny. Three independent integrated lines were obtained: eIs25(V), eIs26(IV), and eIs27(V). They were mapped using standard marked strains (data not shown).
Construction of double mutants:
Where possible, double mutants were obtained by using fox-1(
) XO males. In all genetic experiments involving fox-1(
) its presence was confirmed by single-worm PCR. fox-1(gf) was tracked by rol-6 marker. A fox-1(
); tra-2(q276) strain was constructed by mating q276 XX males with fox-1(
) hermaphrodites and double mutants were isolated from the F2 generation. fox-1(
) xol-1; tra-2(e1095sd) triple mutant was made by mating xol-1; tra-2 XX males with fox-1(
) unc-18 hermaphrodites. Non-Unc F2 hermaphrodites were isolated and selfed. The mothers were tested for the presence of the deletion by PCR, and their broods were examined for the presence of XX males. fox-1(
); tra-3 and fox-1(gf); tra-3 were constructed by mating tra-3 XO males with fox-1(
) and fox-1(gf) hermaphrodites, respectively. F3 cross-progeny were picked individually and allowed to self. fox-1(
); tra-3 and fox-1(gf); tra-3 daughters of tra-3 homozygous mothers give entirely masculinized broods. dpy-3 fox-1(
); yDp13 XO males were obtained as the non-dumpy F1 male cross-progeny from mating meDf6; yDp13 males with dpy-3 fox-1(
) hermaphrodites. fox-1(
) was crossed into 11 different wild-type strains by mating fox-1(
) XO males with wild-type hermaphrodites from the strain of interest. F1 cross-progeny were transferred singly to fresh plates and allowed to self. The presence of fox-1(
) was confirmed by PCR. The F2 broods from these animals were examined for any signs of masculinization. fox-1(gf); tra-2(q276) was made by mating q276 XX males with fox-1(gf) hermaphrodites; double mutants were recovered from the F2 generation. fox-1(gf); tra-2(e1095sd) and fox-1(gf); tra-1(e1076) were made by mating XO males heterozygous for tra-2 or tra-1 with fox-1(gf) hermaphrodites. Double mutant cross-progeny were identified from the F2 generation. fox-1(gf); tra-1(e1099) was isolated following a cross between e1099 XX males and fox-1(gf) hermaphrodites. fox-1(gf); her-1(y101sd) was made from a cross between y101sd XO males and fox-1(gf) hermaphrodites.
Outcrossing of the deletion:
dpy-3 unc-2 hermaphrodites were crossed with fox-1(
) XO males to construct dpy-3 fox-1(
) and fox-1(
) unc-2 strains. dpy-3 fox-1(
) XO males were mated with fox-1(
) unc-2 hermaphrodites to construct dpy-3 fox-1(
) unc-2. dpy-3 fox-1(
) unc-2 hermaphrodites were crossed with N2 males to break up the triple mutant and recover dpy-3 fox-1(
) and fox-1(
) unc-2, now outcrossed on the right and left of the fox-1 locus, respectively. fox-1(
) unc-2 hermaphrodites obtained in this way were mated with tra-2(q276) XX males to construct a fox-1(
) unc-2; tra-2(q276)/+ strain. fox-1(
) dpy-3; tra-2(q276) was constructed in an analogous way. dpy-3; tra-2(q276) XX males were mated with fox-1(
) unc-2; tra-2(q276)/+ hermaphrodites. F1 dpy-3/fox-1(
) unc-2; tra-2(q276) XX males were mated with dpy-3 unc-2 hermaphrodites. Rare non-Dpy and non-Unc F1 hermaphrodites were isolated. They must have been of one of the following genotypes: fox-1(
)/dpy-3 unc-2; tra-2(q276)/+ or +/dpy-3 unc-2; tra-2(q276)/+. Animals of the former type were identified by PCR and selfed for succeeding generations until no Dpy, Uncs, or males were segregated.
Mating efficiency tests:
Single L4 males were mated at 20° with four young fem-1(hc17ts) females (raised at 25°) until the females laid no more eggs. Fertilized females were transferred daily onto fresh plates, and their progeny were counted.
Expression analysis:
Two fox-1::lacZ reporter constructs were made and their expression was analyzed in vivo. Both constructs are translational fusions that include the first 800 bp of fox-1 genomic sequence. CB#1505 was made by subcloning an EcoRI-PstI 5.5-kb fragment into the pPD89.20 lacZ vector; CB#1504 was made by subcloning a XhoI-PstI 4-kb fragment into the pPD89.20 lacZ vector. The plasmids were coinjected with a pRF4, a rol-6 marker plasmid, at a concentration of 50 µg/µl each, into young N2 hermaphrodites as described in ![]()
![]()
RNase protection assay (RPA):
Total RNA was isolated from embryos of fox-1(gf); him-8, xol-1; him-8, fox-1(
); him-8, and him-8 strains using Trizol Reagent (GIBCO BRL, Gaithersburg, MD). The embryos were obtained from worm cultures grown on 9-cm plates (![]()
![]()
In vitro RNA binding assays:
To create the fox-1 expression vector pT7TSCB, an EcoRI to NdeI fragment from CBH4E1 (![]()
![]()
![]()
Western blot analysis:
Mixed-stage populations of worms were collected in 1.5 ml of M9 buffer from a 4.5-cm plate that was just clearing and spun in a 2-ml tube at 6500 rpm for 2 min. Pelleted worms were washed once in M9 buffer and then resuspended in 150 µl of SDS sample buffer. The worms were boiled for 10 min and then loaded immediately onto a 10% SDS-polyacrylamide gel. The protein was transferred from the gel to Protran nitrocellulose membrane (Schleicher & Schuell, Keene, NH) using a standard Western blotting procedure (![]()
For staged Westerns large populations of gravid adults from liquid culture were bleached to release embryos that were then allowed to hatch overnight in M9 buffer as described in ![]()
Pure populations of males were generated as in ![]()
Construction of the fox-1 genomic construct expressing only the second exon start:
A 16-kb KpnI-StuI genomic fragment containing fox-1 and its 5' and 3' flanking regions was subcloned from cosmid R04B3 into pBluescriptII KS- to create pCMFG1. Deletion of the fox-1 genomic coding sequence within exon 1 was achieved by PCR using the overlap extension procedure described by ![]()
![]()
![]()
.
pCMFGex
was used to transform C. elegans homozygous for the fox-1 deletion. pCMFG1 was also transformed into the fox-1 deletion strain.
| RESULTS |
|---|
Analysis of fox-1 gene products:
Sequencing of the complete fox-1 genomic region by the sequencing consortium predicts a gene spanning 5 kb and containing six putative exons. The open reading frame (ORF) created by joining all six of these exons would contain 1368 bp and produce a protein of 454 amino acids. The RNA-binding motif is split between exons 5 and 6 (Figure 2).
|
The cDNA initially identified by ![]()
![]()
To investigate the fox-1 products at the protein level, polyclonal antibodies were raised in rabbits against the 415-amino-acid FOX-1 protein. The resulting affinity-purified antisera recognized FOX-1-specific bands. Western blots of extracts from mixed-stage populations of a wild-type strain, a fox-1 deletion strain (see below), and a fox-1 overexpressing strain were probed with the affinity-purified antibody. Proteins detected in extracts from the wild-type N2 strain are clearly absent in the fox-1 deletion strain (Figure 2). Four fox-1-specific products can be seen in the wild-type extract. They run at apparent molecular weights of 44,000, 45,000, 49,000, and 50,000. The expected sizes of the proteins arising from the two alternatively spliced fox-1 transcripts are 44,300 and 49,450 D. The antibody also detects a 27,000-D band in the extract from the deletion strain. This corresponds to the size predicted for the remainder of the coding region in the fox-1 deletion mutant and indicates that the truncated fragment is expressed. This fragment does not contain the RNA-binding motif (see below).
To determine which of the two different transcripts might be responsible for the four fox-1-specific products observed, we generated a genomic fox-1 clone that is deleted for the coding region of the first exon (Figure 2). This construct was transformed into fox-1 deletion animals so that, when expressed, it would provide the shorter transcript as the only available form of FOX-1. A wild-type version of the fox-1 genomic region was also transformed into the fox-1 deletion strain for comparison. The results of this experiment show that the transcript beginning with the coding region of the second exon provides the two smaller fox-1 products at 44 and 45 kD but not the 49- and 50-kD forms (Figure 2).
FOX-1 binds RNA with some sequence preference:
Both transcripts of the fox-1 gene encode proteins with a centrally located RRM-type RNA-binding motif. The presence of this well-studied motif suggests that FOX-1 may bind RNA as part of its role as a numerator element. To determine if FOX-1 is capable of binding RNA we used in vitro-synthesized FOX-1 protein for in vitro RNA-binding experiments. 35S-labeled in vitro transcribed and translated FOX-1 was mixed with Sepharose-bound poly(A), poly(G), poly(C), or poly(U) ribonucleotide. The results of this experiment indicate that FOX-1 is capable of binding RNA and shows some sequence preference (Figure 3). FOX-1 binds poly(A), poly(G), and poly(U) RNA to some degree and may show some preference for poly(A) RNA. Luciferase, a non-RNA-binding protein used as a control, does not bind any of the polyribonucleotides in similar experiments.
|
fox-1 has a ubiquitous early embryonic expression that gives way to a more restricted postembryonic expression pattern:
We examined fox-1 expression by means of Western blot analysis and fox-1::lacZ reporter constructs expression in vivo. After embryogenesis, C. elegans goes through four larval stages before reaching adulthood. Extracts collected from individual stages of development were probed on a Western blot with the FOX-1 antibody to determine the protein expression profile throughout the life of the animal. FOX-1 can be detected at some level throughout all stages of development (Figure 4). The predominant form of the protein observed in embryos is the 45,000-D protein. All of the larval stages appear to have all four forms present, as does the adult. All forms are also present in a pure population of adult male animals.
|
lacZ driven from the fox-1 promoter is ubiquitously expressed in the embryo from at least the 1820 cell stage up to the threefold stage (data not shown). The expression of transgenes becomes much more restricted in postembryonic life (Figure 4). The staining can only be detected in a small subset of cells in the head and the tail of both hermaphrodites and males, although the expression pattern differs between the sexes. We suggest that postembryonic fox-1 expression is limited to a small subset of neurons within the soma. Since lacZ transgenes are not normally expressed in the germline we cannot assess expression there.
Construction of fox-1(gf):
To achieve stable overexpression of fox-1, extrachromosomal arrays of RO4B3 and pRF4 were integrated into the chromosomes and mapped (data not shown). Dot blot analysis of the three integrated lines and a wild-type strain, followed by a quantitation of the hybridization signal, allows one to estimate the number of extra copies of fox-1. Because the arrays have likely undergone rearrangements and recombination, the estimate corresponds to the maximum number of copies present. The strain selected for all subsequent analysis (eIs26) was estimated to contain 42 extra copies of fox-1.
Isolation of Tc1 insertions:
A Tc1 transposable element insertion in fox-1 was obtained from the insertion library generated by ![]()
|
No phenotype was detected in the XX or XO worms for either of the insertion mutants. This is not unexpected because both insertions are within introns and are most likely removed in hnRNA processing. Cases of efficient Tc1 removal from both introns and exons, resulting in a wild-type phenotype, have been reported previously (for review see ![]()
Isolation of the deletion:
IS2 was chosen for further deletion screens for reasons of its genomic location and the higher somatic excision activity. A deletion mutant was isolated following a screen of at least 7000 initial polyclonal worm cultures. The choice of primers biased the screen toward a recovery of one-sided deletions, where the left end of Tc1 excised more or less precisely and the right end imprecisely (see Figure 5). The recovered transposon-mediated deletion removes ~1.2 kb of fox-1 genomic sequence at the 3' end of the ORF. Significantly, it completely removes the RRM domain, the only functional domain predicted at the sequence level. Despite this, no obvious phenotype was observed in fox-1(
) XX animals.
fox-1(
) rescues XO-specific lethality caused by duplications of the left end of the X:
fox-1(
) removes the RRM domain, the only functional domain predicted at the sequence level, and yet fox-1(
) XX animals show no phenotype. To establish if the deletion represented a null mutation, we tested the ability of fox-1(
) to rescue the XO-specific lethality caused by the duplications of the left end of the X.
fox-1 was identified as a result of analysis of eDp26, an XO lethal and feminizing duplication that increases the dose of the numerators (![]()
) is a biological null, then males carrying fox-1(
) and eDp26 should be viable. Unexpectedly, the desired recombination event, which would put fox-1(
) and eDp26 on the same chromosome, was never achieved despite very extensive screens. Snapback pairing of eDp26, which is attached in inverted orientation to the left end of the X, probably leads to a complete suppression of recombination in this region. Another duplication, yDp13, slightly larger than eDp26 but otherwise equivalent, was used in the same experiment (see Figure 6). Unlike eDp26, yDp13 is a free duplication that makes genetic manipulation easier. The results are presented in Table 1. XO males that are fox-1(
) and carry yDp13 are ~95% viable, in contrast with yDp13 XO males that are ~4% viable. Therefore fox-1 is wholly or largely responsible for XO-specific lethality caused by yDp13, since fox-1(
) is capable of rescuing XO-specific effects of this duplication. This finding is consistent with the deletion being a loss-of-function allele.
|
|
fox-1(
) synergizes with putative numerator elements:
fox-1(
) hermaphrodites appear morphologically and behaviorally wild type. Because there are at least four putative numerator elements in the worm (![]()
![]()
) males were crossed with hermaphrodites carrying meDf6, a deletion of the left end of the X that removes the putative numerator elements from regions 1 and 2. fox-1(
) and meDf6 XX hermaphrodites appear wild type, but XX hermaphrodites that are hemizygous for the two putative elements, i.e., fox-1(
)/meDf6, are often masculinized and dumpy (Figure 6). The masculinization manifests itself through a truncated tail spike (hermaphrodites have a long, pointy tail spike), deformed gonad, and vulval abnormalities. There also appear to be germline problems, although these were not extensively investigated. The animals are often constipated, sometimes severely, resulting in the tail end bursting open as a result of the pressure in the gut. The dumpiness is assumed to be a result of inappropriate dosage compensation. XX animals normally downregulate expression from both Xs to a level equivalent to that of a single male X. Masculinization results in a reduced or a complete lack of dosage compensation. Reducing the numerator dose further by removing both copies of fox-1 (fox-1(
)/fox-1(
) meDf6) does not appear to exacerbate the above phenotype. These results are in agreement with those of ![]()
fox-1 and meDf6 results show that, just as in Drosophila, in C. elegans the numerator function is partially redundant. It has been reported in Drosophila that the strength of the individual numerator elements can vary in different wild-type genetic backgrounds (![]()
) had a phenotype in XX animals, fox-1(
) was crossed into 11 different wild-type strains of C. elegans (see MATERIALS AND METHODS) and 50 F2 populations were examined for each strain. In all strains tested fox-1(
) was compatible with normal XX hermaphrodite development.
Genetic analysis of fox-1(
):
xol-1 is the predicted downstream target of fox-1. It is difficult to study this epistatic relationship directly because fox-1 and xol-1 exert their influence on opposite sexes (fox-1 in hermaphrodites and xol-1 in males). Therefore we examined the minor, XX-specific function of xol-1. This way the phenotypic effects of fox-1 and xol-1 can both be analyzed in XX animals. The xol-1 XX-specific feminizing role can be seen in tra-2, tra-3, and her-1 backgrounds (![]()
![]()
![]()
) it might become more prominent in tra-2, tra-3, and her-1 XX animals. Moreover, because the role of fox-1 is opposite to that of xol-1, the effects of fox-1(
) should be comparable to xol-1 overexpression and vice versa. The details of the double mutant analysis for fox-1(
) and tra-2, tra-3, and tra-1 are shown in Table 2. The effects of fox-1(
); tra-2 XX double mutant combinations on the XX male tail morphology can be seen in Figure 7. Sexual transformation in tra-2 and tra-3 XX animals, which also carry a deletion at the fox-1 locus, is poorer than in tra-2 or tra-3 XX animals alone. The effect is particularly pronounced within the copulatory structures of the male tail. There is a marked reduction in the fan size, and the continuity of the fan is often broken. Ray morphology is variable (often short and stumpy), with frequent reduction in ray number. In most cases the whole fan structure is almost completely absent and there is no appreciable regression of the cytoplasm from the distal regions of the tail. The animals are also often severely constipated. Constipation is probably due to a defect in the anatomy of the cloaca, a side effect of the morphological abnormalities of the tail.
|
|
To test whether the feminization of tra-2 XX animals caused by fox-1(
) is dependent on the wild-type function of xol-1, we examined fox-1(
) xol-1(y9); tra-2(e1095) XX animals. xol-1(y9) completely removes xol-1 activity (![]()
) xol-1(y9); tra-2(e1095) XX animals are no longer feminized. They are phenotypically indistinguishable from xol-1(y9); tra-2(e1095) XX. This observation confirms that xol-1 is epistatic to fox-1 and that feminization caused by fox-1(
) requires wild-type function of xol-1.
The effects of fox-1(
) were also examined in the unusual tra-2 allele, q276 (P. E. KUWABARA and T. SCHEDL, unpublished results). Unlike tra-2(e1095) XX, which do not mate, q276 XX animals are mating males, although the mating efficiency is lower than that of the wild type. fox-1(
); tra-2(q276) XX males are more similar to tra-2(e1095) in a behavioral sense. fox-1(
); tra-2(q276) XX males show very little interest in hermaphrodites. Occasionally, one will pause by a hermaphrodite and initiate the typical mating behavior of tracking along the hermaphrodite body. The male almost invariably falls off the head or tail and loses contact with the hermaphrodite body. In most cases tracking is not reinitiated. Such behavior is assessed as poor according to the Loer and Kenyon assay (![]()
|
Genetic analysis of fox-1(gf):
Genetic analysis of fox-1(gf) and tra-1, tra-2, tra-3, and her-1 yielded reciprocal results to those obtained from fox-1(
) analysis (Table 4). The effects of fox-1(gf) in tra-2 and tra-3 animals are to shift the phenotype toward more complete masculinization (Figure 7). However, fox-1(gf); tra-2 XX animals are not transformed into complete males, as seen in xol-1; tra-2 XXs. Despite their almost wild-type morphology, they do not show mating behavior. The alteration in brood profile in fox-1(gf); her-1 XXs (see Table 4) is probably not significant; however, it is consistent with the mild masculinizing effects seen in tra-2 and tra-3 animals. The shift toward stronger masculinization of tra-2, tra-3, and her-1 animals by fox-1(gf) is comparable with that of weak xol-1 alleles, e.g., y70 (![]()
![]()
![]()
![]()
![]()
|
The same overall phenotypic tendency seen in sexually sensitized backgrounds is weakly detectable in XX animals that are only mutant at the fox-1 locus. fox-1(
) hermaphrodites have reduced brood size (mean = 256 ± 36, N = 10 broods, range 213329; wild-type figures, mean = 329 ± 32, N = 12 broods, range 274374). The brood sizes of additionally outcrossed fox-1(
) hermaphrodites are also reduced (mean = 254 ± 28, N = 12, range 211309). Broods for fox-1(
) xol-1, however, are close to wild type (mean = 310 ± 22, N = 6, range 288339).
fox-1 expression levels influence the levels of xol-1 2.2-kb message:
Our genetic analysis suggests that fox-1 overexpression leads to downregulation of xol-1, while removing fox-1 leads to xol-1 upregulation. We investigated the possibility that xol-1 transcript levels may be altered in fox-1 mutant backgrounds. FOX-1 is an RNA-binding protein; therefore its involvement in post-transcriptional regulation of its target would not be unexpected. Furthermore, ![]()
![]()
); him-8, (3) him-8, and (4) xol-1; him-8. xol-1 messages are 10-fold more abundant in XOs than in XXs; therefore, to facilitate xol-1 message detection we used him-8 strains to enrich the population in XO animals. Broods of him-8 hermaphrodites are 38% male, as a result of increased incidence of X chromosome nondisjunction (![]()
); him-8 strain the level of the same xol-1 message is increased (Figure 8).
|
fox-1 has a late function, distinct from its role as a numerator:
The function of a numerator element in C. elegans is presumed to be over by the time dosage compensation becomes activated, which corresponds to the 30-cell stage of embryogenesis. It is intriguing to find fox-1 expressed beyond embryonic development. This phenomenon could be either fortuitous or indicative of a late requirement for fox-1 in some aspect of worm development. It would not be without precedent. In Drosophila, for example, there is evidence for the involvement of some numerator elements in neural development. Further characterization revealed that the mating efficiency of fox-1(
) XO males is lower than wild type. Total progeny sired by single males from fox-1(
) and wild-type strains were counted (Table 3). The average number of progeny sired by a single fox-1(
) XO male is approximately one-half of the wild-type value. To test whether fox-1 effects on male mating efficiency are xol-1 dependent, xol-1; tra-2(e1095) XX males were compared with fox-1(
) xol-1; tra-2(e1095) XX males for their mating efficiency. If fox-1 acts through xol-1 in a relationship similar to that seen during primary sex determination, then xol-1 should be epistatic to fox-1, and no difference between xol-1; tra-2(e1095) and fox-1(
) xol-1; tra-2 XX males should be observed. It is evident from Table 3 that xol-1 is not epistatic to fox-1(
) in this interaction, because fox-1(
) xol-1; tra-2(e1095) XX males sire significantly fewer progeny than xol-1; tra-2(e1095) XX males. These results suggest that fox-1 effects on male mating are not mediated via xol-1. The effects of fox-1(
) on male mating efficiency in the tra-2(e1095) background are similar to those observed in tra-2(q276) background (see above and Table 2 and Table 3). To exclude the possibility that this reduction in male mating efficiency was due to genetic factors other than fox-1(
), a series of crosses was designed to outcross the deletion from any closely linked factors. Because the deletion was isolated from a strain with a high Tc1 transposon copy number, a possibility existed that the observed mating effects were due to a high genetic load caused by a high transposition rate. The strategy adopted to outcross fox-1(
) is described in detail in MATERIALS AND METHODS. The males from the outcrossed strain were tested for their mating efficiency. As can be seen in Table 3, the number of progeny sired by single outcrossed males is on average the same as for the previous fox-1(
) strain. Therefore we conclude that fox-1(
) is responsible for the observed effects on mating efficiency.
| DISCUSSION |
|---|
FOX-1 is an RNA-binding protein involved in the assessment of the X:A ratio in the initial stages of sex determination and dosage compensation in C. elegans. We describe construction and analysis of a Tc1-derived deletion within the fox-1 locus and present genetic and molecular evidence to establish the role of fox-1 as a numerator element. We show that fox-1 influences the sex determination and dosage compensation pathway probably by regulating the levels of the 2.2-kb transcript of xol-1. Furthermore, we describe a postembryonic function for fox-1, which is distinct from its role as a numerator element.
Duplication of the left end of the X chromosome results in XO-specific feminization and lethality due to an increase in the number of numerator elements that act to downregulate xol-1 activity. We have generated a deletion that removes 1.2 kb of fox-1 genomic sequence, including the RRM domain. Its ability to rescue XO-specific feminization and lethality caused by duplications of the left end of the X demonstrates that it is a bona fide loss-of-function allele. The duplication used in our analysis, yDp13, duplicates two distinct regions with putative numerator function, as well as fox-1. The ability of fox-1(
) to almost completely rescue the XO effects of yDp13 argues that fox-1 is by far the strongest element in this part of the chromosome.
A strong numerator element might be expected to have reciprocal effects in XX and XO animals, such that overexpression in XO should result in a strong feminization and lethality, while loss of function should have reciprocal effects in XX. This is not the case for fox-1. Although increasing the dose of fox-1 is almost completely lethal to XOs, fox-1(
) XX animals develop as apparently normal hermaphrodites. Comparable genetic behavior, revealing that numerator elements are not equipotent and can be redundant, has been demonstrated in Drosophila (![]()
![]()
![]()
) nor meDf6, which removes two putative numerator elements, has a phenotype on its own in XXs, both synergize in trans to result in strong dumpy and partially masculinized hermaphrodites. fox-1 therefore has both reciprocal functions expected from a numerator element, but its loss in XX animals is masked by contributions from other numerators.
It is conceivable that in different biological contexts the relative importance of the same signal will vary. This phenomenon was reported in Drosophila (![]()
) in 11 different wild-type genetic backgrounds in an attempt to
nd an XX-specific fox-1(
) phenotype. In contrast with the fly, the partial numerator redundancy is robust in the worm (at least in the case of fox-1), because no abnormal phenotypes were ever observed in any of the hybrid strains tested.
fox-1 may be dispensable for hermaphrodite development, but its overexpression has strong lethal and feminizing effects in XOs (![]()
![]()
) XX animals the expression of numerators that control xol-1 at transcriptional levels is wild type. Transcriptional control is the primary stage in xol-1 regulation and accounts for about a 10-fold difference in xol-1 levels between the sexes (![]()
) XX animals transcriptional repression is administered correctly by other numerator elements. It seems that in this case a further post-transcriptional repression is not critical; therefore its absence in fox-1(
) animals is of no great consequence. In other words, the absence of a repressor when its target is already repressed will go unnoticed.
In contrast to the XXs, it is important that XOL-1 levels are high in the XOs, because XOL-1 activity directs the male mode of development. When fox-1 is overexpressed, the levels of transcriptional regulators of xol-1 remain low, allowing for a higher transcription of xol-1. However, xol-1 transcripts have to be processed correctly to achieve high levels of a 2.2-kb message, which is both necessary and sufficient for all known xol-1 functions (![]()
![]()
![]()
The observation that fox-1 overexpression does not completely eliminate the 2.2-kb xol-1 message probably accounts for the fact that the effects of fox-1(gf) are less strong than xol-1(lf) in some of the genetic experiments. xol-1 is an XO-specific gene, responsible for the male mode of development. fox-1(gf) effectively mimics the xol-1 XO lethal and feminizing phenotype in XO animals, suggesting it sufficiently reduces the levels of xol-1 function for sex determination and dosage compensation. However, xol-1 also has a minor XX-specific role. A weak feminizing effect can be seen in sexually transformed XX animals, e.g., tra-2 XXs. tra-2 XXs develop into nonmating pseudomales, but tra-2; xol-1 XXs develop into complete males capable of mating (![]()
Interestingly, fox-1(gf); tra-2 XX animals resemble xol-1; tra-2 XX animals morphologically, but not behaviorally. It seems that xol-1 influences morphology and behavior at two distinct times in development, L3 and L4, respectively (![]()
An indication of an additional late fox-1 function came from a comparison of male mating efficiencies between fox-1(
) and wild type. fox-1(
) males consistently sired fewer progeny. This function of fox-1 appears to be xol-1 independent, because fox-1(
) xol-1; tra-2 males sire significantly fewer progeny than xol-1; tra-2. Therefore fox-1 must have another target or targets, whose nature is yet unknown. The existence of a late function is further supported by the results of our expression studies. We found a very restricted expression pattern of fox-1::lacZ transgenes, which we suggest is neuronal. Western analysis of staged animals also shows clearly that FOX-1 protein is present throughout the life of the animal. Multiple forms of the protein are observed throughout development. The two different transcripts of fox-1 could account for a subset of the protein products observed. In fact, animals that express only the shorter SL1-spliced transcript produce only the 44- and 45-kD forms of FOX-1 as detected on Western blots. The presence of two different-sized products from one transcript suggests there may be some form of post-translational modification of the protein that may be involved in its activity. The significance of the two different starts is unclear as the additional 39 amino acids found in the longer ORF have no obviously remarkable features. The multiple forms of the protein raise the possibility of division of labor, with some forms being involved in early function and others responsible for the late effects. All four forms are observed in L4/adult populations of males so none of the forms can be ruled out for providing the late activity. The predominance of the 45-kD form of FOX-1 in the embryo may indicate that it is this form that is responsible for the early functions in sex determination or it may simply reflect an increased stability or more efficient processing of the shorter SL1-spliced transcript. Evidence suggests that both the long and short transcripts of fox-1 are sufficient to cause XO lethality when overexpressed in males (data not shown).
Defects in mating efficiency can result from a lack of interest in hermaphrodites or from a reduced sperm count. We suggest that fox-1(
) XO male mating deficiency has a behavioral cause, because rare males manage to sire almost-wild-type numbers of progeny. We suggest that the reduced male mating efficiency and the smaller brood sizes, which reveal the late function of fox-1, represent its ancestral role. The finding of a surprisingly conserved human homologue (68% identical within the RRM domain; J. COLLINS, unpublished results, EMBL accession number AL009266) further suggests the involvement of fox-1 in a process other than sex determination. Such high homology is unlikely to be fortuitous, especially in view of well-documented rapid divergence of sex-determining genes (![]()
![]()
![]()
The uncovering of fox-1 involvement in male mating behavior forms an interesting parallel with the Drosophila system in which many numerator elements are also involved in aspects of neural development.
The genetic and molecular data presented here strongly argue in favor of a model in which fox-1 is one of a small number of numerator elements whose function is to downregulate xol-1 at the post-transcriptional level. Due to a redundancy among the elements, removing fox-1 in XX animals results in normal development. The loss of one numerator is compensated for by the others. However, adding multiple copies of fox-1 in the XO animals disturbs the balance beyond compensation. fox-1 overexpression is capable of downregulating xol-1 sufficiently in XO animals to result in their death and feminization. However, it is not able to eliminate completely the XX-specific xol-1-dependent feminization. We demonstrate that altering the levels of fox-1 results in reciprocal changes in the levels of the functional xol-1 message, so that removing fox-1 leads to increased levels of xol-1, while fox-1 overexpression leads to a reduction, but not complete elimination, of xol-1. We suggest that this reduction in xol-1 levels is sufficient to cause strong XO lethality and feminization, but is insufficient to mimic the effects of xol-1 loss of function in XXs.
| ACKNOWLEDGMENTS |
|---|
We thank Shawn Ahmed, Marc Bickle, and Alison Woollard for comments on the manuscript and all members of our laboratory, as well as Patty Kuwabara and Julie Ahringer, for support and discussion. Tc1 insertions in fox-1 were isolated by M.S. in the laboratory of Ronald Plasterk at the Netherlands Cancer Institute, Amsterdam. This work was supported by the Medical Research Councils of Great Britain and Canada, the Human Frontier Science Program, and the Howard Hughes Medical Institute. Some stocks were provided by the Caenorhabditis Genetic Center.
Manuscript received August 31, 1998; Accepted for publication November 2, 1998.
| LITERATURE CITED |
|---|
AKERIB, C. C. and B. J. MEYER, 1994 Identification of X chromosome regions in C. elegans that contain sex-determination signal elements. Genetics 138:1105-1125[Abstract].
CLINE, T. W., 1988 Evidence that sisterless a and sisterless b are two of several discrete "numerator elements" of the X/A sex determination signal in Drosophila that switch Sxl between two alternative stable expression states. Genetics 119:829-862
CLINE, T. W. and B. J. MEYER, 1997 Vive la difference: males vs. females in flies vs. worms. Annu. Rev. Genet. 30:637-702[Medline].
DE BONO, M. and J. HODGKIN, 1996 Evolution of sex determination in Caenorhabditis elegans: unusually high divergence of tra-1 and its functional consequences. Genetics 144:587-595[Abstract].
FIRE, A., 1986 Integrative transformation of Caenorhabditis elegans.. EMBO J. 5:2673-2680[Medline].
FROHMAN, M. A., M. K. DUSH, and G. R. MARTIN, 1988 Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer. Proc. Natl. Acad. Sci. USA 85:8998-9002
HARLOW, E., and D. LANE, 1988 Antibodies: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
HIGUCHI, R., 1990 Recombinant PCR, pp. 177183 in PCR Protocols, A Guide to Methods and Applications, edited by M. A. INNIS, D. H. GELFAND, J. J. SNINSKY and T. J. WHITE. Academic Press, San Diego.
HO, S. N., H. D. HUNT, R. M. HORTON, J. K. PULLEN, and L. R. PEASE, 1989 Site directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 77:51-59[Medline].
HODGKIN, J., 1992 Genetic sex determination mechanisms and evolution. BioEssays 14:253-261[Medline].
HODGKIN, J. and S. BRENNER, 1977 Mutations causing transformation of sexual phenotype in the nematode Caenorhabditis elegans.. Genetics 91:67-94.
HODGKIN, J. and T. DONIACH, 1997 Natural variation and copulatory plug formation in Caenorhabditis elegans. Genetics 146:149-164[Abstract].
HODGKIN, J., H. R. HORVITZ, and S. BRENNER, 1979 Nondisjunction mutants of the nematode Caenorhabditis elegans.. Genetics 91:67-94
HODGKIN, J., J. D. ZELLAN, and D. G. ALBERTSON, 1994 Identification of a candidate primary sex determination locus, fox-1, on the X chromosome of Caenorhabditis elegans.. Development 120:3681-3689[Abstract].
HORVITZ, H. R., S. BRENNER, J. HODGKIN, and R. K. HERMAN, 1979 A uniform genetic nomenclature for the nematode Caenorhabditis elegans.. Mol. Gen. Genet. 175:129-133[Medline].
HSU, D. R. and B. J. MEYER, 1993 X chromosome dosage compensation and its relationship to sex determination in C. elegans. Semin. Dev. Biol. 4:93-106.
KUWABARA, P. E., 1996 A novel regulatory mutation in the C. elegans sex determining gene tra-2 defines a candidate ligand/receptor interaction site. Development 122:2089-2098[Abstract].
LEWIS, J. A., and J. T. FLEMING, 1995 Basic culture methods, pp. 427 in Caenorhabditis elegans: Modern Biological Analysis of an Organism, edited by H. F. EPSTEIN and D. C. SHAKES. Academic Press, San Diego.
LOER, C. M. and C. J. KENYON, 1993 Serotonin-deficient mutants and male mating behavior in the nematode Caenorhabditis elegans.. J. Neurosci. 13:5407-5417[Abstract].
MADL, J. E. and R. K. HERMAN, 1979 Polyploids and sex determination in Caenorhabditis elegans.. Genetics 93:393-402
MEYER, B. J., 1997 Sex determination and X chromosome dosage compensation, pp. 209240 in C. elegans II edited by D. L. RIDDLE, T. BLUMENTHAL, B. J. MEYER and J. R. PRIESS. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
MILLER, L. M., J. D. PLENEFISCH, L. P. CASSON, and B. J. MEYER, 1988 xol-1: a gene that controls the male modes of both sex determination and X chromosome dosage compensation in C. elegans.. Cell 55:167-183[Medline].
NICOLL, M., C. C. AKERIB, and B. J. MEYER, 1997 X-chromosome-counting mechanisms that determine nematode sex. Nature 388:200-204[Medline].
PARKHURST, S. M. and P. M. MENEELY, 1994 Sex determination and dosage compensation: lessons from flies and worms. Science 264:924-932
PLASTERK, R. H. A., 1992 Reverse genetics of Caenorhabditis elegans.. BioEssays 14:629-633[Medline].
PULAK, R. and P. ANDERSON, 1993 mRNA surveillance by the Caenorhabditis elegans smg genes. Genes Dev. 7:1885-1897
RHIND, N. R., L. M. MILLER, J. B. KOPCZYNSKI, and B. J. MEYER, 1995 xol-1 acts as an early switch in the C. elegans male/hermaphrodite decision. Cell 80:71-82[Medline].
SANGER, F., S. NICKLEN, and A. R. COULSON, 1977 DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463-5467
SIKORSKI, R. S. and P. HIETER, 1989 A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saachromyces cerevisiae.. Genetics 122:19-27
SULSTON, J. E., and J. HODGKIN, 1988 Methods, pp. 587606 in The Nematode Caenorhabditis elegans, edited by W. B. WOOD. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
SWANSON, M. S. and G. DREYFUSS, 1988 RNA-binding specificity of HNRNP proteins: a subset bind to the 3' end of introns. EMBO J. 7:3519-3529[Medline].
TRENT, C., W. B. WOOD, and H. R. HORVITZ, 1988 A novel dominant transformer allele of the sex-determining gene her-1 of Caenorhabditis elegans.. Genetics 120:145-157
WHITFIELD, L. S., R. LOVELL-BADGE, and P. N. GOODFELLOW, 1993 Rapid sequence evolution of the mammalian sex-determining gene SRY.. Nature 364:713-715[Medline].
WILLIAMS, B. D., B. SCHRANK, C. HUYNH, R. SHOWNKEEN, and R. H. WATERSTON, 1992 A genetic mapping system in Caenorhabditis elegans based on polymorphic sequence-tagged sites. Genetics 131:609-624[Abstract].
WOOD, W. B., 1988 The Nematode Caenorhabditis elegans. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
ZARKOWER, D. and J. HODGKIN, 1992 Molecular analysis of the C. elegans sex-determining gene tra-1: a gene encoding two zinc finger proteins. Cell 70:237-249[Medline].
ZORN, A. M. and P. A. KRIEG, 1997 The KH domain protein encoded by quaking functions as a dimer and is essential for notochord development in Xenopus embryos. Genes Dev. 11:2176-2190
ZWAAL, R. R., A. BROEKS, A. VAN MEURS, J. T. M. GROENEN, and R. H. A. PLASTERK, 1993 Target-selected gene inactivation in Caenorhabditis elegans by using a frozen transposon insertion mutant bank. Proc. Natl. Acad. Sci. USA 90:7431-7435
This article has been cited by other articles:
![]() |
J. G. Underwood, P. L. Boutz, J. D. Dougherty, P. Stoilov, and D. L. Black Homologues of the Caenorhabditis elegans Fox-1 Protein Are Neuronal Splicing Regulators in Mammals Mol. Cell. Biol., November 15, 2005; 25(22): 10005 - 10016. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-i. Ogura, N. Kishimoto, S. Mitani, K. Gengyo-Ando, and Y. Kohara Translational control of maternal glp-1 mRNA by POS-1 and its interacting protein SPN-4 in Caenorhabditis elegans Development, June 1, 2003; 130(11): 2495 - 2503. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. G. Luz, C. A. Hassig, C. Pickle, A. Godzik, B. J. Meyer, and I. A. Wilson XOL-1, primary determinant of sexual fate in C. elegans, is a GHMP kinase family member and a structural prototype for a class of developmental regulators Genes & Dev., April 15, 2003; 17(8): 977 - 990. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Norris, D. Fan, A. Sherk, and D. P. McDonnell A Negative Coregulator for the Human ER Mol. Endocrinol., March 1, 2002; 16(3): 459 - 468. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. E. Wolf, J. A. Satkoski, K. White, and L. H. Rieseberg Sex Determination in the Androdioecious Plant Datisca glomerata and Its Dioecious Sister Species D. cannabina Genetics, November 1, 2001; 159(3): 1243 - 1257. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Carmi and B. J. Meyer The Primary Sex Determination Signal of Caenorhabditis elegans Genetics, July 1, 1999; 152(3): 999 - 1015. [Abstract] [Full Text] |
||||
- THIS ARTICLE
-
Abstract
- Full Text (PDF)
- Alert me when this article is cited
- Alert me if a correction is posted
- SERVICES
- Email this article to a friend
- Similar articles in this journal
- Similar articles in PubMed
- Alert me to new issues of the journal
- Download to citation manager
- Reprints & Permissions
- CITING ARTICLES
- Citing Articles via HighWire
- Citing Articles via Google Scholar
- GOOGLE SCHOLAR
- Articles by Skipper, M.
- Articles by Hodgkin, J.
- Search for Related Content
- PUBMED
- PubMed Citation
- Articles by Skipper, M.
- Articles by Hodgkin, J.












